Accession ID: MIRT000012 [miRNA, hsa-miR-122-5p :: CYP7A1, target gene]
| pre-miRNA ID | hsa-mir-122LinkOut: [miRBase ] |
|---|---|
| Synonyms | MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122 |
| Description | Homo sapiens miR-122 stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
| 2nd Structure of pre-miRNA |  |
| Disease |
|
| Mature miRNA | hsa-miR-122-5p |
|---|---|
| Mature Sequence | 15| UGGAGUGUGACAAUGGUGUUUG |36 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-122-5p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
| Gene Symbol | CYP7A1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Synonyms | CP7A, CYP7, CYPVII | ||||||||||||||||||||
| Description | cytochrome P450, family 7, subfamily A, polypeptide 1 | ||||||||||||||||||||
| Transcript | NM_000780 LinkOut: [ RefSeq ] | ||||||||||||||||||||
| Expression | LinkOut: [ BioGPS ] | ||||||||||||||||||||
| Putative miRNA Targets on CYP7A1 | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] | ||||||||||||||||||||
| 3'UTR of CYP7A1 (miRNA target sites are highlighted) |
>CYP7A1|NM_000780|3'UTR 1 ATACATGGCTGGAATAAGAGGACACTAGATGATATTACAGGACTGCAGAACACCCTCACCACACAGTCCCTTTGGACAAA 81 TGCATTTAGTGGTGGTAGAAATGATTCACCAGGTCCAATGTTGTTCACCAGTGCTTGCTTGTGAATCTTAACATTTTGGT 161 GACAGTTTCCAGATGCTATCACAGACTCTGCTAGTGAAAAGAACTAGTTTCTAGGAGCACAATAATTTGTTTTCATTTGT 241 ATAAGTCCATGAATGTTCATATAGCCAGGGATTGAAGTTTATTATTTTCAAAGGAAAACACCTTTATTTTATTTTTTTTC 321 AAAATGAAGATACACATTACAGCCAGGTGTGGTAGCAGGCACCTGTAGTCTTAGCTACTCGAGAGGCCAAAGAAGGAGGA 401 TGGCTTGAGCCCAGGAGTTCAAGACCAGCCTGGACAGCTTAGTGAGATCCCGTCTCCGAAGAAAAGATATGTATTCTAAT 481 TGGCAGATTGTTTTTTCCTAAGGAAACTGCTTTATTTTTATAAAACTGCCTGACAATTATGAAAAAATGTTCAAATTCAC 561 GTTCTAGTGAAACTGCATTATTTGTTGACTAGATGGTGGGGTTCTTCGGGTGTGATCATATATCATAAAGGATATTTCAA 641 ATGATTATGATTAGTTATGTCTTTTAATAAAAAGGAAATATTTTTCAACTTCTTCTATATCCAAAATTCAGGGCTTTAAA 721 CATGATTATCTTGATTTCCCAAAAACACTAAAGGTGGTTTTATTTTCCCTTCATGTTTTAACTTATTGTTGCTGAAAACT 801 CTATGTCCGGCTTTAACTATCTTCTCTATATTTTTATTTCATTCACATTAATGAGAAGAGTTTTCTCAGAGATTAAAAAA 881 GGTAGTTTTTCTGTCATTGTTAAATACACATTATCACTGAAAAAATGTAGCTTTTATGTGATATGTTTTAAAGTTAAAAC 961 TGGATGGAAATAGCCATTTGGAAGCTTTGGTTATGAAACATGTGGAGTGTATTAAGTGCAGCTTGACATTATGTTTTATT 1041 TAAATGCTTTTTATCGCTAAATGACTTGCAGATGAAAAAAACTAAGGTGACTCGAGTGTTTAAATGCTGTGTACAACAAT 1121 GCTTTGATAAAATATTTTAAGTATGAGTTATCAGCTCTATGTCAATTGATATTTCTGTGTAGTATTTATATTTAAATTAT 1201 ATTTACCTTTTTGCTTATTTTACAAATATTAAGAAAATATTCTAACATTTGATAATTTTGAAATGATTCATCTTTCAGAA 1281 ATAAAAGTATGAATCTA Target sites
Provided by authors Predicted by miRanda |
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
| miRNA:Target | hsa-miR-122-5p :: CYP7A1 [ Functional MTI ] |
|---|---|
| Validation Method | qRT-PCR , Luciferase reporter assay , |
| Conditions | HepG2 |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , TargetScan , miRBase Target Database |
| Original Description (Extracted from the article) |
...
In this study we focused on miR-122a and miR-422a since putative binding sites for those two miRNAs are localized in the 3’-UTR of CYP7A1 mRNA. Inhibition of CYP7A1 mRNA expression by miR-122a-mimic and miR-422a-mimic, and stimulation by their inhibitors confirmed the inhibitory effect of these two miRNAs on CYP7A1 mRNA expression. Furthermore, miR-122a-mimic and miR-422a-mimic inhibit the activity of luciferase reporters containing miR-122a and miR-422a target sequences found in the 3’-UTR of human CYP7A1 mRNA. These results clearly demonstrated that these two miRNAs were functional in inhibiting CYP7A1 expression.// A putative miR-422a targeting sequence was located in the 3’-UTR of human CYP8B1 mRNA but was not functional.
Target validation of miR-122a and miR-422a on the 3’-UTR of human CYP7A1 mRNA//The miR-122a- and miR-422a-mimics nhibited, whereas their inhibitors stimulated CYP7A1 mRNA expression. These miRNAs specifically inhibited the activity of the CYP7A1-3’UTR reporter plasmids, and mutations of miRNA binding sites in 3’UTR abrogated miRNAs inhibition of reporter activity. These results suggest that miR-122a and miR-422a may destabilize mRNA to inhibit CYP7A1 expression.
... - Song, K. H. Li, T. Owsley, E. Chiang, J. Y., 2010, J Lipid Res. |
| Article |
- Song, K. H.
Li, T.
Owsley, E.
Chiang, J. Y. - J Lipid Res, 2010
Cholesterol 7alpha-hydroxylase (CYP7A1) plays a critical role in regulation of bile acid synthesis in the liver. CYP7A1 mRNAs have very short half-lives, and bile acids destabilize CYP7A1 mRNA via the 3'-untranslated region (3'-UTR). However, the underlying mechanism of translational regulation of CYP7A1 mRNA remains unknown. Screening of a human micro RNA (miRNA) microarray has identified five differentially expressed miRNAs in human primary hepatocytes treated with chenodeoxycholic acid, GW4064, or fibroblast growth factor (FGF)19. These compounds also significantly induced the expression of miR-122a, a liver-specific and the predominant miRNA in human hepatocytes. The putative recognition sequences for miR-122a and miR-422a were localized in the 3'-UTR of human CYP7A1 mRNA. The miR-122a and miR-422a mimics inhibited, whereas their inhibitors stimulated CYP7A1 mRNA expression. These miRNAs specifically inhibited the activity of the CYP7A1-3'-UTR reporter plasmids, and mutations of miRNA binding sites in 3'-UTR abrogated miRNA inhibition of reporter activity. These results suggest that miR-122a and miR-422a may destabilize CYP7A1 mRNA to inhibit CYP7A1 expression. However, these miRNAs did not play a role in mediating FGF19 inhibition of CYP7A1 transcription. Under certain conditions, miRNA may reduce CYP7A1 mRNA stability to inhibit bile acid synthesis, and the miR-122a antagomirs may stimulate bile acid synthesis to reduce serum cholesterol and triglycerides.
LinkOut: [PMID: 20351063]
|
MiRNA-Target Expression Profile:
|
|
MiRNA-Target Expression Profile(TCGA):
|
|
MiRNA-Target Interaction Network:
Functional analysis: [KEGG Pathway Enrichment] [Gene Ontology Enrichment]
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
Other evidence
534 hsa-miR-122-5p Target Genes:
Functional analysis: [KEGG Pathway Enrichment] [Gene Ontology Enrichment]
ID |
Target | Description | Validation methods |
 |
 |
||||||
| Strong evidence | Less strong evidence | ||||||||||
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000012 | CYP7A1 | cytochrome P450, family 7, subfamily A, polypeptide 1 |  |
|
|
3 | 1 | ||||
| MIRT000364 | IGF1R | insulin-like growth factor 1 receptor | |
|
|
|
4 | 3 | |||
| MIRT000365 | SRF | serum response factor (c-fos serum response element-binding transcription factor) | |
|
|
|
4 | 1 | |||
| MIRT000663 | RAC1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | |
|
2 | 1 | |||||
| MIRT000717 | RHOA | ras homolog family member A | |
|
2 | 2 | |||||
| MIRT003006 | CCNG1 | cyclin G1 | |
|
|
|
4 | 4 | |||
| MIRT003079 | GTF2B | general transcription factor IIB | |
|
2 | 1 | |||||
| MIRT003080 | GYS1 | glycogen synthase 1 (muscle) | |
|
|
|
4 | 2 | |||
| MIRT003081 | ANK2 | ankyrin 2, neuronal | |
|
|
3 | 1 | ||||
| MIRT003082 | NFATC2IP | nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein | |
|
|
3 | 1 | ||||
| MIRT003083 | ENTPD4 | ectonucleoside triphosphate diphosphohydrolase 4 | |
|
|
3 | 1 | ||||
| MIRT003084 | ANXA11 | annexin A11 | |
|
|
|
4 | 2 | |||
| MIRT003085 | ALDOA | aldolase A, fructose-bisphosphate | |
|
|
3 | 2 | ||||
| MIRT003086 | RAB6B | RAB6B, member RAS oncogene family | |
|
|
3 | 1 | ||||
| MIRT003087 | RAB11FIP1 | RAB11 family interacting protein 1 (class I) | |
|
|
|
4 | 2 | |||
| MIRT003088 | FOXP1 | forkhead box P1 | |
|
|
3 | 1 | ||||
| MIRT003089 | MECP2 | methyl CpG binding protein 2 (Rett syndrome) | |
|
|
3 | 2 | ||||
| MIRT003090 | NCAM1 | neural cell adhesion molecule 1 | |
|
|
|
4 | 3 | |||
| MIRT003091 | UBAP2 | ubiquitin associated protein 2 | |
|
|
3 | 1 | ||||
| MIRT003092 | TBX19 | T-box 19 | |
|
|
3 | 1 | ||||
| MIRT003093 | AACS | acetoacetyl-CoA synthetase | |
|
|
3 | 1 | ||||
| MIRT003094 | DUSP2 | dual specificity phosphatase 2 | |
|
|
3 | 1 | ||||
| MIRT003095 | ATP1A2 | ATPase, Na+/K+ transporting, alpha 2 polypeptide | |
|
|
3 | 1 | ||||
| MIRT003097 | MAPK11 | mitogen-activated protein kinase 11 | |
|
|
3 | 1 | ||||
| MIRT003098 | FUNDC2 | FUN14 domain containing 2 | |
|
|
3 | 1 | ||||
| MIRT003099 | AKT3 | v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) | |
|
|
3 | 3 | ||||
| MIRT003100 | TPD52L2 | tumor protein D52-like 2 | |
|
|
|
4 | 3 | |||
| MIRT003102 | GALNT10 | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) | |
|
|
3 | 1 | ||||
| MIRT003103 | G6PC3 | glucose 6 phosphatase, catalytic, 3 | |
|
|
|
4 | 2 | |||
| MIRT003104 | AP3M2 | adaptor-related protein complex 3, mu 2 subunit | |
|
|
3 | 1 | ||||
| MIRT003105 | SLC7A1 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | |
|
|
|
4 | 4 | |||
| MIRT003106 | XPO6 | exportin 6 | |
|
|
3 | 1 | ||||
| MIRT003107 | FOXJ3 | forkhead box J3 | |
|
|
3 | 1 | ||||
| MIRT003108 | SLC7A11 | solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 | |
|
|
3 | 1 | ||||
| MIRT003109 | TRIB1 | tribbles homolog 1 (Drosophila) | |
|
|
3 | 1 | ||||
| MIRT003110 | EGLN3 | egl nine homolog 3 (C. elegans) | |
|
|
3 | 1 | ||||
| MIRT003111 | NUMBL | numb homolog (Drosophila)-like | |
|
|
3 | 1 | ||||
| MIRT003112 | ADAM17 | ADAM metallopeptidase domain 17 | |
|
|
3 | 5 | ||||
| MIRT003727 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
|
|
3 | 2 | ||||
| MIRT003728 | FAM117B | family with sequence similarity 117, member B | |
|
|
3 | 1 | ||||
| MIRT004364 | BCL2L2 | BCL2-like 2 | |
|
|
|
4 | 2 | |||
| MIRT004527 | PRKAB1 | protein kinase, AMP-activated, beta 1 non-catalytic subunit | |
|
2 | 1 | |||||
| MIRT004879 | ADAM10 | ADAM metallopeptidase domain 10 | |
|
|
|
4 | 1 | |||
| MIRT005782 | ACVR1C | activin A receptor, type IC | |
1 | 1 | ||||||
| MIRT006123 | PRKRA | protein kinase, interferon-inducible double stranded RNA dependent activator | |
|
|
|
4 | 1 | |||
| MIRT006421 | WNT1 | wingless-type MMTV integration site family, member 1 | |
|
|
3 | 1 | ||||
| MIRT007007 | PTPN1 | protein tyrosine phosphatase, non-receptor type 1 | |
1 | 1 | ||||||
| MIRT007081 | NT5C3A | 5'-nucleotidase, cytosolic III | |
1 | 1 | ||||||
| MIRT007082 | P4HA1 | prolyl 4-hydroxylase, alpha polypeptide I | |
1 | 1 | ||||||
| MIRT007083 | ZNF395 | zinc finger protein 395 | |
1 | 1 | ||||||
| MIRT007084 | SOCS1 | suppressor of cytokine signaling 1 | |
1 | 1 | ||||||
| MIRT023217 | SSR3 | signal sequence receptor, gamma (translocon-associated protein gamma) | |
1 | 1 | ||||||
| MIRT023218 | PHOX2A | paired-like homeobox 2a | |
1 | 1 | ||||||
| MIRT023219 | DZIP1L | DAZ interacting protein 1-like | |
1 | 1 | ||||||
| MIRT023220 | GSTM2 | glutathione S-transferase mu 2 (muscle) | |
1 | 1 | ||||||
| MIRT023221 | RAI14 | retinoic acid induced 14 | |
1 | 1 | ||||||
| MIRT023222 | STARD13 | StAR-related lipid transfer (START) domain containing 13 | |
1 | 1 | ||||||
| MIRT023223 | CNN3 | calponin 3, acidic | |
1 | 1 | ||||||
| MIRT023224 | A2M | alpha-2-macroglobulin | |
1 | 1 | ||||||
| MIRT023225 | EFCAB6 | EF-hand calcium binding domain 6 | |
1 | 1 | ||||||
| MIRT023226 | GLOD4 | glyoxalase domain containing 4 | |
1 | 1 | ||||||
| MIRT023227 | CALR | calreticulin | |
1 | 1 | ||||||
| MIRT023228 | POFUT1 | protein O-fucosyltransferase 1 | |
1 | 1 | ||||||
| MIRT023229 | PYGO1 | pygopus homolog 1 (Drosophila) | |
1 | 1 | ||||||
| MIRT023230 | CDY2B | chromodomain protein, Y-linked, 2B | |
1 | 1 | ||||||
| MIRT023231 | CDC42EP3 | CDC42 effector protein (Rho GTPase binding) 3 | |
1 | 1 | ||||||
| MIRT023232 | CS | citrate synthase | |
|
2 | 2 | |||||
| MIRT023233 | RNF170 | ring finger protein 170 | |
|
2 | 2 | |||||
| MIRT023234 | GTF3C6 | general transcription factor IIIC, polypeptide 6, alpha 35kDa | |
1 | 1 | ||||||
| MIRT023235 | ZNF321P | zinc finger protein 321, pseudogene | |
1 | 1 | ||||||
| MIRT023236 | LAMP1 | lysosomal-associated membrane protein 1 | |
1 | 1 | ||||||
| MIRT023237 | SLC52A2 | solute carrier family 52, riboflavin transporter, member 2 | |
1 | 1 | ||||||
| MIRT023238 | ZNF658 | zinc finger protein 658 | |
1 | 1 | ||||||
| MIRT023239 | ATP13A3 | ATPase type 13A3 | |
1 | 1 | ||||||
| MIRT023240 | CPNE5 | copine V | |
1 | 1 | ||||||
| MIRT023241 | KATNAL1 | katanin p60 subunit A-like 1 | |
1 | 1 | ||||||
| MIRT023242 | TMEM136 | transmembrane protein 136 | |
1 | 1 | ||||||
| MIRT023243 | ATP11A | ATPase, class VI, type 11A | |
1 | 1 | ||||||
| MIRT023244 | TMEM74 | transmembrane protein 74 | |
1 | 1 | ||||||
| MIRT023245 | ANKRD10 | ankyrin repeat domain 10 | |
1 | 1 | ||||||
| MIRT023246 | TBL1XR1 | transducin (beta)-like 1 X-linked receptor 1 | |
1 | 1 | ||||||
| MIRT023247 | USP10 | ubiquitin specific peptidase 10 | |
1 | 1 | ||||||
| MIRT023248 | AKAP11 | A kinase (PRKA) anchor protein 11 | |
1 | 1 | ||||||
| MIRT023249 | BACH2 | BTB and CNC homology 1, basic leucine zipper transcription factor 2 | |
1 | 1 | ||||||
| MIRT023250 | HCCS | holocytochrome c synthase | |
1 | 1 | ||||||
| MIRT023251 | Slc7a1 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | |
1 | 1 | ||||||
| MIRT023252 | GTDC2 | glycosyltransferase-like domain containing 2 | |
1 | 1 | ||||||
| MIRT023253 | CTPS1 | CTP synthase 1 | |
1 | 1 | ||||||
| MIRT023254 | SLC44A1 | solute carrier family 44, member 1 | |
1 | 1 | ||||||
| MIRT023255 | CLSPN | claspin | |
1 | 1 | ||||||
| MIRT023256 | RABGEF1 | RAB guanine nucleotide exchange factor (GEF) 1 | |
1 | 1 | ||||||
| MIRT023257 | FBXO7 | F-box protein 7 | |
1 | 1 | ||||||
| MIRT023258 | NCDN | neurochondrin | |
1 | 1 | ||||||
| MIRT023259 | SOX2 | SRY (sex determining region Y)-box 2 | |
1 | 1 | ||||||
| MIRT023260 | ZNF618 | zinc finger protein 618 | |
1 | 1 | ||||||
| MIRT023261 | ABLIM1 | actin binding LIM protein 1 | |
1 | 1 | ||||||
| MIRT023262 | ZBTB4 | zinc finger and BTB domain containing 4 | |
1 | 1 | ||||||
| MIRT023263 | LUZP1 | leucine zipper protein 1 | |
1 | 1 | ||||||
| MIRT023264 | NLGN3 | neuroligin 3 | |
1 | 1 | ||||||
| MIRT023265 | PRR11 | proline rich 11 | |
1 | 1 | ||||||
| MIRT023266 | HHAT | hedgehog acyltransferase | |
1 | 1 | ||||||
| MIRT023267 | UBE2L3 | ubiquitin-conjugating enzyme E2L 3 | |
1 | 1 | ||||||
| MIRT023268 | DNAJC18 | DnaJ (Hsp40) homolog, subfamily C, member 18 | |
1 | 1 | ||||||
| MIRT023269 | FAM102A | family with sequence similarity 102, member A | |
1 | 1 | ||||||
| MIRT023270 | PFKFB2 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 | |
1 | 1 | ||||||
| MIRT023271 | DENND2C | DENN/MADD domain containing 2C | |
1 | 1 | ||||||
| MIRT023272 | HMOX1 | heme oxygenase (decycling) 1 | |
|
|
3 | 2 | ||||
| MIRT023273 | USP28 | ubiquitin specific peptidase 28 | |
1 | 1 | ||||||
| MIRT023274 | KRT18 | keratin 18 | |
1 | 1 | ||||||
| MIRT023275 | BPGM | 2,3-bisphosphoglycerate mutase | |
1 | 1 | ||||||
| MIRT023276 | ZNF233 | zinc finger protein 233 | |
1 | 1 | ||||||
| MIRT023277 | SLC25A30 | solute carrier family 25, member 30 | |
1 | 1 | ||||||
| MIRT023278 | ANKRD9 | ankyrin repeat domain 9 | |
|
2 | 2 | |||||
| MIRT023279 | RLN1 | relaxin 1 | |
1 | 1 | ||||||
| MIRT023280 | DDIT3 | DNA-damage-inducible transcript 3 | |
1 | 1 | ||||||
| MIRT023281 | TRIM65 | tripartite motif containing 65 | |
1 | 1 | ||||||
| MIRT023282 | B4GALT1 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | |
1 | 1 | ||||||
| MIRT023283 | ANXA7 | annexin A7 | |
1 | 1 | ||||||
| MIRT023284 | SLC19A2 | solute carrier family 19 (thiamine transporter), member 2 | |
1 | 1 | ||||||
| MIRT023285 | MARCKS | myristoylated alanine-rich protein kinase C substrate | |
1 | 1 | ||||||
| MIRT023286 | CLEC11A | C-type lectin domain family 11, member A | |
1 | 1 | ||||||
| MIRT023287 | CENPF | centromere protein F, 350/400kDa (mitosin) | |
1 | 1 | ||||||
| MIRT023288 | CLDN18 | claudin 18 | |
1 | 1 | ||||||
| MIRT023289 | PFDN1 | prefoldin subunit 1 | |
1 | 1 | ||||||
| MIRT023290 | SPAG9 | sperm associated antigen 9 | |
1 | 1 | ||||||
| MIRT023291 | CEACAM8 | carcinoembryonic antigen-related cell adhesion molecule 8 | |
1 | 1 | ||||||
| MIRT023292 | KRT10 | keratin 10 | |
1 | 1 | ||||||
| MIRT023293 | SET | SET nuclear oncogene | |
1 | 1 | ||||||
| MIRT023294 | SLC11A2 | solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 | |
1 | 1 | ||||||
| MIRT023295 | MYCBP | c-myc binding protein | |
|
2 | 2 | |||||
| MIRT023296 | GPHB5 | glycoprotein hormone beta 5 | |
1 | 1 | ||||||
| MIRT023297 | STAU2 | staufen, RNA binding protein, homolog 2 (Drosophila) | |
1 | 1 | ||||||
| MIRT023298 | NFATC1 | nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 | |
1 | 1 | ||||||
| MIRT023299 | ERP29 | endoplasmic reticulum protein 29 | |
1 | 1 | ||||||
| MIRT023300 | MEP1A | meprin A, alpha (PABA peptide hydrolase) | |
1 | 1 | ||||||
| MIRT023301 | SPTLC1 | serine palmitoyltransferase, long chain base subunit 1 | |
1 | 1 | ||||||
| MIRT023302 | GTF2H2 | general transcription factor IIH, polypeptide 2, 44kDa | |
1 | 1 | ||||||
| MIRT023303 | C14orf39 | chromosome 14 open reading frame 39 | |
1 | 1 | ||||||
| MIRT023304 | UBE2K | ubiquitin-conjugating enzyme E2K | |
1 | 1 | ||||||
| MIRT023305 | PPP1R9B | protein phosphatase 1, regulatory subunit 9B | |
1 | 1 | ||||||
| MIRT023306 | PSMD10 | proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 | |
1 | 1 | ||||||
| MIRT023307 | CALD1 | caldesmon 1 | |
1 | 1 | ||||||
| MIRT023308 | TTYH3 | tweety homolog 3 (Drosophila) | |
1 | 1 | ||||||
| MIRT023309 | NMNAT2 | nicotinamide nucleotide adenylyltransferase 2 | |
1 | 1 | ||||||
| MIRT023310 | SCN4B | sodium channel, voltage-gated, type IV, beta subunit | |
1 | 1 | ||||||
| MIRT023311 | C1orf122 | chromosome 1 open reading frame 122 | |
1 | 1 | ||||||
| MIRT023312 | PAK1 | p21 protein (Cdc42/Rac)-activated kinase 1 | |
1 | 1 | ||||||
| MIRT023313 | DNAJB1 | DnaJ (Hsp40) homolog, subfamily B, member 1 | |
1 | 1 | ||||||
| MIRT023314 | DMXL1 | Dmx-like 1 | |
1 | 1 | ||||||
| MIRT023315 | ZNF160 | zinc finger protein 160 | |
1 | 1 | ||||||
| MIRT023316 | CSRP1 | cysteine and glycine-rich protein 1 | |
1 | 1 | ||||||
| MIRT023317 | PHKA1 | phosphorylase kinase, alpha 1 (muscle) | |
1 | 1 | ||||||
| MIRT023318 | RBBP5 | retinoblastoma binding protein 5 | |
1 | 1 | ||||||
| MIRT023319 | ANKRD13C | ankyrin repeat domain 13C | |
1 | 1 | ||||||
| MIRT023320 | SUCLA2 | succinate-CoA ligase, ADP-forming, beta subunit | |
1 | 1 | ||||||
| MIRT023321 | PEA15 | phosphoprotein enriched in astrocytes 15 | |
1 | 1 | ||||||
| MIRT023322 | MTPN | myotrophin | |
1 | 1 | ||||||
| MIRT023323 | YKT6 | YKT6 v-SNARE homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT023324 | MOB3B | MOB kinase activator 3B | |
1 | 1 | ||||||
| MIRT023325 | FAM118A | family with sequence similarity 118, member A | |
1 | 1 | ||||||
| MIRT023326 | ZNF264 | zinc finger protein 264 | |
1 | 1 | ||||||
| MIRT023327 | HECTD3 | HECT domain containing E3 ubiquitin protein ligase 3 | |
1 | 1 | ||||||
| MIRT023328 | BATF2 | basic leucine zipper transcription factor, ATF-like 2 | |
1 | 1 | ||||||
| MIRT023329 | PIP4K2A | phosphatidylinositol-5-phosphate 4-kinase, type II, alpha | |
1 | 1 | ||||||
| MIRT023330 | MAPRE1 | microtubule-associated protein, RP/EB family, member 1 | |
1 | 1 | ||||||
| MIRT023331 | TBC1D22B | TBC1 domain family, member 22B | |
1 | 1 | ||||||
| MIRT023332 | SLC9A1 | solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 | |
|
2 | 2 | |||||
| MIRT023333 | NPEPPS | aminopeptidase puromycin sensitive | |
1 | 1 | ||||||
| MIRT023334 | BCL2L1 | BCL2-like 1 | |
|
2 | 1 | |||||
| MIRT023335 | OSMR | oncostatin M receptor | |
1 | 1 | ||||||
| MIRT023336 | CALU | calumenin | |
1 | 1 | ||||||
| MIRT023337 | BRI3BP | BRI3 binding protein | |
1 | 1 | ||||||
| MIRT023338 | PSPH | phosphoserine phosphatase | |
1 | 1 | ||||||
| MIRT023339 | APMAP | adipocyte plasma membrane associated protein | |
1 | 1 | ||||||
| MIRT023340 | WASF1 | WAS protein family, member 1 | |
1 | 1 | ||||||
| MIRT023341 | LCA5 | Leber congenital amaurosis 5 | |
1 | 1 | ||||||
| MIRT023342 | NODAL | nodal homolog (mouse) | |
1 | 1 | ||||||
| MIRT023343 | CASP7 | caspase 7, apoptosis-related cysteine peptidase | |
1 | 1 | ||||||
| MIRT023344 | CPA3 | carboxypeptidase A3 (mast cell) | |
1 | 1 | ||||||
| MIRT023345 | PALM | paralemmin | |
1 | 1 | ||||||
| MIRT023346 | TCP11 | t-complex 11, testis-specific | |
1 | 1 | ||||||
| MIRT023347 | NALCN | sodium leak channel, non-selective | |
1 | 1 | ||||||
| MIRT023348 | PLAGL2 | pleiomorphic adenoma gene-like 2 | |
1 | 1 | ||||||
| MIRT023349 | IDS | iduronate 2-sulfatase | |
|
2 | 2 | |||||
| MIRT023350 | PARP11 | poly (ADP-ribose) polymerase family, member 11 | |
1 | 1 | ||||||
| MIRT023351 | MAZ | MYC-associated zinc finger protein (purine-binding transcription factor) | |
1 | 1 | ||||||
| MIRT023352 | CPNE4 | copine IV | |
1 | 1 | ||||||
| MIRT023353 | FAM19A3 | family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 | |
1 | 1 | ||||||
| MIRT023354 | KRT14 | keratin 14 | |
1 | 1 | ||||||
| MIRT023355 | DYNC1H1 | dynein, cytoplasmic 1, heavy chain 1 | |
1 | 1 | ||||||
| MIRT023356 | GNL3L | guanine nucleotide binding protein-like 3 (nucleolar)-like | |
1 | 1 | ||||||
| MIRT023357 | HLA-DQA1 | major histocompatibility complex, class II, DQ alpha 1 | |
1 | 1 | ||||||
| MIRT023358 | EYA4 | eyes absent homolog 4 (Drosophila) | |
1 | 1 | ||||||
| MIRT023359 | GNPDA2 | glucosamine-6-phosphate deaminase 2 | |
1 | 1 | ||||||
| MIRT023360 | BRCA2 | breast cancer 2, early onset | |
1 | 1 | ||||||
| MIRT023361 | ZSCAN4 | zinc finger and SCAN domain containing 4 | |
1 | 1 | ||||||
| MIRT023362 | HSPA5 | heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) | |
1 | 1 | ||||||
| MIRT023363 | SERAC1 | serine active site containing 1 | |
1 | 1 | ||||||
| MIRT023364 | SLC15A2 | solute carrier family 15 (H+/peptide transporter), member 2 | |
1 | 1 | ||||||
| MIRT023365 | RABIF | RAB interacting factor | |
1 | 1 | ||||||
| MIRT023366 | ART3 | ADP-ribosyltransferase 3 | |
1 | 1 | ||||||
| MIRT023367 | EP400 | E1A binding protein p400 | |
1 | 1 | ||||||
| MIRT023368 | MT4 | metallothionein 4 | |
1 | 1 | ||||||
| MIRT023369 | TRAM2 | translocation associated membrane protein 2 | |
1 | 1 | ||||||
| MIRT023370 | PHPT1 | phosphohistidine phosphatase 1 | |
1 | 1 | ||||||
| MIRT023371 | KIAA0101 | KIAA0101 | |
1 | 1 | ||||||
| MIRT023372 | VHL | von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase | |
1 | 1 | ||||||
| MIRT023373 | IFNA1 | interferon, alpha 1 | |
1 | 1 | ||||||
| MIRT023374 | FSTL3 | follistatin-like 3 (secreted glycoprotein) | |
1 | 1 | ||||||
| MIRT023375 | PHF14 | PHD finger protein 14 | |
1 | 1 | ||||||
| MIRT023376 | ZCCHC2 | zinc finger, CCHC domain containing 2 | |
1 | 1 | ||||||
| MIRT023377 | GSTM3 | glutathione S-transferase mu 3 (brain) | |
1 | 1 | ||||||
| MIRT023378 | DCTN5 | dynactin 5 (p25) | |
1 | 1 | ||||||
| MIRT023379 | CHST3 | carbohydrate (chondroitin 6) sulfotransferase 3 | |
1 | 1 | ||||||
| MIRT023380 | HECW2 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 | |
1 | 1 | ||||||
| MIRT023381 | ADO | 2-aminoethanethiol (cysteamine) dioxygenase | |
1 | 1 | ||||||
| MIRT023382 | POMZP3 | POM121 and ZP3 fusion | |
1 | 1 | ||||||
| MIRT023383 | CHST12 | carbohydrate (chondroitin 4) sulfotransferase 12 | |
1 | 1 | ||||||
| MIRT023384 | ARSB | arylsulfatase B | |
1 | 1 | ||||||
| MIRT023385 | ATP7A | ATPase, Cu++ transporting, alpha polypeptide | |
1 | 1 | ||||||
| MIRT023386 | PMP22 | peripheral myelin protein 22 | |
1 | 1 | ||||||
| MIRT023387 | TGFBRAP1 | transforming growth factor, beta receptor associated protein 1 | |
1 | 1 | ||||||
| MIRT023388 | ORC2 | origin recognition complex, subunit 2 | |
1 | 1 | ||||||
| MIRT023389 | CREB1 | cAMP responsive element binding protein 1 | |
1 | 1 | ||||||
| MIRT023390 | CD83 | CD83 molecule | |
1 | 1 | ||||||
| MIRT023391 | TOB2 | transducer of ERBB2, 2 | |
|
2 | 3 | |||||
| MIRT023392 | LRP11 | low density lipoprotein receptor-related protein 11 | |
1 | 1 | ||||||
| MIRT023393 | MPV17 | MpV17 mitochondrial inner membrane protein | |
1 | 1 | ||||||
| MIRT023394 | TRIM29 | tripartite motif containing 29 | |
1 | 1 | ||||||
| MIRT023395 | OSBP2 | oxysterol binding protein 2 | |
1 | 1 | ||||||
| MIRT023396 | PKM | pyruvate kinase, muscle | |
|
|
|
|
5 | 3 | ||
| MIRT023397 | FOXK2 | forkhead box K2 | |
|
2 | 2 | |||||
| MIRT023398 | CLIC4 | chloride intracellular channel 4 | |
|
|
|
4 | 4 | |||
| MIRT023399 | ST6GALNAC4 | ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 | |
1 | 1 | ||||||
| MIRT023400 | SMURF2 | SMAD specific E3 ubiquitin protein ligase 2 | |
1 | 1 | ||||||
| MIRT023401 | LMNB2 | lamin B2 | |
|
2 | 3 | |||||
| MIRT023402 | BAX | BCL2-associated X protein | |
|
2 | 2 | |||||
| MIRT023403 | CDK4 | cyclin-dependent kinase 4 | |
|
2 | 2 | |||||
| MIRT054362 | Cux1 | cut-like homeobox 1 | |
1 | 1 | ||||||
| MIRT074336 | TNRC6A | trinucleotide repeat containing 6A | |
1 | 1 | ||||||
| MIRT109185 | VMA21 | VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) | |
1 | 2 | ||||||
| MIRT324745 | ACER2 | alkaline ceramidase 2 | |
1 | 1 | ||||||
| MIRT325564 | HIATL1 | hippocampus abundant transcript-like 1 | |
1 | 2 | ||||||
| MIRT438005 | MEF2D | myocyte enhancer factor 2D | |
1 | 1 | ||||||
| MIRT438206 | TGFB1 | transforming growth factor, beta 1 | |
1 | 1 | ||||||
| MIRT438639 | AXL | AXL receptor tyrosine kinase | |
1 | 1 | ||||||
| MIRT438655 | NOD2 | nucleotide-binding oligomerization domain containing 2 | |
|
|
3 | 1 | ||||
| MIRT438734 | FUT8 | fucosyltransferase 8 (alpha (1,6) fucosyltransferase) | |
|
|
3 | 1 | ||||
| MIRT449879 | CYP3A5 | cytochrome P450, family 3, subfamily A, polypeptide 5 | |
1 | 1 | ||||||
| MIRT451716 | OLR1 | oxidized low density lipoprotein (lectin-like) receptor 1 | |
1 | 1 | ||||||
| MIRT453274 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
1 | 1 | ||||||
| MIRT454113 | MRPL52 | mitochondrial ribosomal protein L52 | |
1 | 1 | ||||||
| MIRT454232 | OSBPL10 | oxysterol binding protein-like 10 | |
1 | 7 | ||||||
| MIRT454344 | CDKL1 | cyclin-dependent kinase-like 1 (CDC2-related kinase) | |
1 | 1 | ||||||
| MIRT455826 | ZSWIM1 | zinc finger, SWIM-type containing 1 | |
1 | 1 | ||||||
| MIRT459903 | PIGO | phosphatidylinositol glycan anchor biosynthesis, class O | |
1 | 6 | ||||||
| MIRT461654 | G6PC | glucose-6-phosphatase, catalytic subunit | |
1 | 1 | ||||||
| MIRT461934 | TNFSF14 | tumor necrosis factor (ligand) superfamily, member 14 | |
1 | 1 | ||||||
| MIRT463834 | WSB1 | WD repeat and SOCS box containing 1 | |
1 | 1 | ||||||
| MIRT468615 | SUMO1 | SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT469456 | REL | v-rel reticuloendotheliosis viral oncogene homolog (avian) | |
1 | 3 | ||||||
| MIRT469637 | RAD21 | RAD21 homolog (S. pombe) | |
1 | 3 | ||||||
| MIRT473432 | MDM4 | Mdm4 p53 binding protein homolog (mouse) | |
1 | 1 | ||||||
| MIRT473872 | MAFK | v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) | |
1 | 3 | ||||||
| MIRT476861 | FHL2 | four and a half LIM domains 2 | |
1 | 2 | ||||||
| MIRT476893 | FBXO21 | F-box protein 21 | |
1 | 1 | ||||||
| MIRT479880 | CCDC43 | coiled-coil domain containing 43 | |
1 | 1 | ||||||
| MIRT488848 | UBTF | upstream binding transcription factor, RNA polymerase I | |
1 | 1 | ||||||
| MIRT491164 | LRP3 | low density lipoprotein receptor-related protein 3 | |
1 | 1 | ||||||
| MIRT497662 | PRMT3 | protein arginine methyltransferase 3 | |
1 | 1 | ||||||
| MIRT499314 | ZNF485 | zinc finger protein 485 | |
1 | 5 | ||||||
| MIRT499759 | CIRH1A | cirrhosis, autosomal recessive 1A (cirhin) | |
1 | 5 | ||||||
| MIRT500014 | ABCF2 | ATP-binding cassette, sub-family F (GCN20), member 2 | |
1 | 4 | ||||||
| MIRT501090 | SLC7A5 | solute carrier family 7 (amino acid transporter light chain, L system), member 5 | |
1 | 2 | ||||||
| MIRT509646 | ZNF354B | zinc finger protein 354B | |
1 | 5 | ||||||
| MIRT509945 | TOMM70A | translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) | |
1 | 3 | ||||||
| MIRT510320 | SLC2A3 | solute carrier family 2 (facilitated glucose transporter), member 3 | |
1 | 2 | ||||||
| MIRT515505 | GTF2F1 | general transcription factor IIF, polypeptide 1, 74kDa | |
1 | 1 | ||||||
| MIRT516410 | COPA | coatomer protein complex, subunit alpha | |
1 | 1 | ||||||
| MIRT517861 | NCAPD2 | non-SMC condensin I complex, subunit D2 | |
1 | 2 | ||||||
| MIRT522558 | MCAM | melanoma cell adhesion molecule | |
1 | 2 | ||||||
| MIRT523525 | GLUL | glutamate-ammonia ligase | |
1 | 1 | ||||||
| MIRT523764 | FBXO27 | F-box protein 27 | |
1 | 2 | ||||||
| MIRT524517 | CDK19 | cyclin-dependent kinase 19 | |
1 | 1 | ||||||
| MIRT524753 | BIRC5 | baculoviral IAP repeat containing 5 | |
1 | 3 | ||||||
| MIRT529366 | YWHAB | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | |
1 | 2 | ||||||
| MIRT531189 | SIGLEC12 | sialic acid binding Ig-like lectin 12 (gene/pseudogene) | |
1 | 1 | ||||||
| MIRT531639 | C19orf52 | chromosome 19 open reading frame 52 | |
1 | 2 | ||||||
| MIRT531913 | SLC4A1 | solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) | |
1 | 1 | ||||||
| MIRT532678 | PATZ1 | POZ (BTB) and AT hook containing zinc finger 1 | |
1 | 1 | ||||||
| MIRT533115 | YIPF4 | Yip1 domain family, member 4 | |
1 | 2 | ||||||
| MIRT534740 | RBM47 | RNA binding motif protein 47 | |
1 | 1 | ||||||
| MIRT535471 | PARVB | parvin, beta | |
1 | 2 | ||||||
| MIRT536742 | HSPA4L | heat shock 70kDa protein 4-like | |
1 | 1 | ||||||
| MIRT537237 | GALNT3 | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) | |
1 | 1 | ||||||
| MIRT539523 | ABCF1 | ATP-binding cassette, sub-family F (GCN20), member 1 | |
1 | 2 | ||||||
| MIRT540438 | RBM43 | RNA binding motif protein 43 | |
1 | 1 | ||||||
| MIRT542982 | ERC1 | ELKS/RAB6-interacting/CAST family member 1 | |
1 | 1 | ||||||
| MIRT544674 | AP1S1 | adaptor-related protein complex 1, sigma 1 subunit | |
1 | 1 | ||||||
| MIRT549514 | HDDC2 | HD domain containing 2 | |
1 | 1 | ||||||
| MIRT549663 | ORC6 | origin recognition complex, subunit 6 | |
1 | 2 | ||||||
| MIRT555420 | PPIC | peptidylprolyl isomerase C (cyclophilin C) | |
1 | 1 | ||||||
| MIRT564701 | ZNF322P1 | zinc finger protein 322 pseudogene 1 | |
1 | 1 | ||||||
| MIRT570046 | PKNOX1 | PBX/knotted 1 homeobox 1 | |
1 | 1 | ||||||
| MIRT570257 | PRSS16 | protease, serine, 16 (thymus) | |
1 | 1 | ||||||
| MIRT571143 | HM13 | histocompatibility (minor) 13 | |
1 | 1 | ||||||
| MIRT575202 | Entpd4 | ectonucleoside triphosphate diphosphohydrolase 4 | |
1 | 1 | ||||||
| MIRT575282 | Mapk8ip2 | mitogen-activated protein kinase 8 interacting protein 2 | |
1 | 1 | ||||||
| MIRT575302 | Osbpl10 | oxysterol binding protein-like 10 | |
1 | 1 | ||||||
| MIRT575323 | Fbxo6 | F-box protein 6 | |
1 | 1 | ||||||
| MIRT575377 | Ang | angiogenin, ribonuclease, RNase A family, 5 | |
1 | 1 | ||||||
| MIRT575614 | Zswim1 | zinc finger, SWIM domain containing 1 | |
1 | 1 | ||||||
| MIRT575671 | Map1b | microtubule-associated protein 1B | |
1 | 1 | ||||||
| MIRT607065 | POM121L7 | POM121 transmembrane nucleoporin-like 7 | |
1 | 1 | ||||||
| MIRT607490 | HEBP2 | heme binding protein 2 | |
1 | 1 | ||||||
| MIRT607522 | ABL2 | v-abl Abelson murine leukemia viral oncogene homolog 2 | |
1 | 1 | ||||||
| MIRT607655 | BTN3A2 | butyrophilin, subfamily 3, member A2 | |
1 | 1 | ||||||
| MIRT607795 | RHBDL2 | rhomboid, veinlet-like 2 (Drosophila) | |
1 | 1 | ||||||
| MIRT607842 | PHLDA3 | pleckstrin homology-like domain, family A, member 3 | |
1 | 1 | ||||||
| MIRT607927 | ANG | angiogenin, ribonuclease, RNase A family, 5 | |
1 | 1 | ||||||
| MIRT607966 | SNX22 | sorting nexin 22 | |
1 | 1 | ||||||
| MIRT608074 | ZFP14 | zinc finger protein 14 homolog (mouse) | |
1 | 1 | ||||||
| MIRT608141 | SYAP1 | synapse associated protein 1 | |
1 | 1 | ||||||
| MIRT612620 | RABL3 | RAB, member of RAS oncogene family-like 3 | |
1 | 1 | ||||||
| MIRT617444 | CCS | copper chaperone for superoxide dismutase | |
1 | 1 | ||||||
| MIRT617552 | MTO1 | mitochondrial translation optimization 1 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT618772 | HLA-E | major histocompatibility complex, class I, E | |
1 | 1 | ||||||
| MIRT618926 | MEAF6 | MYST/Esa1-associated factor 6 | |
1 | 1 | ||||||
| MIRT619247 | TIAL1 | TIA1 cytotoxic granule-associated RNA binding protein-like 1 | |
1 | 1 | ||||||
| MIRT620091 | YME1L1 | YME1-like 1 (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT620483 | XKR6 | XK, Kell blood group complex subunit-related family, member 6 | |
1 | 1 | ||||||
| MIRT620570 | WBSCR27 | Williams Beuren syndrome chromosome region 27 | |
1 | 2 | ||||||
| MIRT622977 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | |
1 | 1 | ||||||
| MIRT623169 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | |
1 | 1 | ||||||
| MIRT624165 | DGKE | diacylglycerol kinase, epsilon 64kDa | |
1 | 1 | ||||||
| MIRT625268 | AGAP9 | ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 | |
1 | 1 | ||||||
| MIRT625396 | AKR7L | aldo-keto reductase family 7-like | |
1 | 1 | ||||||
| MIRT625694 | OPTN | optineurin | |
1 | 1 | ||||||
| MIRT626093 | MKLN1 | muskelin 1, intracellular mediator containing kelch motifs | |
1 | 1 | ||||||
| MIRT626431 | CHDH | choline dehydrogenase | |
1 | 1 | ||||||
| MIRT627013 | FIG4 | FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT627077 | SF3A1 | splicing factor 3a, subunit 1, 120kDa | |
1 | 1 | ||||||
| MIRT627140 | HS3ST1 | heparan sulfate (glucosamine) 3-O-sulfotransferase 1 | |
1 | 1 | ||||||
| MIRT627347 | TSHZ2 | teashirt zinc finger homeobox 2 | |
1 | 1 | ||||||
| MIRT627420 | THAP2 | THAP domain containing, apoptosis associated protein 2 | |
1 | 1 | ||||||
| MIRT627441 | TAS2R5 | taste receptor, type 2, member 5 | |
1 | 1 | ||||||
| MIRT628078 | KAT7 | K(lysine) acetyltransferase 7 | |
1 | 2 | ||||||
| MIRT628276 | CYB5D1 | cytochrome b5 domain containing 1 | |
1 | 1 | ||||||
| MIRT629094 | F2RL1 | coagulation factor II (thrombin) receptor-like 1 | |
1 | 1 | ||||||
| MIRT629236 | CINP | cyclin-dependent kinase 2 interacting protein | |
1 | 1 | ||||||
| MIRT629286 | UNC13A | unc-13 homolog A (C. elegans) | |
1 | 1 | ||||||
| MIRT629407 | ADM2 | adrenomedullin 2 | |
1 | 1 | ||||||
| MIRT629584 | RFC2 | replication factor C (activator 1) 2, 40kDa | |
1 | 1 | ||||||
| MIRT629635 | WDR31 | WD repeat domain 31 | |
1 | 1 | ||||||
| MIRT629874 | NOM1 | nucleolar protein with MIF4G domain 1 | |
1 | 1 | ||||||
| MIRT629984 | NARS | asparaginyl-tRNA synthetase | |
1 | 1 | ||||||
| MIRT630043 | TERF2 | telomeric repeat binding factor 2 | |
1 | 1 | ||||||
| MIRT630061 | NIP7 | nuclear import 7 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT630127 | ARHGEF5 | Rho guanine nucleotide exchange factor (GEF) 5 | |
1 | 1 | ||||||
| MIRT630155 | ZBTB8A | zinc finger and BTB domain containing 8A | |
1 | 1 | ||||||
| MIRT630252 | SMTNL2 | smoothelin-like 2 | |
1 | 1 | ||||||
| MIRT630278 | PSMB5 | proteasome (prosome, macropain) subunit, beta type, 5 | |
1 | 1 | ||||||
| MIRT630347 | NKAP | NFKB activating protein | |
1 | 1 | ||||||
| MIRT630497 | CYP20A1 | cytochrome P450, family 20, subfamily A, polypeptide 1 | |
1 | 1 | ||||||
| MIRT631264 | CENPM | centromere protein M | |
1 | 1 | ||||||
| MIRT631403 | IL2RA | interleukin 2 receptor, alpha | |
1 | 1 | ||||||
| MIRT632470 | RPS15A | ribosomal protein S15a | |
1 | 1 | ||||||
| MIRT632596 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | |
1 | 1 | ||||||
| MIRT632994 | DUSP18 | dual specificity phosphatase 18 | |
1 | 1 | ||||||
| MIRT633082 | CXorf21 | chromosome X open reading frame 21 | |
1 | 1 | ||||||
| MIRT633239 | ZNF573 | zinc finger protein 573 | |
1 | 1 | ||||||
| MIRT633286 | SLC1A5 | solute carrier family 1 (neutral amino acid transporter), member 5 | |
1 | 1 | ||||||
| MIRT633536 | PGBD5 | piggyBac transposable element derived 5 | |
1 | 1 | ||||||
| MIRT634338 | SGOL1 | shugoshin-like 1 (S. pombe) | |
1 | 1 | ||||||
| MIRT634600 | KIAA1919 | KIAA1919 | |
1 | 1 | ||||||
| MIRT635050 | MYH11 | myosin, heavy chain 11, smooth muscle | |
1 | 1 | ||||||
| MIRT635236 | QPRT | quinolinate phosphoribosyltransferase | |
1 | 1 | ||||||
| MIRT635322 | BMS1 | BMS1 homolog, ribosome assembly protein (yeast) | |
1 | 1 | ||||||
| MIRT636268 | RNF157 | ring finger protein 157 | |
1 | 1 | ||||||
| MIRT636450 | LRCH3 | leucine-rich repeats and calponin homology (CH) domain containing 3 | |
1 | 1 | ||||||
| MIRT636516 | FMN1 | formin 1 | |
1 | 1 | ||||||
| MIRT636755 | SLC16A5 | solute carrier family 16, member 5 (monocarboxylic acid transporter 6) | |
1 | 1 | ||||||
| MIRT637134 | BAMBI | BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) | |
1 | 1 | ||||||
| MIRT637188 | ROMO1 | reactive oxygen species modulator 1 | |
1 | 1 | ||||||
| MIRT637287 | IBA57 | IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT637532 | RGS9BP | regulator of G protein signaling 9 binding protein | |
1 | 1 | ||||||
| MIRT637693 | CEP89 | centrosomal protein 89kDa | |
1 | 1 | ||||||
| MIRT637788 | OLA1 | Obg-like ATPase 1 | |
1 | 1 | ||||||
| MIRT637925 | LILRA2 | leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 | |
1 | 1 | ||||||
| MIRT638449 | PLXDC2 | plexin domain containing 2 | |
1 | 1 | ||||||
| MIRT640871 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
1 | 1 | ||||||
| MIRT642643 | PTGR2 | prostaglandin reductase 2 | |
1 | 1 | ||||||
| MIRT643082 | PTPLAD2 | protein tyrosine phosphatase-like A domain containing 2 | |
1 | 1 | ||||||
| MIRT643123 | FAM71F2 | family with sequence similarity 71, member F2 | |
1 | 1 | ||||||
| MIRT644236 | SLC35E3 | solute carrier family 35, member E3 | |
1 | 1 | ||||||
| MIRT644665 | TMCO1 | transmembrane and coiled-coil domains 1 | |
1 | 1 | ||||||
| MIRT645092 | SLC35E2B | solute carrier family 35, member E2B | |
1 | 1 | ||||||
| MIRT645993 | ACP6 | acid phosphatase 6, lysophosphatidic | |
1 | 1 | ||||||
| MIRT646508 | FAM217B | family with sequence similarity 217, member B | |
1 | 1 | ||||||
| MIRT647013 | ADCY2 | adenylate cyclase 2 (brain) | |
1 | 1 | ||||||
| MIRT647095 | SEC23B | Sec23 homolog B (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT647714 | NFX1 | nuclear transcription factor, X-box binding 1 | |
1 | 2 | ||||||
| MIRT648040 | FADS6 | fatty acid desaturase domain family, member 6 | |
1 | 1 | ||||||
| MIRT648510 | PIGG | phosphatidylinositol glycan anchor biosynthesis, class G | |
1 | 1 | ||||||
| MIRT648865 | ABCA6 | ATP-binding cassette, sub-family A (ABC1), member 6 | |
1 | 1 | ||||||
| MIRT649182 | DNPEP | aspartyl aminopeptidase | |
1 | 1 | ||||||
| MIRT649660 | TEP1 | telomerase-associated protein 1 | |
1 | 1 | ||||||
| MIRT651465 | XIAP | X-linked inhibitor of apoptosis | |
1 | 1 | ||||||
| MIRT652398 | TMEM40 | transmembrane protein 40 | |
1 | 1 | ||||||
| MIRT653691 | SLC25A33 | solute carrier family 25 (pyrimidine nucleotide carrier), member 33 | |
1 | 1 | ||||||
| MIRT654122 | RPS6KA5 | ribosomal protein S6 kinase, 90kDa, polypeptide 5 | |
1 | 1 | ||||||
| MIRT654577 | PXMP4 | peroxisomal membrane protein 4, 24kDa | |
1 | 1 | ||||||
| MIRT656470 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | |
1 | 1 | ||||||
| MIRT658905 | DPY19L4 | dpy-19-like 4 (C. elegans) | |
1 | 1 | ||||||
| MIRT660878 | ADRBK2 | adrenergic, beta, receptor kinase 2 | |
1 | 2 | ||||||
| MIRT661101 | SPIB | Spi-B transcription factor (Spi-1/PU.1 related) | |
1 | 1 | ||||||
| MIRT661238 | ARL17B | ADP-ribosylation factor-like 17B | |
1 | 1 | ||||||
| MIRT661291 | LIN52 | lin-52 homolog (C. elegans) | |
1 | 1 | ||||||
| MIRT662235 | PGBD4 | piggyBac transposable element derived 4 | |
1 | 1 | ||||||
| MIRT662544 | MTAP | methylthioadenosine phosphorylase | |
1 | 1 | ||||||
| MIRT662736 | LRRC3C | leucine rich repeat containing 3C | |
1 | 1 | ||||||
| MIRT662844 | OMD | osteomodulin | |
1 | 1 | ||||||
| MIRT662907 | MED18 | mediator complex subunit 18 | |
1 | 1 | ||||||
| MIRT662956 | JPH2 | junctophilin 2 | |
1 | 1 | ||||||
| MIRT663340 | ZNF74 | zinc finger protein 74 | |
1 | 1 | ||||||
| MIRT663496 | IYD | iodotyrosine deiodinase | |
1 | 1 | ||||||
| MIRT663523 | MASTL | microtubule associated serine/threonine kinase-like | |
1 | 1 | ||||||
| MIRT663542 | CCR6 | chemokine (C-C motif) receptor 6 | |
1 | 1 | ||||||
| MIRT663903 | MRI1 | methylthioribose-1-phosphate isomerase homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT663973 | ZNF786 | zinc finger protein 786 | |
1 | 1 | ||||||
| MIRT664350 | C16orf45 | chromosome 16 open reading frame 45 | |
1 | 1 | ||||||
| MIRT664417 | TIGD6 | tigger transposable element derived 6 | |
1 | 1 | ||||||
| MIRT664468 | ZYG11B | zyg-11 homolog B (C. elegans) | |
1 | 1 | ||||||
| MIRT664957 | PTCD3 | pentatricopeptide repeat domain 3 | |
1 | 1 | ||||||
| MIRT664970 | TDRD1 | tudor domain containing 1 | |
1 | 1 | ||||||
| MIRT665199 | ESF1 | ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT665359 | XKR4 | XK, Kell blood group complex subunit-related family, member 4 | |
1 | 1 | ||||||
| MIRT665454 | WDR17 | WD repeat domain 17 | |
1 | 1 | ||||||
| MIRT665486 | VPS53 | vacuolar protein sorting 53 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT666078 | SSTR2 | somatostatin receptor 2 | |
1 | 1 | ||||||
| MIRT666258 | SLC31A1 | solute carrier family 31 (copper transporters), member 1 | |
1 | 1 | ||||||
| MIRT666324 | SLC16A10 | solute carrier family 16, member 10 (aromatic amino acid transporter) | |
1 | 1 | ||||||
| MIRT666486 | SBNO1 | strawberry notch homolog 1 (Drosophila) | |
1 | 1 | ||||||
| MIRT666696 | RBM23 | RNA binding motif protein 23 | |
1 | 1 | ||||||
| MIRT666712 | RBL1 | retinoblastoma-like 1 (p107) | |
1 | 1 | ||||||
| MIRT666762 | RAB10 | RAB10, member RAS oncogene family | |
1 | 1 | ||||||
| MIRT666931 | PNRC1 | proline-rich nuclear receptor coactivator 1 | |
1 | 1 | ||||||
| MIRT667226 | NFE2L1 | nuclear factor (erythroid-derived 2)-like 1 | |
1 | 1 | ||||||
| MIRT667359 | MPLKIP | M-phase specific PLK1 interacting protein | |
1 | 1 | ||||||
| MIRT667474 | MAPK1 | mitogen-activated protein kinase 1 | |
1 | 1 | ||||||
| MIRT667558 | LRAT | lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) | |
1 | 1 | ||||||
| MIRT667748 | KDELR1 | KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 | |
1 | 1 | ||||||
| MIRT668088 | GMEB1 | glucocorticoid modulatory element binding protein 1 | |
1 | 1 | ||||||
| MIRT668119 | GK5 | glycerol kinase 5 (putative) | |
1 | 1 | ||||||
| MIRT668166 | GDE1 | glycerophosphodiester phosphodiesterase 1 | |
1 | 1 | ||||||
| MIRT668346 | STXBP2 | syntaxin binding protein 2 | |
1 | 1 | ||||||
| MIRT668509 | ESYT2 | extended synaptotagmin-like protein 2 | |
1 | 1 | ||||||
| MIRT669291 | C17orf85 | chromosome 17 open reading frame 85 | |
1 | 1 | ||||||
| MIRT669547 | ALG14 | asparagine-linked glycosylation 14 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT669778 | CNDP1 | carnosine dipeptidase 1 (metallopeptidase M20 family) | |
1 | 1 | ||||||
| MIRT669858 | BROX | BRO1 domain and CAAX motif containing | |
1 | 2 | ||||||
| MIRT670017 | TECPR1 | tectonin beta-propeller repeat containing 1 | |
1 | 1 | ||||||
| MIRT670177 | CCDC142 | coiled-coil domain containing 142 | |
1 | 1 | ||||||
| MIRT671107 | ZNF841 | zinc finger protein 841 | |
1 | 1 | ||||||
| MIRT671351 | SMG1 | smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) | |
1 | 1 | ||||||
| MIRT671476 | FLYWCH2 | FLYWCH family member 2 | |
1 | 1 | ||||||
| MIRT671492 | SLC38A9 | solute carrier family 38, member 9 | |
1 | 1 | ||||||
| MIRT671554 | LIMS1 | LIM and senescent cell antigen-like domains 1 | |
1 | 1 | ||||||
| MIRT671925 | PLEKHS1 | pleckstrin homology domain containing, family S member 1 | |
1 | 2 | ||||||
| MIRT672196 | F2 | coagulation factor II (thrombin) | |
1 | 1 | ||||||
| MIRT672217 | DCAF7 | DDB1 and CUL4 associated factor 7 | |
1 | 1 | ||||||
| MIRT672252 | SIK2 | salt-inducible kinase 2 | |
1 | 1 | ||||||
| MIRT672290 | GP2 | glycoprotein 2 (zymogen granule membrane) | |
1 | 1 | ||||||
| MIRT672430 | POLR2D | polymerase (RNA) II (DNA directed) polypeptide D | |
1 | 1 | ||||||
| MIRT672597 | NKPD1 | NTPase, KAP family P-loop domain containing 1 | |
1 | 1 | ||||||
| MIRT672901 | KRBA2 | KRAB-A domain containing 2 | |
1 | 1 | ||||||
| MIRT672958 | ZNF655 | zinc finger protein 655 | |
1 | 1 | ||||||
| MIRT673096 | SYNPO2L | synaptopodin 2-like | |
1 | 1 | ||||||
| MIRT673171 | TMEM56 | transmembrane protein 56 | |
1 | 1 | ||||||
| MIRT673251 | INO80 | INO80 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT673296 | RNF19B | ring finger protein 19B | |
1 | 1 | ||||||
| MIRT673574 | KDELC2 | KDEL (Lys-Asp-Glu-Leu) containing 2 | |
1 | 1 | ||||||
| MIRT673586 | KIF1C | kinesin family member 1C | |
1 | 1 | ||||||
| MIRT673737 | TCF23 | transcription factor 23 | |
1 | 1 | ||||||
| MIRT673767 | MRPL17 | mitochondrial ribosomal protein L17 | |
1 | 1 | ||||||
| MIRT674215 | FAM120AOS | family with sequence similarity 120A opposite strand | |
1 | 1 | ||||||
| MIRT674283 | NAGK | N-acetylglucosamine kinase | |
1 | 1 | ||||||
| MIRT674338 | KCMF1 | potassium channel modulatory factor 1 | |
1 | 1 | ||||||
| MIRT674517 | PRR23A | proline rich 23A | |
1 | 1 | ||||||
| MIRT675100 | SNTB2 | syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) | |
1 | 1 | ||||||
| MIRT675144 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | |
1 | 2 | ||||||
| MIRT675223 | CLK4 | CDC-like kinase 4 | |
1 | 1 | ||||||
| MIRT675263 | ZNF431 | zinc finger protein 431 | |
1 | 1 | ||||||
| MIRT675577 | WWC1 | WW and C2 domain containing 1 | |
1 | 1 | ||||||
| MIRT676025 | C9orf69 | chromosome 9 open reading frame 69 | |
1 | 1 | ||||||
| MIRT676430 | PLEKHM3 | pleckstrin homology domain containing, family M, member 3 | |
1 | 1 | ||||||
| MIRT676560 | VSIG1 | V-set and immunoglobulin domain containing 1 | |
1 | 1 | ||||||
| MIRT676596 | ARIH2OS | ariadne homolog 2 opposite strand | |
1 | 1 | ||||||
| MIRT678576 | TMEM168 | transmembrane protein 168 | |
1 | 1 | ||||||
| MIRT678756 | ALG1 | asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT680344 | ZNF281 | zinc finger protein 281 | |
1 | 1 | ||||||
| MIRT680467 | C3 | complement component 3 | |
1 | 1 | ||||||
| MIRT682826 | FLG2 | filaggrin family member 2 | |
1 | 1 | ||||||
| MIRT682881 | SAR1A | SAR1 homolog A (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT684404 | TMEM180 | transmembrane protein 180 | |
1 | 1 | ||||||
| MIRT685275 | KIAA1143 | KIAA1143 | |
1 | 1 | ||||||
| MIRT686061 | KCNA7 | potassium voltage-gated channel, shaker-related subfamily, member 7 | |
1 | 1 | ||||||
| MIRT687526 | NASP | nuclear autoantigenic sperm protein (histone-binding) | |
1 | 1 | ||||||
| MIRT691760 | BCL2L15 | BCL2-like 15 | |
1 | 1 | ||||||
| MIRT693890 | C3orf62 | chromosome 3 open reading frame 62 | |
1 | 1 | ||||||
| MIRT699342 | SLC35E1 | solute carrier family 35, member E1 | |
1 | 1 | ||||||
| MIRT699909 | RUNDC1 | RUN domain containing 1 | |
1 | 1 | ||||||
| MIRT700536 | PTPDC1 | protein tyrosine phosphatase domain containing 1 | |
1 | 1 | ||||||
| MIRT701807 | MRPS25 | mitochondrial ribosomal protein S25 | |
1 | 1 | ||||||
| MIRT702174 | LYRM4 | LYR motif containing 4 | |
1 | 1 | ||||||
| MIRT706205 | ACOT9 | acyl-CoA thioesterase 9 | |
1 | 1 | ||||||
| MIRT706659 | RNF216 | ring finger protein 216 | |
1 | 1 | ||||||
| MIRT706682 | COL13A1 | collagen, type XIII, alpha 1 | |
1 | 1 | ||||||
| MIRT706705 | GPR155 | G protein-coupled receptor 155 | |
1 | 1 | ||||||
| MIRT706777 | ANKRD36 | ankyrin repeat domain 36 | |
1 | 1 | ||||||
| MIRT706844 | DNAJB13 | DnaJ (Hsp40) homolog, subfamily B, member 13 | |
1 | 1 | ||||||
| MIRT706863 | MAFF | v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) | |
1 | 1 | ||||||
| MIRT706896 | ST3GAL1 | ST3 beta-galactoside alpha-2,3-sialyltransferase 1 | |
1 | 1 | ||||||
| MIRT706916 | THAP6 | THAP domain containing 6 | |
1 | 1 | ||||||
| MIRT706962 | FANCC | Fanconi anemia, complementation group C | |
1 | 1 | ||||||
| MIRT706980 | XPO5 | exportin 5 | |
1 | 1 | ||||||
| MIRT707015 | RRP36 | ribosomal RNA processing 36 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT707032 | ACTR5 | ARP5 actin-related protein 5 homolog (yeast) | |
1 | 1 | ||||||
| MIRT707072 | MED29 | mediator complex subunit 29 | |
1 | 1 | ||||||
| MIRT709368 | SPECC1 | sperm antigen with calponin homology and coiled-coil domains 1 | |
1 | 1 | ||||||
| MIRT720092 | SPTLC3 | serine palmitoyltransferase, long chain base subunit 3 | |
1 | 1 | ||||||
| MIRT721330 | IFNAR2 | interferon (alpha, beta and omega) receptor 2 | |
1 | 1 | ||||||
| MIRT724198 | MED7 | mediator complex subunit 7 | |
1 | 1 | ||||||
| MIRT725403 | KIF6 | kinesin family member 6 | |
1 | 1 | ||||||