Accession ID: MIRT000012 [miRNA, hsa-miR-122-5p :: CYP7A1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-122LinkOut: [miRBase ]
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Mature Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-122-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CYP7A1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CP7A, CYP7, CYPVII
Description cytochrome P450, family 7, subfamily A, polypeptide 1
Transcript NM_000780    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CYP7A1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CYP7A1
(miRNA target sites are highlighted)
>CYP7A1|NM_000780|3'UTR
   1 ATACATGGCTGGAATAAGAGGACACTAGATGATATTACAGGACTGCAGAACACCCTCACCACACAGTCCCTTTGGACAAA
  81 TGCATTTAGTGGTGGTAGAAATGATTCACCAGGTCCAATGTTGTTCACCAGTGCTTGCTTGTGAATCTTAACATTTTGGT
 161 GACAGTTTCCAGATGCTATCACAGACTCTGCTAGTGAAAAGAACTAGTTTCTAGGAGCACAATAATTTGTTTTCATTTGT
 241 ATAAGTCCATGAATGTTCATATAGCCAGGGATTGAAGTTTATTATTTTCAAAGGAAAACACCTTTATTTTATTTTTTTTC
 321 AAAATGAAGATACACATTACAGCCAGGTGTGGTAGCAGGCACCTGTAGTCTTAGCTACTCGAGAGGCCAAAGAAGGAGGA
 401 TGGCTTGAGCCCAGGAGTTCAAGACCAGCCTGGACAGCTTAGTGAGATCCCGTCTCCGAAGAAAAGATATGTATTCTAAT
 481 TGGCAGATTGTTTTTTCCTAAGGAAACTGCTTTATTTTTATAAAACTGCCTGACAATTATGAAAAAATGTTCAAATTCAC
 561 GTTCTAGTGAAACTGCATTATTTGTTGACTAGATGGTGGGGTTCTTCGGGTGTGATCATATATCATAAAGGATATTTCAA
 641 ATGATTATGATTAGTTATGTCTTTTAATAAAAAGGAAATATTTTTCAACTTCTTCTATATCCAAAATTCAGGGCTTTAAA
 721 CATGATTATCTTGATTTCCCAAAAACACTAAAGGTGGTTTTATTTTCCCTTCATGTTTTAACTTATTGTTGCTGAAAACT
 801 CTATGTCCGGCTTTAACTATCTTCTCTATATTTTTATTTCATTCACATTAATGAGAAGAGTTTTCTCAGAGATTAAAAAA
 881 GGTAGTTTTTCTGTCATTGTTAAATACACATTATCACTGAAAAAATGTAGCTTTTATGTGATATGTTTTAAAGTTAAAAC
 961 TGGATGGAAATAGCCATTTGGAAGCTTTGGTTATGAAACATGTGGAGTGTATTAAGTGCAGCTTGACATTATGTTTTATT
1041 TAAATGCTTTTTATCGCTAAATGACTTGCAGATGAAAAAAACTAAGGTGACTCGAGTGTTTAAATGCTGTGTACAACAAT
1121 GCTTTGATAAAATATTTTAAGTATGAGTTATCAGCTCTATGTCAATTGATATTTCTGTGTAGTATTTATATTTAAATTAT
1201 ATTTACCTTTTTGCTTATTTTACAAATATTAAGAAAATATTCTAACATTTGATAATTTTGAAATGATTCATCTTTCAGAA
1281 ATAAAAGTATGAATCTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUG--AGGu 5'
            |||||| |   |||||  ||| 
Target 5' agAACACCCTCACCACACAGTCCc 3'
47 - 70 128.00 -14.90
2
miRNA  3' guUUGUGGUAACAGUGU--GAGGu 5'
            ||||:: | || |||  :||| 
Target 5' ttAACATTTTGGTGACAGTTTCCa 3'
148 - 171 112.00 -12.80
3
miRNA  3' guUUGUGGUAACAG-----UGUGAGGu 5'
            ||| ::|||||:     | ||||: 
Target 5' ttAAC-TTATTGTTGCTGAAAACTCTa 3'
778 - 803 111.00 -9.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-122-5p :: CYP7A1    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay ,
Conditions HepG2
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , miRBase Target Database
Original Description (Extracted from the article) ... In this study we focused on miR-122a and miR-422a since putative binding sites for those two miRNAs are localized in the 3’-UTR of CYP7A1 mRNA. Inhibition of CYP7A1 mRNA expression by miR-122a-mimic and miR-422a-mimic, and stimulation by their inhibitors confirmed the inhibitory effect of these two miRNAs on CYP7A1 mRNA expression. Furthermore, miR-122a-mimic and miR-422a-mimic inhibit the activity of luciferase reporters containing miR-122a and miR-422a target sequences found in the 3’-UTR of human CYP7A1 mRNA. These results clearly demonstrated that these two miRNAs were functional in inhibiting CYP7A1 expression.// A putative miR-422a targeting sequence was located in the 3’-UTR of human CYP8B1 mRNA but was not functional. Target validation of miR-122a and miR-422a on the 3’-UTR of human CYP7A1 mRNA//The miR-122a- and miR-422a-mimics nhibited, whereas their inhibitors stimulated CYP7A1 mRNA expression. These miRNAs specifically inhibited the activity of the CYP7A1-3’UTR reporter plasmids, and mutations of miRNA binding sites in 3’UTR abrogated miRNAs inhibition of reporter activity. These results suggest that miR-122a and miR-422a may destabilize mRNA to inhibit CYP7A1 expression. ...

- Song, K. H. Li, T. Owsley, E. Chiang, J. Y., 2010, J Lipid Res.

Article - Song, K. H. Li, T. Owsley, E. Chiang, J. Y.
- J Lipid Res, 2010
Cholesterol 7alpha-hydroxylase (CYP7A1) plays a critical role in regulation of bile acid synthesis in the liver. CYP7A1 mRNAs have very short half-lives, and bile acids destabilize CYP7A1 mRNA via the 3'-untranslated region (3'-UTR). However, the underlying mechanism of translational regulation of CYP7A1 mRNA remains unknown. Screening of a human micro RNA (miRNA) microarray has identified five differentially expressed miRNAs in human primary hepatocytes treated with chenodeoxycholic acid, GW4064, or fibroblast growth factor (FGF)19. These compounds also significantly induced the expression of miR-122a, a liver-specific and the predominant miRNA in human hepatocytes. The putative recognition sequences for miR-122a and miR-422a were localized in the 3'-UTR of human CYP7A1 mRNA. The miR-122a and miR-422a mimics inhibited, whereas their inhibitors stimulated CYP7A1 mRNA expression. These miRNAs specifically inhibited the activity of the CYP7A1-3'-UTR reporter plasmids, and mutations of miRNA binding sites in 3'-UTR abrogated miRNA inhibition of reporter activity. These results suggest that miR-122a and miR-422a may destabilize CYP7A1 mRNA to inhibit CYP7A1 expression. However, these miRNAs did not play a role in mediating FGF19 inhibition of CYP7A1 transcription. Under certain conditions, miRNA may reduce CYP7A1 mRNA stability to inhibit bile acid synthesis, and the miR-122a antagomirs may stimulate bile acid synthesis to reduce serum cholesterol and triglycerides.
LinkOut: [PMID: 20351063]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
534 hsa-miR-122-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450, family 7, subfamily A, polypeptide 1 3 1
MIRT000364 IGF1R insulin-like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor (c-fos serum response element-binding transcription factor) 4 1
MIRT000663 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 2 1
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 (muscle) 4 2
MIRT003081 ANK2 ankyrin 2, neuronal 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase A, fructose-bisphosphate 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 (class I) 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl CpG binding protein 2 (Rett syndrome) 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 3 3
MIRT003100 TPD52L2 tumor protein D52-like 2 4 3
MIRT003102 GALNT10 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) 3 1
MIRT003103 G6PC3 glucose 6 phosphatase, catalytic, 3 4 2
MIRT003104 AP3M2 adaptor-related protein complex 3, mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 3 1
MIRT003109 TRIB1 tribbles homolog 1 (Drosophila) 3 1
MIRT003110 EGLN3 egl nine homolog 3 (C. elegans) 3 1
MIRT003111 NUMBL numb homolog (Drosophila)-like 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117, member B 3 1
MIRT004364 BCL2L2 BCL2-like 2 4 2
MIRT004527 PRKAB1 protein kinase, AMP-activated, beta 1 non-catalytic subunit 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor, type IC 1 1
MIRT006123 PRKRA protein kinase, interferon-inducible double stranded RNA dependent activator 4 1
MIRT006421 WNT1 wingless-type MMTV integration site family, member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase, alpha polypeptide I 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT023218 PHOX2A paired-like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting protein 1-like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 (muscle) 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR-related lipid transfer (START) domain containing 13 1 1
MIRT023223 CNN3 calponin 3, acidic 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus homolog 1 (Drosophila) 1 1
MIRT023230 CDY2B chromodomain protein, Y-linked, 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC, polypeptide 6, alpha 35kDa 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal-associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52, riboflavin transporter, member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase type 13A3 1 1
MIRT023240 CPNE5 copine V 1 1
MIRT023241 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase, class VI, type 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT023249 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 glycosyltransferase-like domain containing 2 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44, member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor (GEF) 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY (sex determining region Y)-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin-conjugating enzyme E2L 3 1 1
MIRT023268 DNAJC18 DnaJ (Hsp40) homolog, subfamily C, member 18 1 1
MIRT023269 FAM102A family with sequence similarity 102, member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN/MADD domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase (decycling) 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25, member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA-damage-inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT023285 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain family 11, member A 1 1
MIRT023287 CENPF centromere protein F, 350/400kDa (mitosin) 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen-related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT023295 MYCBP c-myc binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen, RNA binding protein, homolog 2 (Drosophila) 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A, alpha (PABA peptide hydrolase) 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin-conjugating enzyme E2K 1 1
MIRT023305 PPP1R9B protein phosphatase 1, regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety homolog 3 (Drosophila) 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium channel, voltage-gated, type IV, beta subunit 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT023314 DMXL1 Dmx-like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine-rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT023318 RBBP5 retinoblastoma binding protein 5 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118, member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain containing E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper transcription factor, ATF-like 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT023330 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family, member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2-like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family, member 1 1 1
MIRT023341 LCA5 Leber congenital amaurosis 5 1 1
MIRT023342 NODAL nodal homolog (mouse) 1 1
MIRT023343 CASP7 caspase 7, apoptosis-related cysteine peptidase 1 1
MIRT023344 CPA3 carboxypeptidase A3 (mast cell) 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11, testis-specific 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT023351 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT023352 CPNE4 copine IV 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT023356 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 breast cancer 2, early onset 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 (H+/peptide transporter), member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 KIAA0101 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 1
MIRT023373 IFNA1 interferon, alpha 1 1 1
MIRT023374 FSTL3 follistatin-like 3 (secreted glycoprotein) 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 (brain) 1 1
MIRT023378 DCTN5 dynactin 5 (p25) 1 1
MIRT023379 CHST3 carbohydrate (chondroitin 6) sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate (chondroitin 4) sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor, beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex, subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 low density lipoprotein receptor-related protein 11 1 1
MIRT023393 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2-associated X protein 2 2
MIRT023403 CDK4 cyclin-dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 hippocampus abundant transcript-like 1 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 1
MIRT438206 TGFB1 transforming growth factor, beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide-binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 (alpha (1,6) fucosyltransferase) 3 1
MIRT449879 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5 1 1
MIRT451716 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein-like 10 1 7
MIRT454344 CDKL1 cyclin-dependent kinase-like 1 (CDC2-related kinase) 1 1
MIRT455826 ZSWIM1 zinc finger, SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 6
MIRT461654 G6PC glucose-6-phosphatase, catalytic subunit 1 1
MIRT461934 TNFSF14 tumor necrosis factor (ligand) superfamily, member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT469456 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 3
MIRT469637 RAD21 RAD21 homolog (S. pombe) 1 3
MIRT473432 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT473872 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 5
MIRT500014 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) 1 3
MIRT510320 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF, polypeptide 1, 74kDa 1 1
MIRT516410 COPA coatomer protein complex, subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex, subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin-dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig-like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 chromosome 19 open reading frame 52 1 2
MIRT531913 SLC4A1 solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) 1 1
MIRT532678 PATZ1 POZ (BTB) and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family, member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin, beta 1 2
MIRT536742 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT537237 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT539523 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex, subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine, 16 (thymus) 1 1
MIRT571143 HM13 histocompatibility (minor) 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger, SWIM domain containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin-like 7 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 1
MIRT607655 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT607795 RHBDL2 rhomboid, veinlet-like 2 (Drosophila) 1 1
MIRT607842 PHLDA3 pleckstrin homology-like domain, family A, member 3 1 1
MIRT607927 ANG angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 zinc finger protein 14 homolog (mouse) 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family-like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial translation optimization 1 homolog (S. cerevisiae) 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1-associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT620091 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT620483 XKR6 XK, Kell blood group complex subunit-related family, member 6 1 1
MIRT620570 WBSCR27 Williams Beuren syndrome chromosome region 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase, epsilon 64kDa 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7-like 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) 1 1
MIRT627077 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT627140 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing, apoptosis associated protein 2 1 1
MIRT627441 TAS2R5 taste receptor, type 2, member 5 1 1
MIRT628078 KAT7 K(lysine) acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT629236 CINP cyclin-dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A (C. elegans) 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor (GEF) 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin-like 2 1 1
MIRT630278 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor, alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin-like 1 (S. pombe) 1 1
MIRT634600 KIAA1919 KIAA1919 1 1
MIRT635050 MYH11 myosin, heavy chain 11, smooth muscle 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine-rich repeats and calponin homology (CH) domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16, member 5 (monocarboxylic acid transporter 6) 1 1
MIRT637134 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae) 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89kDa 1 1
MIRT637788 OLA1 Obg-like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 protein tyrosine phosphatase-like A domain containing 2 1 1
MIRT643123 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35, member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217, member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 (brain) 1 1
MIRT647095 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase domain family, member 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT648865 ABCA6 ATP-binding cassette, sub-family A (ABC1), member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase-associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4, 24kDa 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19-like 4 (C. elegans) 1 1
MIRT660878 ADRBK2 adrenergic, beta, receptor kinase 2 1 2
MIRT661101 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT661238 ARL17B ADP-ribosylation factor-like 17B 1 1
MIRT661291 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT663542 CCR6 chemokine (C-C motif) receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase homolog (S. cerevisiae) 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 homolog B (C. elegans) 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) 1 1
MIRT665359 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) 1 1
MIRT667748 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT669291 C17orf85 chromosome 17 open reading frame 85 1 1
MIRT669547 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 (metallopeptidase M20 family) 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38, member 9 1 1
MIRT671554 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing, family S member 1 1 2
MIRT672196 F2 coagulation factor II (thrombin) 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt-inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 (zymogen granule membrane) 1 1
MIRT672430 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT672597 NKPD1 NTPase, KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2-like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 homolog (S. cerevisiae) 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC-like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 chromosome 9 open reading frame 69 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne homolog 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement component 3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT684404 TMEM180 transmembrane protein 180 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel, shaker-related subfamily, member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT691760 BCL2L15 BCL2-like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35, member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen, type XIII, alpha 1 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT706863 MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia, complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 1 1
MIRT707032 ACTR5 ARP5 actin-related protein 5 homolog (yeast) 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*