Accession ID: MIRT000036 [miRNA, hsa-miR-559 :: ERBB2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-559LinkOut: [miRBase ]
Synonyms MIRN559, hsa-mir-559, MIR559
Description Homo sapiens miR-559 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-559
Mature Sequence 16| UAAAGUAAAUAUGCACCAAAA |36
Evidence Experimental
Experiments SAGE
Putative hsa-miR-559 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ERBB2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD340, HER-2, HER-2/neu, HER2, MLN 19, NEU, NGL, TKR1
Description v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
Transcript NM_0010058    LinkOut: [ RefSeq ]
Other Transcripts NM_0044   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ERBB2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ERBB2
(miRNA target sites are highlighted)
>ERBB2|NM_0010058|3'UTR
   1 TGAACCAGAAGGCCAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTCTGCTGGCATCAAGA
  81 GGTGGGAGGGCCCTCCGACCACTTCCAGGGGAACCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGA
 161 GTTCCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGGGGAGTCTTTGTGGATTCTGAGGCCCTG
 241 CCCAATGAGACTCTAGGGTCCAGTGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGAAAGCCTT
 321 AGGGAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTCTAAGAACAAAAGCGACCCATTCAGAGACTGTCCCTGA
 401 AACCTAGTACTGCCCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGGCTTTGTACAGAGTGCTTTTCTGTTTAG
 481 TTTTTACTTTTTTTGTTTTGTTTTTTTAAAGATGAAATAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGT
 561 GTGGGGGGTCCTTCTCCACACCCACTTTGTCCATTTGCAAATATATTTTGGAAAACAGCTA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-559 :: ERBB2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other , Reporter assay;Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... miR-548d-3p, miR-559 can interfere with recombinant luciferase mRNA translation via direct interaction with the ERBB2 3'-UTR// ...

- Chen, H. Sun, J. G. Cao, X. W. Ma, X. G. et al., 2009, Biochem Biophys Res Commun.

Article - Chen, H. Sun, J. G. Cao, X. W. Ma, X. G. et al.
- Biochem Biophys Res Commun, 2009
ERBB2 overexpression occurs in numerous types of primary human tumors and alterations in microRNA (miRNA) expression have been associated with tumor suppression or tumorigenesis in human cancer, nevertheless, little is known about natural miRNAs acting on ERBB2. In this study, bioinformatical analysis of the 3'-UTRs of ERBB2 revealed the target elements for miR-548d-3p and miR-559. Moreover, a predicted miRNA/mRNA interaction experimental validation showed that both miR-548d-3p and miR-559 can interact specifically with the 3'-UTR of the ERBB2 mRNA. And miR-548d-3p plus miR-559 transfection showed a cooperative regulation of translationally repressing ERBB2 mRNA rather than by either miR-548d-3p or miR-559 alone. These results not only support the idea that different miRNAs can simultaneously and cooperatively repress a given target mRNA but also preliminarily validate the role of miR-548d-3p and miR-559 in regulating the ERBB2 expression. These data provide molecular basis for the application of miRNAs in ERBB2-targeted therapy.
LinkOut: [PMID: 19486885]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
5 hsa-miR-559 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000036 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT004115 VCL vinculin 2 1
MIRT004116 MTA2 metastasis associated 1 family, member 2 2 1
MIRT004442 MTA1 metastasis associated 1 3 1
MIRT007228 FXN frataxin 1 1