Accession ID: MIRT000032 [miRNA, hsa-miR-7-5p :: SNCA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-7-1LinkOut: [miRBase ]
Synonyms MIRN7-1, hsa-mir-7-1, mir-7-1, MIR7-1
Description Homo sapiens miR-7-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-7-5p
Mature Sequence 24| UGGAAGACUAGUGAUUUUGUUGU |46
Evidence Experimental
Experiments Cloned
Putative hsa-miR-7-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SNCA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC110988, NACP, PARK1, PARK4, PD1
Description synuclein, alpha (non A4 component of amyloid precursor)
Transcript NM_0003    LinkOut: [ RefSeq ]
Other Transcripts NM_0011460 , NM_0011460 , NM_0073   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SNCA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SNCA
(miRNA target sites are highlighted)
>SNCA|NM_0003|3'UTR
   1 TAAGAAATATCTTTGCTCCCAGTTTCTTGAGATCTGCTGACAGATGTTCCATCCTGTACAAGTGCTCAGTTCCAATGTGC
  81 CCAGTCATGACATTTCTCAAAGTTTTTACAGTGTATCTCGAAGTCTTCCATCAGCAGTGATTGAAGTATCTGTACCTGCC
 161 CCCACTCAGCATTTCGGTGCTTCCCTTTCACTGAAGTGAATACATGGTAGCAGGGTCTTTGTGTGCTGTGGATTTTGTGG
 241 CTTCAATCTACGATGTTAAAACAAATTAAAAACACCTAAGTGACTACCACTTATTTCTAAATCCTCACTATTTTTTTGTT
 321 GCTGTTGTTCAGAAGTTGTTAGTGATTTGCTATCATATATTATAAGATTTTTAGGTGTCTTTTAATGATACTGTCTAAGA
 401 ATAATGACGTATTGTGAAATTTGTTAATATATATAATACTTAAAAATATGTGAGCATGAAACTATGCACCTATAAATACT
 481 AAATATGAAATTTTACCATTTTGCGATGTGTTTTATTCACTTGTGTTTGTATATAAATGGTGAGAATTAAAATAAAACGT
 561 TATCTCATTGCAAAAATATTTTATTTTTATCCCATCTCACTTTAATAATAAAAATCATGCTTATAAGCAACATGAATTAA
 641 GAACTGACACAAAGGACAAAAATATAAAGTTATTAATAGCCATTTGAAGAAGGAGGAATTTTAGAAGAGGTAGAGAAAAT
 721 GGAACATTAACCCTACACTCGGAATTCCCTGAAGCAACACTGCCAGAAGTGTGTTTTGGTATGCACTGGTTCCTTAAGTG
 801 GCTGTGATTAATTATTGAAAGTGGGGTGTTGAAGACCCCAACTACTATTGTAGAGTGGTCTATTTCTCCCTTCAATCCTG
 881 TCAATGTTTGCTTTACGTATTTTGGGGAACTGTTGTTTGATGTGTATGTGTTTATAATTGTTATACATTTTTAATTGAGC
 961 CTTTTATTAACATATATTGTTATTTTTGTCTCGAAATAATTTTTTAGTTAAAATCTATTTTGTCTGATATTGGTGTGAAT
1041 GCTGTACCTTTCTGACAATAAATAATATTCGACCATGAATAAAAAAAAAAAAAAAGTGGGTTCCCGGGAACTAAGCAGTG
1121 TAGAAGATGATTTTGACTACACCCTCCTTAGAGAGCCATAAGACACATTAGCACATATTAGCACATTCAAGGCTCTGAGA
1201 GAATGTGGTTAACTTTGTTTAACTCAGCATTCCTCACTTTTTTTTTTTAATCATCAGAAATTCTCTCTCTCTCTCTCTCT
1281 TTTTCTCTCGCTCTCTTTTTTTTTTTTTTTTTACAGGAAATGCCTTTAAACATCGTTGGAACTACCAGAGTCACCTTAAA
1361 GGAGATCAATTCTCTAGACTGATAAAAATTTCATGGCCTCCTTTAAATGTTGCCAAATATATGAATTCTAGGATTTTTCC
1441 TTAGGAAAGGTTTTTCTCTTTCAGGGAAGATCTATTAACTCCCCATGGGTGCTGAAAATAAACTTGATGGTGAAAAACTC
1521 TGTATAAATTAATTTAAAAATTATTTGGTTTCTCTTTTTAATTATTCTGGGGCATAGTCATTTCTAAAAGTCACTAGTAG
1601 AAAGTATAATTTCAAGACAGAATATTCTAGACATGCTAGCAGTTTATATGTATTCATGAGTAATGTGATATATATTGGGC
1681 GCTGGTGAGGAAGGAAGGAGGAATGAGTGACTATAAGGATGGTTACCATAGAAACTTCCTTTTTTACCTAATTGAAGAGA
1761 GACTACTACAGAGTGCTAAGCTGCATGTGTCATCTTACACTAGAGAGAAATGGTAAGTTTCTTGTTTTATTTAAGTTATG
1841 TTTAAGCAAGGAAAGGATTTGTTATTGAACAGTATATTTCAGGAAGGTTAGAAAGTGGCGGTTAGGATATATTTTAAATC
1921 TACCTAAAGCAGCATATTTTAAAAATTTAAAAGTATTGGTATTAAATTAAGAAATAGAGGACAGAACTAGACTGATAGCA
2001 GTGACCTAGAACAATTTGAGATTAGGAAAGTTGTGACCATGAATTTAAGGATTTATGTGGATACAAATTCTCCTTTAAAG
2081 TGTTTCTTCCCTTAATATTTATCTGACGGTAATTTTTGAGCAGTGAATTACTTTATATATCTTAATAGTTTATTTGGGAC
2161 CAAACACTTAAACAAAAAGTTCTTTAAGTCATATAAGCCTTTTCAGGAAGCTTGTCTCATATTCACTCCCGAGACATTCA
2241 CCTGCCAAGTGGCCTGAGGATCAATCCAGTCCTAGGTTTATTTTGCAGACTTACATTCTCCCAAGTTATTCAGCCTCATA
2321 TGACTCCACGGTCGGCTTTACCAAAACAGTTCAGAGTGCACTTTGGCACACAATTGGGAACAGAACAATCTAATGTGTGG
2401 TTTGGTATTCCAAGTGGGGTCTTTTTCAGAATCTCTGCACTAGTGTGAGATGCAAACATGTTTCCTCATCTTTCTGGCTT
2481 ATCCAGTATGTAGCTATTTGTGACATAATAAATATATACATATATGAAAATA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-7-5p :: SNCA    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar , miRBase Target Database
Original Description (Extracted from the article) ... Here, we show that microRNA-7 (miR-7),which is expressed mainly in neurons, represses -synuclein protein levels through the 3-untranslated region (UTR) of -synuclein mRNA. ...

- Junn, E. Lee, K. W. Jeong, B. S. Chan, T. et al., 2009, Proc Natl Acad Sci U S A.

Article - Junn, E. Lee, K. W. Jeong, B. S. Chan, T. et al.
- Proc Natl Acad Sci U S A, 2009
alpha-Synuclein is a key protein in Parkinson's disease (PD) because it accumulates as fibrillar aggregates in pathologic hallmark features in affected brain regions, most notably in nigral dopaminergic neurons. Intraneuronal levels of this protein appear critical in mediating its toxicity, because multiplication of its gene locus leads to autosomal dominant PD, and transgenic animal models overexpressing human alpha-synuclein manifest impaired function or decreased survival of dopaminergic neurons. Here, we show that microRNA-7 (miR-7), which is expressed mainly in neurons, represses alpha-synuclein protein levels through the 3'-untranslated region (UTR) of alpha-synuclein mRNA. Importantly, miR-7-induced down-regulation of alpha-synuclein protects cells against oxidative stress. Further, in the MPTP-induced neurotoxin model of PD in cultured cells and in mice, miR-7 expression decreases, possibly contributing to increased alpha-synuclein expression. These findings provide a mechanism by which alpha-synuclein levels are regulated in neurons, have implications for the pathogenesis of PD, and suggest miR-7 as a therapeutic target for PD and other alpha-synucleinopathies.
LinkOut: [PMID: 19628698]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-7-5p :: SNCA    [ Functional MTI ]
Validation Method Immunocytochemistry , Luciferase reporter assay , qRT-PCR , Western blot
Conditions 293
Disease Parkinson\'s disease
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... Mir-7 and Mir-153 Post-transcriptionally Control SNCA Expression via Its 3'-UTR// Mir-7 and Mir-153 Regulate Endogenous SNCA Protein Levels in Neurons// This study has revealed a previously unknown mechanism by which SNCA levels are regulated in the nervous system. Specifically, two brain-enriched miRNAs, mir-7 and mir-153, have been shown to bind directly to the 3'-UTR of SNCA mRNA and significantly reduce its levels// ...

- Doxakis, E., 2010, J Biol Chem.

Article - Doxakis, E.
- J Biol Chem, 2010
Genetic and biochemical studies have established a central role for alpha-synuclein accumulation in the pathogenesis of Parkinson disease. Here, two microRNAs, namely mir-7 and mir-153, have been identified to regulate alpha-synuclein levels post-transcriptionally. These microRNAs bind specifically to the 3'-untranslated region of alpha-synuclein and down-regulate its mRNA and protein levels, with their effect being additive. They are expressed predominantly in the brain with a pattern that mirrors synuclein expression in different tissues as well as during neuronal development, indicating that they play a tuning role in the amount of alpha-synuclein produced. Overexpression of mir-7 and mir-153 significantly reduces endogenous alpha-synuclein levels, whereas inhibition of mir-7 and mir-153 enhances translation of a luciferase construct bearing the alpha-synuclein 3'-untranslated region in primary neurons. These findings reveal a significant additional mechanism by which alpha-synuclein is regulated and point toward new therapeutic regimes for lowering endogenous alpha-synuclein levels in patients with familial or sporadic Parkinson disease.
LinkOut: [PMID: 20106983]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
387 hsa-miR-7-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000032 SNCA synuclein, alpha (non A4 component of amyloid precursor) 4 2
MIRT000668 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 4 3
MIRT002289 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 5 9
MIRT003199 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 4 2
MIRT003807 IRS1 insulin receptor substrate 1 2 1
MIRT003808 IRS2 insulin receptor substrate 2 3 1
MIRT004026 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 5 2
MIRT004057 CKAP4 cytoskeleton-associated protein 4 3 2
MIRT004058 CNOT8 CCR4-NOT transcription complex, subunit 8 3 2
MIRT004059 CNN3 calponin 3, acidic 2 1
MIRT004060 CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 2 2
MIRT004061 ARF4 ADP-ribosylation factor 4 2 1
MIRT004062 PFN2 profilin 2 2 1
MIRT004063 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 2 1
MIRT004076 PLEC plectin 2 1
MIRT004360 Hells helicase, lymphoid specific 2 1
MIRT004361 HELLS helicase, lymphoid-specific 1 1
MIRT004497 SRSF1 splicing factor, arginine/serine-rich 1 4 1
MIRT004528 SLC7A5 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 4 1
MIRT005364 IGF1R insulin-like growth factor 1 receptor 4 2
MIRT006777 PIK3CD phosphoinositide-3-kinase, catalytic, delta polypeptide 1 1
MIRT006838 HOXB3 homeobox B3 1 1
MIRT006900 PTK2 PTK2 protein tyrosine kinase 2 2 1
MIRT006902 HOXB5 homeobox B5 3 1
MIRT006904 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT025628 SLC25A39 solute carrier family 25, member 39 2 2
MIRT025629 SLC26A3 solute carrier family 26, member 3 1 1
MIRT025630 KCNH2 potassium voltage-gated channel, subfamily H (eag-related), member 2 1 1
MIRT025631 TCL1B T-cell leukemia/lymphoma 1B 1 1
MIRT025632 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 1
MIRT025633 SNAP29 synaptosomal-associated protein, 29kDa 1 1
MIRT025634 SP7 Sp7 transcription factor 1 1
MIRT025635 MAP1B microtubule-associated protein 1B 1 1
MIRT025636 TUSC2 tumor suppressor candidate 2 1 1
MIRT025637 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT025638 RPL15 ribosomal protein L15 1 2
MIRT025639 LYPLA2 lysophospholipase II 1 1
MIRT025640 LCE1E late cornified envelope 1E 1 1
MIRT025641 HTRA4 HtrA serine peptidase 4 1 1
MIRT025642 MFSD5 major facilitator superfamily domain containing 5 1 1
MIRT025643 KRT80 keratin 80 1 1
MIRT025644 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT025645 GJC1 gap junction protein, gamma 1, 45kDa 1 1
MIRT025646 ARMC10 armadillo repeat containing 10 1 1
MIRT025647 KCNK13 potassium channel, subfamily K, member 13 1 1
MIRT025648 RHBDF2 rhomboid 5 homolog 2 (Drosophila) 1 1
MIRT025649 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT025650 KRTAP4-2 keratin associated protein 4-2 1 1
MIRT025651 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT025652 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT025653 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 1 1
MIRT025654 WNT8B wingless-type MMTV integration site family, member 8B 1 1
MIRT025655 HPS6 Hermansky-Pudlak syndrome 6 1 1
MIRT025656 MATR3 matrin 3 1 1
MIRT025657 OR1A1 olfactory receptor, family 1, subfamily A, member 1 1 1
MIRT025658 PMEPA1 prostate transmembrane protein, androgen induced 1 1 1
MIRT025659 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT025660 GLT8D2 glycosyltransferase 8 domain containing 2 1 1
MIRT025661 PLEKHH1 pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 1 1
MIRT025662 TMEM134 transmembrane protein 134 1 1
MIRT025663 SLC52A2 G protein-coupled receptor 172A 1 1
MIRT025664 KRTAP11-1 keratin associated protein 11-1 1 1
MIRT025665 TAPBP TAP binding protein (tapasin) 1 1
MIRT025666 FGF1 fibroblast growth factor 1 (acidic) 1 1
MIRT025667 EHD3 EH-domain containing 3 1 1
MIRT025668 LAMC2 laminin, gamma 2 1 1
MIRT025669 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT025670 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT025671 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT025672 PDGFC platelet derived growth factor C 1 1
MIRT025673 TSN translin 1 1
MIRT025674 ACOT4 acyl-CoA thioesterase 4 1 1
MIRT025675 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT025676 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT025677 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) 1 1
MIRT025678 GFRA1 GDNF family receptor alpha 1 1 1
MIRT025679 PLEKHB1 pleckstrin homology domain containing, family B (evectins) member 1 1 1
MIRT025680 TMEM69 transmembrane protein 69 1 1
MIRT025681 ZNF625 zinc finger protein 625 1 1
MIRT025682 PCED1B family with sequence similarity 113, member B 1 1
MIRT025683 HSPBP1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 1 1
MIRT025684 ANXA11 annexin A11 1 1
MIRT025685 RCC2 regulator of chromosome condensation 2 1 1
MIRT025686 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT025687 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT025688 PHF16 PHD finger protein 16 1 1
MIRT025689 CANT1 calcium activated nucleotidase 1 1 1
MIRT025690 IGSF3 immunoglobulin superfamily, member 3 1 1
MIRT025691 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT025692 NDC1 transmembrane protein 48 1 1
MIRT025693 EXOSC2 exosome component 2 1 1
MIRT025694 ZNF555 zinc finger protein 555 1 1
MIRT025695 ADCY9 adenylate cyclase 9 1 1
MIRT025696 KIAA0247 KIAA0247 1 1
MIRT025697 C5orf22 chromosome 5 open reading frame 22 1 1
MIRT025698 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT025699 HDLBP high density lipoprotein binding protein 1 1
MIRT025700 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT025701 RSPRY1 ring finger and SPRY domain containing 1 1 1
MIRT025702 HMGN4 high mobility group nucleosomal binding domain 4 1 1
MIRT025703 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT025704 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT025705 CHAMP1 zinc finger protein 828 1 1
MIRT025706 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT025707 TMUB2 transmembrane and ubiquitin-like domain containing 2 1 1
MIRT025708 TSC22D4 TSC22 domain family, member 4 1 1
MIRT025709 GRB2 growth factor receptor-bound protein 2 1 1
MIRT025710 SERTAD2 SERTA domain containing 2 1 1
MIRT025711 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT025712 JPH1 junctophilin 1 1 1
MIRT025713 STK40 serine/threonine kinase 40 1 1
MIRT025714 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT025715 CLK3 CDC-like kinase 3 1 1
MIRT025716 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT025717 FNDC4 fibronectin type III domain containing 4 1 1
MIRT025718 EHD1 EH-domain containing 1 1 2
MIRT025719 SCARB2 scavenger receptor class B, member 2 1 2
MIRT025720 IDE insulin-degrading enzyme 1 2
MIRT025721 PPIF peptidylprolyl isomerase F 2 2
MIRT025722 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 2 3
MIRT025723 DUS1L dihydrouridine synthase 1-like (S. cerevisiae) 1 1
MIRT025724 ATF5 activating transcription factor 5 1 1
MIRT025725 ZNF655 zinc finger protein 655 1 1
MIRT025726 GPR19 G protein-coupled receptor 19 1 1
MIRT025727 RNF114 ring finger protein 114 1 1
MIRT025728 SIGMAR1 sigma non-opioid intracellular receptor 1 1 1
MIRT025729 KRTAP4-7 keratin associated protein 4-7 1 1
MIRT025730 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT025731 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT025732 IL12RB2 interleukin 12 receptor, beta 2 1 1
MIRT025733 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT025734 PRDM8 PR domain containing 8 1 1
MIRT025735 IGFBP4 insulin-like growth factor binding protein 4 1 1
MIRT025736 CHRNA2 cholinergic receptor, nicotinic, alpha 2 (neuronal) 1 1
MIRT025737 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT025738 UBE3C ubiquitin protein ligase E3C 1 1
MIRT025739 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT025740 DUSP23 dual specificity phosphatase 23 1 1
MIRT025741 GRAMD1A GRAM domain containing 1A 1 1
MIRT025742 CDC42EP4 CDC42 effector protein (Rho GTPase binding) 4 1 1
MIRT025743 KRT7 keratin 7 1 1
MIRT025744 CFLAR CASP8 and FADD-like apoptosis regulator 1 1
MIRT025745 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif, 17 1 1
MIRT025746 ANKRD31 ankyrin repeat domain 31 1 1
MIRT025747 SERTAD4 SERTA domain containing 4 1 1
MIRT025748 TSEN34 tRNA splicing endonuclease 34 homolog (S. cerevisiae) 1 1
MIRT025749 POLR2E polymerase (RNA) II (DNA directed) polypeptide E, 25kDa 1 1
MIRT025750 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT025751 CCDC65 coiled-coil domain containing 65 1 1
MIRT025752 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 1 1
MIRT025753 HOXC12 homeobox C12 1 1
MIRT025754 WASF2 WAS protein family, member 2 2 2
MIRT025755 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT025756 GIT1 G protein-coupled receptor kinase interacting ArfGAP 1 1 1
MIRT025757 VAMP8 vesicle-associated membrane protein 8 (endobrevin) 1 1
MIRT025758 ZNF365 zinc finger protein 365 1 1
MIRT025759 ROR1 receptor tyrosine kinase-like orphan receptor 1 1 1
MIRT025760 C10orf105 chromosome 10 open reading frame 105 1 1
MIRT025761 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT025762 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT025763 CRTAP cartilage associated protein 1 1
MIRT025764 IGSF8 immunoglobulin superfamily, member 8 1 1
MIRT025765 CLN3 ceroid-lipofuscinosis, neuronal 3 1 1
MIRT025766 HIATL1 hippocampus abundant transcript-like 1 1 1
MIRT025767 CASP9 caspase 9, apoptosis-related cysteine peptidase 1 1
MIRT025768 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT025769 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT025770 PHC2 polyhomeotic homolog 2 (Drosophila) 1 1
MIRT025771 FAM89B family with sequence similarity 89, member B 1 1
MIRT025772 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT025773 GINS1 GINS complex subunit 1 (Psf1 homolog) 1 1
MIRT025774 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT025775 DBNL drebrin-like 1 1
MIRT025776 MIF4GD MIF4G domain containing 1 1
MIRT025777 FLNA filamin A, alpha 1 1
MIRT025778 TGOLN2 trans-golgi network protein 2 1 1
MIRT025779 RSU1 Ras suppressor protein 1 1 1
MIRT025780 HECTD3 HECT domain containing 3 1 1
MIRT025781 GLO1 glyoxalase I 1 1
MIRT025782 ZNF264 zinc finger protein 264 1 1
MIRT025783 DOCK5 dedicator of cytokinesis 5 1 1
MIRT025784 RAB11FIP5 RAB11 family interacting protein 5 (class I) 1 1
MIRT025785 MARCKSL1 MARCKS-like 1 1 1
MIRT025786 NXT2 nuclear transport factor 2-like export factor 2 1 1
MIRT025787 LRRC59 leucine rich repeat containing 59 1 1
MIRT025788 NR1H2 nuclear receptor subfamily 1, group H, member 2 1 1
MIRT025789 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT025790 OSBPL11 oxysterol binding protein-like 11 1 1
MIRT025791 SETD8 SET domain containing (lysine methyltransferase) 8 1 1
MIRT025792 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 1 1
MIRT025793 POLE4 polymerase (DNA-directed), epsilon 4 (p12 subunit) 1 1
MIRT025794 KEAP1 kelch-like ECH-associated protein 1 1 1
MIRT025795 BTG2 BTG family, member 2 1 1
MIRT025796 HOXA3 homeobox A3 1 1
MIRT025797 PRDX1 peroxiredoxin 1 1 1
MIRT025798 ZNF460 zinc finger protein 460 1 1
MIRT025799 ARL15 ADP-ribosylation factor-like 15 1 1
MIRT025800 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT025801 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT025802 PDIA3 protein disulfide isomerase family A, member 3 1 1
MIRT025803 ZNF805 zinc finger protein 805 1 1
MIRT025804 CRLS1 cardiolipin synthase 1 1 1
MIRT025805 CPNE2 copine II 1 2
MIRT025806 APLP2 amyloid beta (A4) precursor-like protein 2 1 2
MIRT025807 TMEM97 transmembrane protein 97 1 2
MIRT025808 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 2 2
MIRT025809 WDR45 WD repeat domain 45 1 1
MIRT025810 RPS19BP1 ribosomal protein S19 binding protein 1 1 1
MIRT025811 ZP3 zona pellucida glycoprotein 3 (sperm receptor) 1 1
MIRT025812 MICALL1 MICAL-like 1 1 1
MIRT025813 IL21R interleukin 21 receptor 1 1
MIRT025814 KCNJ14 potassium inwardly-rectifying channel, subfamily J, member 14 1 1
MIRT025815 SRM spermidine synthase 1 1
MIRT025816 C17orf78 chromosome 17 open reading frame 78 1 1
MIRT025817 ZYX zyxin 1 1
MIRT025818 ALDH3B2 aldehyde dehydrogenase 3 family, member B2 1 1
MIRT025819 EXOC3 exocyst complex component 3 1 1
MIRT025820 TMEM38B transmembrane protein 38B 1 1
MIRT025821 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT025822 TNP1 transition protein 1 (during histone to protamine replacement) 1 1
MIRT025823 RNF128 ring finger protein 128 1 1
MIRT025824 ZDHHC3 zinc finger, DHHC-type containing 3 1 1
MIRT025825 MEPCE methylphosphate capping enzyme 1 1
MIRT025826 AUP1 ancient ubiquitous protein 1 1 1
MIRT025827 PRRT3 proline-rich transmembrane protein 3 1 1
MIRT025828 CLEC4G C-type lectin domain family 4, member G 1 1
MIRT025829 CXCL5 chemokine (C-X-C motif) ligand 5 1 1
MIRT025830 BCL9L B-cell CLL/lymphoma 9-like 1 1
MIRT025831 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT025832 GLDN gliomedin 1 1
MIRT025833 TMEM81 transmembrane protein 81 1 1
MIRT025834 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT025835 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 1 1
MIRT025836 EFHD2 EF-hand domain family, member D2 1 1
MIRT025837 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT025838 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative function) 1 1
MIRT025839 MYEOV myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas) 1 1
MIRT025840 TRIM14 tripartite motif-containing 14 1 1
MIRT025841 SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa 1 1
MIRT025842 NUDCD3 NudC domain containing 3 1 1
MIRT025843 SH3BP4 SH3-domain binding protein 4 1 1
MIRT025844 MGLL monoglyceride lipase 1 1
MIRT025845 LYPD3 LY6/PLAUR domain containing 3 1 1
MIRT025846 TRPA1 transient receptor potential cation channel, subfamily A, member 1 1 1
MIRT025847 TAF1 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa 1 1
MIRT025848 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT025849 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT025850 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT025851 SQSTM1 sequestosome 1 1 1
MIRT025852 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT025853 SLC35A5 solute carrier family 35, member A5 1 1
MIRT025854 TMEM43 transmembrane protein 43 1 1
MIRT025855 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT025856 RYK RYK receptor-like tyrosine kinase 1 1
MIRT025857 PAPPA pregnancy-associated plasma protein A, pappalysin 1 1 1
MIRT025858 PDE4D phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) 1 1
MIRT025859 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT025860 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT025861 PIGH phosphatidylinositol glycan anchor biosynthesis, class H 1 1
MIRT025862 TRMT13 coiled-coil domain containing 76 1 1
MIRT025863 KIF16B kinesin family member 16B 1 1
MIRT025864 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT025865 SETD1B SET domain containing 1B 1 1
MIRT025866 C19orf12 chromosome 19 open reading frame 12 1 1
MIRT025867 DNAJC11 DnaJ (Hsp40) homolog, subfamily C, member 11 1 1
MIRT025868 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT025869 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT025870 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT025871 SIRT2 sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) 1 1
MIRT025872 NRSN2 neurensin 2 1 1
MIRT025873 ZNF436 zinc finger protein 436 1 1
MIRT025874 TRAM2 translocation associated membrane protein 2 1 1
MIRT025875 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT025876 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT025877 NFYA nuclear transcription factor Y, alpha 1 1
MIRT025878 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT025879 COLEC12 collectin sub-family member 12 1 1
MIRT025880 LITAF lipopolysaccharide-induced TNF factor 1 2
MIRT025881 TPGS2 chromosome 18 open reading frame 10 1 2
MIRT025882 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 2
MIRT025883 GLS glutaminase 1 2
MIRT025884 AP1M1 adaptor-related protein complex 1, mu 1 subunit 2 2
MIRT025885 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 1 2
MIRT025886 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 2 2
MIRT025887 KIF24 kinesin family member 24 1 1
MIRT025888 PMP2 peripheral myelin protein 2 1 1
MIRT025889 SNAPIN SNAP-associated protein 1 1
MIRT025890 AGK acylglycerol kinase 1 1
MIRT025891 TAGLN transgelin 1 1
MIRT025892 ACTN2 actinin, alpha 2 1 1
MIRT025893 HPCAL1 hippocalcin-like 1 1 1
MIRT025894 CAGE1 cancer antigen 1 1 1
MIRT025895 SSX1 synovial sarcoma, X breakpoint 1 1 1
MIRT025896 SULT1C2 sulfotransferase family, cytosolic, 1C, member 2 1 1
MIRT025897 DSC2 desmocollin 2 1 1
MIRT025898 IFNE interferon, epsilon 1 1
MIRT025899 ARG1 arginase, liver 1 1
MIRT025900 MAP2K2 mitogen-activated protein kinase kinase 2 1 1
MIRT025901 SHISA5 shisa homolog 5 (Xenopus laevis) 1 1
MIRT025902 ASB2 ankyrin repeat and SOCS box-containing 2 1 1
MIRT025903 DEFA5 defensin, alpha 5, Paneth cell-specific 1 1
MIRT025904 CDC25B cell division cycle 25 homolog B (S. pombe) 1 1
MIRT025905 TRIM47 tripartite motif-containing 47 1 1
MIRT025906 WFS1 Wolfram syndrome 1 (wolframin) 1 1
MIRT025907 CDC37 cell division cycle 37 homolog (S. cerevisiae) 1 1
MIRT025908 MINA MYC induced nuclear antigen 1 1
MIRT025909 RDH16 retinol dehydrogenase 16 (all-trans) 1 1
MIRT025910 CACNG5 calcium channel, voltage-dependent, gamma subunit 5 1 1
MIRT025911 GDNF glial cell derived neurotrophic factor 1 1
MIRT025912 MAS1L MAS1 oncogene-like 1 1
MIRT025913 ZFAND4 AN1, ubiquitin-like, homolog (Xenopus laevis) 1 1
MIRT025914 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT025915 CORO6 coronin 6 1 1
MIRT025916 PARP11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT025917 TRIM8 tripartite motif-containing 8 1 1
MIRT025918 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 1 1
MIRT025919 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT025920 ACVR1B activin A receptor, type IB 1 1
MIRT025921 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT025922 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT025923 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT025924 SUPT4H1 suppressor of Ty 4 homolog 1 (S. cerevisiae) 1 1
MIRT025925 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT025926 COMMD7 COMM domain containing 7 1 1
MIRT025927 CAMK2D calcium/calmodulin-dependent protein kinase II delta 1 1
MIRT025928 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT025929 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT025930 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT025931 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT025932 OAS2 2'-5'-oligoadenylate synthetase 2, 69/71kDa 1 1
MIRT025933 ALDH3A2 aldehyde dehydrogenase 3 family, member A2 1 1
MIRT025934 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT025935 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT025936 TBC1D2B TBC1 domain family, member 2B 1 1
MIRT025937 SZRD1 chromosome 1 open reading frame 144 1 1
MIRT025938 RFFL ring finger and FYVE-like domain containing 1 1 1
MIRT025939 POLE3 polymerase (DNA directed), epsilon 3 (p17 subunit) 1 1
MIRT025940 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT025941 VPS13D vacuolar protein sorting 13 homolog D (S. cerevisiae) 1 1
MIRT025942 USP31 ubiquitin specific peptidase 31 1 1
MIRT025943 GPAA1 glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) 1 1
MIRT025944 UBE2R2 ubiquitin-conjugating enzyme E2R 2 1 1
MIRT025945 NBL1 neuroblastoma, suppression of tumorigenicity 1 1 1
MIRT025946 CALU calumenin 1 1
MIRT025947 DTYMK deoxythymidylate kinase (thymidylate kinase) 1 1
MIRT025948 ALDH1A3 aldehyde dehydrogenase 1 family, member A3 1 1
MIRT025949 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT025950 UBQLN4 ubiquilin 4 1 1
MIRT025951 DAZAP2 DAZ associated protein 2 1 1
MIRT025952 PIK3CB phosphoinositide-3-kinase, catalytic, beta polypeptide 1 1
MIRT025953 RUSC1 RUN and SH3 domain containing 1 1 1
MIRT025954 GTF3C5 general transcription factor IIIC, polypeptide 5, 63kDa 1 1
MIRT025955 ERI2 ERI1 exoribonuclease family member 2 1 1
MIRT025956 NDFIP2 Nedd4 family interacting protein 2 1 1
MIRT025957 DCTD dCMP deaminase 1 1
MIRT025958 PTK7 PTK7 protein tyrosine kinase 7 1 1
MIRT025959 SLC25A37 solute carrier family 25, member 37 1 1
MIRT025960 SLC25A44 solute carrier family 25, member 44 1 1
MIRT025961 SERTAD3 SERTA domain containing 3 1 1
MIRT025962 FAM126B family with sequence similarity 126, member B 1 1
MIRT025963 RNF38 ring finger protein 38 1 1
MIRT025964 RNF41 ring finger protein 41 1 1
MIRT025965 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT025966 CAPN2 calpain 2, (m/II) large subunit 1 1
MIRT025967 SPATA2 spermatogenesis associated 2 1 1
MIRT025968 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 2
MIRT047753 PHF10 PHD finger protein 10 1 1
MIRT047754 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT047755 PNISR splicing factor, arginine/serine-rich 18 1 1
MIRT047756 RPS3A ribosomal protein S3A 1 1
MIRT047757 E2F2 E2F transcription factor 2 1 1
MIRT047758 SNX29 sorting nexin 29 1 1
MIRT047759 UNC119 unc-119 homolog (C. elegans) 1 1
MIRT047760 C3orf38 chromosome 3 open reading frame 38 1 1
MIRT047761 EIF3L eukaryotic translation initiation factor 3, subunit L 1 1
MIRT047762 XRCC5 X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) 1 1
MIRT047763 TAF4 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa 1 1
MIRT047764 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT047765 KPNB1 karyopherin (importin) beta 1 1 1
MIRT047766 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT047767 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 1 1
MIRT047768 MOCS3 molybdenum cofactor synthesis 3 1 1
MIRT047769 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT047770 ZNF507 zinc finger protein 507 1 1
MIRT047771 RWDD1 RWD domain containing 1 1 1
MIRT047772 RBM17 RNA binding motif protein 17 1 1
MIRT047773 NAV1 neuron navigator 1 1 1