Accession ID: MIRT000037 [miRNA, hsa-miR-548d-3p :: ERBB2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-548d-1LinkOut: [miRBase ]
Synonyms MIRN548D1, MIR548D1
Description Homo sapiens miR-548d-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-548d-3p
Mature Sequence 61| CAAAAACCACAGUUUCUUUUGC |82
Evidence Experimental
Experiments RT-PCR
Putative hsa-miR-548d-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ERBB2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD340, HER-2, HER-2/neu, HER2, MLN 19, NEU, NGL, TKR1
Description v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
Transcript NM_001005862    LinkOut: [ RefSeq ]
Other Transcripts NM_004448   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ERBB2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ERBB2
(miRNA target sites are highlighted)
>ERBB2|NM_001005862|3'UTR
   1 ACCAGAAGGCCAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTCTGCTGGCATCAAGAGGT
  81 GGGAGGGCCCTCCGACCACTTCCAGGGGAACCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGAGTT
 161 CCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGGGGAGTCTTTGTGGATTCTGAGGCCCTGCCC
 241 AATGAGACTCTAGGGTCCAGTGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGAAAGCCTTAGG
 321 GAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTCTAAGAACAAAAGCGACCCATTCAGAGACTGTCCCTGAAAC
 401 CTAGTACTGCCCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGGCTTTGTACAGAGTGCTTTTCTGTTTAGTTT
 481 TTACTTTTTTTGTTTTGTTTTTTTAAAGATGAAATAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGTGTG
 561 GGGGGTCCTTCTCCACACCCACTTTGTCCATTTGCAAATATATTTTGGAAAACAGCTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgUUUUCUUUGACACCAAAAac 5'
            ::::||:| || ||| ||  
Target 5' caGGGGGAGAATG-GGTGTTgt 3'
523 - 543 107.00 -12.30
2
miRNA  3' cgUUUUCUU----UGA-CAC-CAAAAAc 5'
            |:|:|||    ||| | | || ||| 
Target 5' gaAGAGGAACAGCACTGGGGAGTCTTTg 3'
193 - 220 98.00 -9.50
3
miRNA  3' cgUUUUCUUUGAC---ACCAAAaac 5'
            ::|||:||| |   |||| |   
Target 5' gaGGAAGGAACAGCAATGGTGTcag 3'
418 - 442 96.00 -7.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-548d-3p :: ERBB2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other , Reporter assay;Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... miR-548d-3p, miR-559 can interfere with recombinant luciferase mRNA translation via direct interaction with the ERBB2 3'-UTR// ...

- Chen, H. Sun, J. G. Cao, X. W. Ma, X. G. et al., 2009, Biochem Biophys Res Commun.

Article - Chen, H. Sun, J. G. Cao, X. W. Ma, X. G. et al.
- Biochem Biophys Res Commun, 2009
ERBB2 overexpression occurs in numerous types of primary human tumors and alterations in microRNA (miRNA) expression have been associated with tumor suppression or tumorigenesis in human cancer, nevertheless, little is known about natural miRNAs acting on ERBB2. In this study, bioinformatical analysis of the 3'-UTRs of ERBB2 revealed the target elements for miR-548d-3p and miR-559. Moreover, a predicted miRNA/mRNA interaction experimental validation showed that both miR-548d-3p and miR-559 can interact specifically with the 3'-UTR of the ERBB2 mRNA. And miR-548d-3p plus miR-559 transfection showed a cooperative regulation of translationally repressing ERBB2 mRNA rather than by either miR-548d-3p or miR-559 alone. These results not only support the idea that different miRNAs can simultaneously and cooperatively repress a given target mRNA but also preliminarily validate the role of miR-548d-3p and miR-559 in regulating the ERBB2 expression. These data provide molecular basis for the application of miRNAs in ERBB2-targeted therapy.
LinkOut: [PMID: 19486885]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
278 hsa-miR-548d-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000037 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT055857 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT074954 LEPROT leptin receptor overlapping transcript 1 1
MIRT076816 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 2
MIRT078700 LLGL2 lethal giant larvae homolog 2 (Drosophila) 1 1
MIRT099602 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 2
MIRT103350 CBX3 chromobox homolog 3 1 1
MIRT111787 MPZL1 myelin protein zero-like 1 1 1
MIRT114044 AKAP11 A kinase (PRKA) anchor protein 11 1 6
MIRT133703 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT136810 NHLRC3 NHL repeat containing 3 1 3
MIRT149888 LDLR low density lipoprotein receptor 1 1
MIRT166905 TNPO1 transportin 1 1 1
MIRT168136 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT190779 STRN3 striatin, calmodulin binding protein 3 1 2
MIRT207456 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT250945 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 2
MIRT271988 ARF1 ADP-ribosylation factor 1 1 2
MIRT282615 IGF1R insulin-like growth factor 1 receptor 1 4
MIRT294149 ZNF845 zinc finger protein 845 1 1
MIRT309051 C4ORF3 chromosome 4 open reading frame 3 1 1
MIRT318543 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT319747 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 1
MIRT331317 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT337196 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 3
MIRT346138 ALYREF Aly/REF export factor 1 1
MIRT347717 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT350495 MRGBP MRG/MORF4L binding protein 1 3
MIRT356403 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 1
MIRT357980 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT374392 M6PR mannose-6-phosphate receptor (cation dependent) 1 3
MIRT442725 TMEM158 transmembrane protein 158 (gene/pseudogene) 1 1
MIRT443409 HMX3 H6 family homeobox 3 1 1
MIRT444406 FRMD5 FERM domain containing 5 1 1
MIRT444467 PTPRG protein tyrosine phosphatase, receptor type, G 1 1
MIRT444648 HSBP1 heat shock factor binding protein 1 1 1
MIRT444859 EXD2 exonuclease 3'-5' domain containing 2 1 1
MIRT445683 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT446000 CD1D CD1d molecule 1 1
MIRT446072 RABIF RAB interacting factor 1 1
MIRT446306 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT446430 ABHD2 abhydrolase domain containing 2 1 1
MIRT447267 C3orf30 chromosome 3 open reading frame 30 1 1
MIRT447757 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT448159 P2RY10 purinergic receptor P2Y, G-protein coupled, 10 1 1
MIRT449047 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 1 1
MIRT449273 PALM2 paralemmin 2 1 1
MIRT450121 IMP3 IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT450153 GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 1 1
MIRT451287 ZNF101 zinc finger protein 101 1 1
MIRT459251 ADRBK1 adrenergic, beta, receptor kinase 1 1 1
MIRT462552 NUDT19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 1 1
MIRT464468 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT465118 TSC22D2 TSC22 domain family, member 2 1 2
MIRT467994 SKIL SKI-like oncogene 1 1
MIRT468716 SDC4 syndecan 4 1 1
MIRT469267 RHOB ras homolog family member B 1 1
MIRT470673 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470721 POGK pogo transposable element with KRAB domain 1 1
MIRT471436 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT471499 PDE4D phosphodiesterase 4D, cAMP-specific 1 2
MIRT471986 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 2
MIRT472384 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT475026 KANSL1 KAT8 regulatory NSL complex subunit 1 1 4
MIRT479409 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 5
MIRT480512 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT481698 AR androgen receptor 1 1
MIRT482541 ACTB actin, beta 1 2
MIRT482625 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT484723 INHBA inhibin, beta A 1 6
MIRT487776 ANKEF1 ankyrin repeat domain 5 1 8
MIRT491881 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT494651 ARNTL aryl hydrocarbon receptor nuclear translocator-like 1 1
MIRT497364 SF1 splicing factor 1 1 1
MIRT499154 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT502828 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 3
MIRT502942 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 4
MIRT503940 FBXL13 F-box and leucine-rich repeat protein 13 1 2
MIRT504233 MYO6 myosin VI 1 1
MIRT504451 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) 1 1
MIRT506020 PURA purine-rich element binding protein A 1 1
MIRT508026 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 2
MIRT508297 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 2
MIRT511513 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT512305 AMER1 family with sequence similarity 123B 1 3
MIRT514563 XRCC3 X-ray repair complementing defective repair in Chinese hamster cells 3 1 2
MIRT515655 MYBPC1 myosin binding protein C, slow type 1 1
MIRT518427 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT520376 UBE2D1 ubiquitin-conjugating enzyme E2D 1 1 2
MIRT521602 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 2
MIRT521723 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 2
MIRT522577 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT522729 LRRC55 leucine rich repeat containing 55 1 4
MIRT525369 SYNM synemin, intermediate filament protein 1 1
MIRT526487 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 2
MIRT527195 CLASP1 cytoplasmic linker associated protein 1 1 1
MIRT527283 FBLN2 fibulin 2 1 1
MIRT527381 MGARP mitochondria-localized glutamic acid-rich protein 1 1
MIRT527406 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 3
MIRT527452 COL4A3 collagen, type IV, alpha 3 (Goodpasture antigen) 1 1
MIRT528346 TBC1D22B TBC1 domain family, member 22B 1 1
MIRT529102 ZNF100 zinc finger protein 100 1 1
MIRT529315 ATRNL1 attractin-like 1 1 1
MIRT529326 PDE5A phosphodiesterase 5A, cGMP-specific 1 1
MIRT529748 SEL1L sel-1 suppressor of lin-12-like (C. elegans) 1 1
MIRT530275 MKRN3 makorin ring finger protein 3 1 1
MIRT531412 TMEM18 transmembrane protein 18 1 1
MIRT532542 WDR13 WD repeat domain 13 1 1
MIRT533243 VKORC1L1 vitamin K epoxide reductase complex, subunit 1-like 1 1 1
MIRT534657 RNF20 ring finger protein 20, E3 ubiquitin protein ligase 1 1
MIRT534816 RAB33B RAB33B, member RAS oncogene family 1 1
MIRT537490 FAM169A family with sequence similarity 169, member A 1 1
MIRT538776 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT539120 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT539688 NWD1 NACHT and WD repeat domain containing 1 1 1
MIRT540395 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT540962 SLC25A43 solute carrier family 25, member 43 1 1
MIRT541401 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT543351 ZNF829 zinc finger protein 829 1 1
MIRT543621 MFAP3 microfibrillar-associated protein 3 1 1
MIRT543648 YY2 YY2 transcription factor 1 1
MIRT544943 SNCB synuclein, beta 1 1
MIRT545325 SPC25 SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT546092 VEZF1 vascular endothelial zinc finger 1 1 1
MIRT548603 DCUN1D3 DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) 1 1
MIRT548636 DAZAP1 DAZ associated protein 1 1 2
MIRT550316 ZNF681 zinc finger protein 681 1 1
MIRT550410 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 2
MIRT551032 SPPL3 signal peptide peptidase like 3 1 1
MIRT551600 HDGFRP2 hepatoma-derived growth factor-related protein 2 1 1
MIRT552062 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 2
MIRT552801 YAF2 YY1 associated factor 2 1 1
MIRT553272 TVP23C family with sequence similarity 18, member B2 1 1
MIRT553301 TSPAN3 tetraspanin 3 1 1
MIRT553568 NPM3 nucleophosmin/nucleoplasmin 3 1 1
MIRT554842 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT556067 MTF2 metal response element binding transcription factor 2 1 2
MIRT556896 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT558678 CNIH cornichon homolog (Drosophila) 1 1
MIRT559030 C20orf24 chromosome 20 open reading frame 24 1 1
MIRT559106 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT559862 GSKIP GSK3B interacting protein 1 1
MIRT560866 GAL3ST3 galactose-3-O-sulfotransferase 3 1 1
MIRT562266 GRB2 growth factor receptor-bound protein 2 1 1
MIRT562417 EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa 1 1
MIRT562650 ARID1A AT rich interactive domain 1A (SWI-like) 1 2
MIRT563769 ZNF678 zinc finger protein 678 1 1
MIRT564277 DEPDC1B DEP domain containing 1B 1 1
MIRT565251 TRA2B transformer 2 beta homolog (Drosophila) 1 2
MIRT565305 TMEM64 transmembrane protein 64 1 1
MIRT566032 RFX1 regulatory factor X, 1 (influences HLA class II expression) 1 1
MIRT566712 MTMR3 myotubularin related protein 3 1 1
MIRT568085 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT568415 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT568764 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT569514 THYN1 thymocyte nuclear protein 1 1 1
MIRT571821 PHF19 PHD finger protein 19 1 1
MIRT571993 HOXA9 homeobox A9 1 1
MIRT572172 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT572635 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT573754 KHSRP KH-type splicing regulatory protein 1 1
MIRT574088 CCDC132 coiled-coil domain containing 132 1 3
MIRT574309 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT574511 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT574557 NRBF2 nuclear receptor binding factor 2 1 1
MIRT576684 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT608489 NKTR natural killer-tumor recognition sequence 1 3
MIRT608638 ATP9A ATPase, class II, type 9A 1 3
MIRT609229 TMEM189 transmembrane protein 189 1 1
MIRT609559 TCEAL4 transcription elongation factor A (SII)-like 4 1 1
MIRT610191 FAM49A family with sequence similarity 49, member A 1 1
MIRT610679 SYT2 synaptotagmin II 1 2
MIRT610723 NAV2 neuron navigator 2 1 1
MIRT610811 SGOL2 shugoshin-like 2 (S. pombe) 1 1
MIRT610991 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT611028 KCNK10 potassium channel, subfamily K, member 10 1 1
MIRT611337 SLC2A4 solute carrier family 2 (facilitated glucose transporter), member 4 1 1
MIRT611509 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT611636 EDIL3 EGF-like repeats and discoidin I-like domains 3 1 1
MIRT611854 RPL3L ribosomal protein L3-like 1 1
MIRT611903 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 1
MIRT612045 PCNXL2 pecanex-like 2 (Drosophila) 1 3
MIRT612338 TRIB2 tribbles homolog 2 (Drosophila) 1 1
MIRT612868 INO80C INO80 complex subunit C 1 1
MIRT613553 AMPD3 adenosine monophosphate deaminase 3 1 1
MIRT614488 MMS22L MMS22-like, DNA repair protein 1 1
MIRT615096 BRD4 bromodomain containing 4 1 1
MIRT616226 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT617218 GDPGP1 GDP-D-glucose phosphorylase 1 1 1
MIRT617882 ESR1 estrogen receptor 1 1 1
MIRT618342 CD59 CD59 molecule, complement regulatory protein 1 1
MIRT620262 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT620658 CCDC108 coiled-coil domain containing 108 1 1
MIRT620759 CCR5 chemokine (C-C motif) receptor 5 (gene/pseudogene) 1 1
MIRT621414 TXNL1 thioredoxin-like 1 1 1
MIRT621674 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT622229 SLC25A51 solute carrier family 25, member 51 1 1
MIRT622375 SALL1 sal-like 1 (Drosophila) 1 1
MIRT622402 RRAGC Ras-related GTP binding C 1 1
MIRT622492 RC3H1 ring finger and CCCH-type domains 1 1 1
MIRT623062 NRXN1 neurexin 1 1 1
MIRT623293 MAX MYC associated factor X 1 1
MIRT623689 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT623928 FMNL3 formin-like 3 1 1
MIRT623982 FAM208A family with sequence similarity 208, member A 1 1
MIRT624511 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 1 1
MIRT624666 ARID4A AT rich interactive domain 4A (RBP1-like) 1 1
MIRT624754 ANGPTL2 angiopoietin-like 2 1 1
MIRT624947 MARCH2 membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase 1 1
MIRT625966 RNF2 ring finger protein 2 1 1
MIRT626413 KIAA2018 KIAA2018 1 1
MIRT626838 TIMM23B translocase of inner mitochondrial membrane 23 homolog B (yeast) 1 1
MIRT626880 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
MIRT627155 ZNF652 zinc finger protein 652 1 1
MIRT627611 SFT2D2 SFT2 domain containing 2 1 1
MIRT627742 RAP2B RAP2B, member of RAS oncogene family 1 2
MIRT627806 PTEN phosphatase and tensin homolog 1 1
MIRT627818 PRR3 proline rich 3 1 1
MIRT630933 UNC93A unc-93 homolog A (C. elegans) 1 1
MIRT635928 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT638299 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT638435 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT640279 TCF24 transcription factor 24 1 1
MIRT641977 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT644177 GIN1 gypsy retrotransposon integrase 1 1 1
MIRT644437 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 1 1
MIRT644972 STEAP4 STEAP family member 4 1 1
MIRT647651 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 1 1
MIRT648700 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT650118 ZCCHC9 zinc finger, CCHC domain containing 9 1 1
MIRT650503 UFM1 ubiquitin-fold modifier 1 1 1
MIRT650699 CLNK cytokine-dependent hematopoietic cell linker 1 1
MIRT651081 ZNF518B zinc finger protein 518B 1 2
MIRT653642 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 1
MIRT653786 SIX4 SIX homeobox 4 1 1
MIRT656771 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT656947 KIAA1456 KIAA1456 1 1
MIRT656979 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT657223 TOR1AIP2 torsin A interacting protein 2 1 2
MIRT657704 GPC5 glypican 5 1 1
MIRT660105 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT662815 C9orf64 chromosome 9 open reading frame 64 1 1
MIRT665887 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT668138 GINS2 GINS complex subunit 2 (Psf2 homolog) 1 1
MIRT668564 ERCC1 excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) 1 1
MIRT669716 AAGAB alpha- and gamma-adaptin binding protein 1 1
MIRT685691 TRIM45 tripartite motif containing 45 1 1
MIRT686577 TMPPE transmembrane protein with metallophosphoesterase domain 1 1
MIRT687489 NHLRC2 NHL repeat containing 2 1 1
MIRT687803 KCNJ15 potassium inwardly-rectifying channel, subfamily J, member 15 1 1
MIRT687966 HHIP hedgehog interacting protein 1 1
MIRT689485 SCIMP SLP adaptor and CSK interacting membrane protein 1 1
MIRT689593 NUDT7 nudix (nucleoside diphosphate linked moiety X)-type motif 7 1 1
MIRT690499 RSRC1 arginine/serine-rich coiled-coil 1 1 1
MIRT692288 XRN2 5'-3' exoribonuclease 2 1 1
MIRT693058 KIAA1324 KIAA1324 1 1
MIRT697441 ZFHX3 zinc finger homeobox 3 1 1
MIRT698473 TJP1 tight junction protein 1 1 1
MIRT699031 SOAT1 sterol O-acyltransferase 1 1 1
MIRT699783 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT701461 NEO1 neogenin 1 1 1
MIRT701867 MRO maestro 1 1
MIRT702156 MAP3K1 mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase 1 1
MIRT703748 FAM126B family with sequence similarity 126, member B 1 1
MIRT704275 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 1
MIRT707954 PGM3 phosphoglucomutase 3 1 1
MIRT712745 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 1
MIRT712846 RHOA ras homolog family member A 1 1
MIRT712952 CCBE1 collagen and calcium binding EGF domains 1 1 1
MIRT713117 U2SURP U2 snRNP-associated SURP domain containing 1 1
MIRT713146 PKIA protein kinase (cAMP-dependent, catalytic) inhibitor alpha 1 1
MIRT715392 TADA3 transcriptional adaptor 3 1 1
MIRT715473 NEGR1 neuronal growth regulator 1 1 1
MIRT715533 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT721157 MYOCD myocardin 1 1
MIRT722717 ZNF460 zinc finger protein 460 1 1
MIRT723128 GTF2F2 general transcription factor IIF, polypeptide 2, 30kDa 1 1
MIRT723257 TMLHE trimethyllysine hydroxylase, epsilon 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*