Accession ID: MIRT000020 [miRNA, hsa-miR-148a-3p :: DNMT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-148aLinkOut: [miRBase ]
Description Homo sapiens miR-148a stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-148a-3p
Mature Sequence 44| UCAGUGCACUACAGAACUUUGU |65
Evidence Experimental
Experiments Cloned
Putative hsa-miR-148a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DNMT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIM, CXXC9, DNMT, FLJ16293, MCMT, MGC104992
Description DNA (cytosine-5-)-methyltransferase 1
Transcript NM_0011308    LinkOut: [ RefSeq ]
Other Transcripts NM_0013   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DNMT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DNMT1
(miRNA target sites are highlighted)
>DNMT1|NM_0011308|3'UTR
   1 GCCAAAGCCCGAGAGAGTGCCTCAGCTAAAATAAAGGAGGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCC
  81 TGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTA
 161 CATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGT
 241 GCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAATTA
 321 AGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACCAAAAAAAAAAAAAAAAAAAA
 401 AAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-148a-3p :: DNMT1    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions Mz-ChA-1
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Article - Braconi, C. Huang, N. Patel, T.
- Hepatology, 2010
Although the inflammation-associated cytokine interleukin-6 (IL-6) has been implicated in cholangiocarcinoma growth, the relationship between IL-6 and oncogenic changes is unknown. IL-6 can increase expression of DNA methyltransferase-1 (DNMT-1) and epigenetically regulate the expression of several genes, including microRNAs (miRNAs). DNMT-1 up-regulation occurs in hepatobiliary cancers and is associated with a poor prognosis. To understand the potential regulation of DNMT-1 by IL-6-dependent miRNAs, we examined the expression of a group of miRNAs which have sequence complementarity to the 3'-untranslated region of DNMT-1, namely miR-148a, miR-152, and miR-301. The expression of these miRNAs was decreased in cholangiocarcinoma cells. Moreover, the expression of all three miRNAs was decreased in IL-6-overexpressing malignant cholangiocytes in vitro and in tumor cell xenografts. There was a concomitant decrease in expression of the methylation-sensitive tumor suppressor genes Rassf1a and p16INK4a. Using luciferase reporter constructs, DNMT-1 was verified as a target for miR-148a and miR-152. Precursors to miR-148a and miR-152 decreased DNMT-1 protein expression, increased Rassf1a and p16INK4a expression, and reduced cell proliferation. Conclusion: These data indicate that IL-6 can regulate the activity of DNMT-1 and expression of methylation-dependent tumor suppressor genes by modulation of miR-148a and miR-152, and provide a link between this inflammation-associated cytokine and oncogenesis in cholangiocarcinoma. (HEPATOLOGY 2010.).
LinkOut: [PMID: 20146264]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-148a-3p :: DNMT1    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot
Conditions HeLa , MCF-7 , Jurkat
Location of target site 3'UTR, CDS
Tools used in this research RNA22
Original Description (Extracted from the article) ... Overexpression of miR-21 and miR-148a also markedly reduced DNMT1 expression (Fig. 2C). Together, these data indicated that the upregulation of miR-21 and miR-148a expression can inhibit DNMT1 expression.//miR-21 indirectly downregulates DNMT1 expression by targeting its upstream regulator, RASGRP1//miR-148a directly downregulates DNMT1 expression by targeting the protein coding region of its transcript// All of these data suggested that miR-148a directly inhibited DNMT1 protein expression through interaction with the protein coding region of DNMT1 transcript. ...

- Pan, W. Zhu, S. Yuan, M. Cui, H. Wang, L. et al., 2010, J Immunol.

Article - Pan, W. Zhu, S. Yuan, M. Cui, H. Wang, L. et al.
- J Immunol, 2010
Systemic lupus erythematosus is a complex autoimmune disease caused by genetic and epigenetic alterations. DNA methylation abnormalities play an important role in systemic lupus erythematosus disease processes. MicroRNAs (miRNAs) have been implicated as fine-tuning regulators controlling diverse biological processes at the level of posttranscriptional repression. Dysregulation of miRNAs has been described in various disease states, including human lupus. Whereas previous studies have shown miRNAs can regulate DNA methylation by targeting the DNA methylation machinery, the role of miRNAs in aberrant CD4(+) T cell DNA hypomethylation of lupus is unclear. In this study, by using high-throughput microRNA profiling, we identified that two miRNAs (miR-21 and miR-148a) overexpressed in CD4(+) T cells from both patients with lupus and lupus-prone MRL/lpr mice, which promote cell hypomethylation by repressing DNA methyltransferase 1 (DNMT1) expression. This in turn leads to the overexpression of autoimmune-associated methylation-sensitive genes, such as CD70 and LFA-1, via promoter demethylation. Further experiments revealed that miR-21 indirectly downregulated DNMT1 expression by targeting an important autoimmune gene, RASGRP1, which mediated the Ras-MAPK pathway upstream of DNMT1; miR-148a directly downregulated DNMT1 expression by targeting the protein coding region of its transcript. Additionally, inhibition of miR-21 and miR-148a expression in CD4(+) T cells from patients with lupus could increase DNMT1 expression and attenuate DNA hypomethylation. Together, our data demonstrated a critical functional link between miRNAs and the aberrant DNA hypomethylation in lupus CD4(+) T cells and could help to develop new therapeutic approaches.
LinkOut: [PMID: 20483747]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-148a-3p :: DNMT1    [ Functional MTI ]
Validation Method Flow , qRT-PCR , Western blot
Conditions SGC7901 , BGC-823 , MGC-803 , GES-1
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Fig. 4 MiR-148a directly targets DNMT1. ...

- Zhu, A. Xia, J. Zuo, J. Jin, S. Zhou, H. et al., 2012, Med Oncol.

Article - Zhu, A. Xia, J. Zuo, J. Jin, S. Zhou, H. et al.
- Med Oncol, 2012
Studies have shown that microRNA-148a (miR-148a) was proved to be silenced while DNA methyltransferase 1 (DNMT1) was over-expressed in gastric cancer. But the mechanism of aberrant expression of miR-148a and DNMT1 and their relationships in gastric cancer are still unknown. The aims of this study were to investigate the expression profile of miR-148a and DNMT1 and reveal whether they have any relationships. We used reverse-transcriptase quantitative real-time PCR, methylation-specific PCR and Western blot to measure the level of miR-148a expression, DNA methylation level and DNMT1 expression, respectively. Gastric cancer cells were transfected with plasmid or siRNA or treated with 5-aza-2'-deoxycytidine. Cell proliferation and apoptosis were detected by cell counting and flow cytometric analysis. In this study, we demonstrated that gastric cancer tissues and cell lines displayed a consistent down-regulation of miR-148a and hypermethylation of promoter region. DNMT1 was over-expressed in primary tumors and cell lines, while knockdown of DNMT1 using siRNA could decrease methylation level of miR-148a promoter and restore its expression. Furthermore, ectopic over-expression of miR-148a in cancer cell lines caused reduction in DNMT1 expression and inhibited cell proliferation, but no obvious change was found in apoptosis rate. These results suggest that miR-148a is inactivated by DNA hypermethylation of promoter region in gastric cancer, which is mediated through DNMT1 over-expression. Additionally, the silence of miR-148a reduces its suppression to DNMT1 in gastric cancer, and this may in turn result in over-expression of DNMT1 and promote DNA hypermethylation.
LinkOut: [PMID: 22167392]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
81 hsa-miR-148a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000020 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 3
MIRT000297 HLA-G major histocompatibility complex, class I, G 2 1
MIRT000298 TGIF2 TGFB-induced factor homeobox 2 3 2
MIRT000955 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 5 2
MIRT003998 NR1I2 nuclear receptor subfamily 1, group I, member 2 3 1
MIRT004504 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 4 1
MIRT005898 CCKBR cholecystokinin B receptor 2 1
MIRT006859 IRS1 insulin receptor substrate 1 2 1
MIRT006946 ACVR1 activin A receptor, type I 1 1
MIRT006975 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT007017 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT025970 GPATCH8 G patch domain containing 8 1 1
MIRT025971 TMEM14A transmembrane protein 14A 1 1
MIRT025972 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT025973 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT025974 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT025975 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT025976 CYCS cytochrome c, somatic 1 1
MIRT025977 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 1 1
MIRT025978 CBX3 chromobox homolog 3 (HP1 gamma homolog, Drosophila) 1 1
MIRT025979 UQCRQ ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa 1 1
MIRT025980 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT025981 PAN3 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1
MIRT025982 KANSL1 KIAA1267 1 1
MIRT025983 GAS1 growth arrest-specific 1 1 1
MIRT025984 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 1
MIRT025985 ZNF92 zinc finger protein 92 1 1
MIRT025986 RAB10 RAB10, member RAS oncogene family 1 1
MIRT025987 PAPD4 PAP associated domain containing 4 1 1
MIRT025988 HCCS holocytochrome c synthase 1 1
MIRT025989 WAPAL wings apart-like homolog (Drosophila) 1 1
MIRT025990 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT025991 ZNF490 zinc finger protein 490 1 1
MIRT025992 RAB12 RAB12, member RAS oncogene family 1 1
MIRT025993 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT025994 SNAPIN SNAP-associated protein 1 1
MIRT025995 PSMD9 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 1 1
MIRT025996 TRIM59 tripartite motif-containing 59 1 1
MIRT025997 DYNLL2 dynein, light chain, LC8-type 2 1 1
MIRT025998 SECISBP2L SECIS binding protein 2-like 1 1
MIRT025999 LYSMD1 LysM, putative peptidoglycan-binding, domain containing 1 1 1
MIRT026000 PBXIP1 pre-B-cell leukemia homeobox interacting protein 1 1 1
MIRT026001 MTMR9 myotubularin related protein 9 1 1
MIRT026002 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT026003 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT026004 LBR lamin B receptor 1 1
MIRT026005 KIAA1549 KIAA1549 1 1
MIRT026006 DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 1 1
MIRT026007 CDK19 cyclin-dependent kinase 19 1 1
MIRT026008 RAB34 RAB34, member RAS oncogene family 1 1
MIRT026009 ARRDC3 arrestin domain containing 3 1 1
MIRT026010 PRNP prion protein 1 1
MIRT026011 HOXC8 homeobox C8 1 1
MIRT026012 TMEM9B TMEM9 domain family, member B 1 1
MIRT026013 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 1
MIRT026014 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT026015 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT026016 SESTD1 SEC14 and spectrin domains 1 1 1
MIRT026017 CDC25B cell division cycle 25 homolog B (S. pombe) 3 1
MIRT048023 MRPL45 mitochondrial ribosomal protein L45 1 1
MIRT048024 DENR density-regulated protein 1 1
MIRT048025 APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 1 1
MIRT048026 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT048027 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT048028 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT048029 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT048030 AMELX amelogenin, X-linked 1 1
MIRT048031 OR2C3 olfactory receptor, family 2, subfamily C, member 3 1 1
MIRT048032 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT048033 APC adenomatous polyposis coli 1 1
MIRT048034 GOLIM4 golgi integral membrane protein 4 1 1
MIRT048035 MYCBP2 MYC binding protein 2 1 1
MIRT048036 RPS17 ribosomal protein S17 1 1
MIRT048037 HSPA4 heat shock 70kDa protein 4 1 1
MIRT048038 WDTC1 WD and tetratricopeptide repeats 1 1 1
MIRT048039 HMGB1 high-mobility group box 1 1 1
MIRT048040 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT048041 USP38 ubiquitin specific peptidase 38 1 1
MIRT048042 NONO non-POU domain containing, octamer-binding 1 1
MIRT048043 CCNI cyclin I 1 1
MIRT048044 AURKB aurora kinase B 1 1