Accession ID: MIRT000044 [miRNA, hsa-miR-504-5p :: DRD1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-504LinkOut: [miRBase ]
Synonyms MIRN504, hsa-mir-504, MIR504
Description Homo sapiens miR-504 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-504-5p
Mature Sequence 13| AGACCCUGGUCUGCACUCUAUC |34
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-504-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DRD1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DADR, DRD1A
Description dopamine receptor D1
Transcript NM_0007    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DRD1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DRD1
(miRNA target sites are highlighted)
>DRD1|NM_0007|3'UTR
   1 TGAACTCGCAGATGAATCCTGCCACACATGCTCATCCCAAAAGCTAGAGGAGATTGCTCTGGGGCTTGCTATTAAGAAAC
  81 TAAGGTACGGTGAGACTCTGAGGTGTCAGGAGAGCCCTCTGCTGCTTTCCAACACACAATTAACTCCGTTTCCAAATACA
 161 TTCCAGTGTATTTTCTGTGTTGTTCATAGTCAATCAAACAGGGACACTACAAACATGGGGAGCCATAAGGGACATGTCTT
 241 TGGCTTCAGAATTGTTTTTAGAAATTTATTCTTATCTTAGGATTTACCAAATAGGGCAAAGAATCAACAGTGAACAGCTT
 321 CACTTAAAATCAAATTTTTCTGGGAAGAAAATGAGATGGGTTGAGTTTGCTGTATACAAACAGGTGCTAACACTGTTCCC
 401 AGCAAAGTTTTCAGATTGTAAAGGTAGGTGCATGCCTTCATAAATTATTTCTAAAACATTAATTGAGGCTTACAGTAGGA
 481 GTGAGAAATTTTTTTCCAGAATTGAGAGATGTTTTGTTGATATTGGTTCTATTTATTTATTGTATATATGGATATTTTTA
 561 ATTTATGATATAATAAATATATATTTATCATATTTAATAGGATAAATTAATGAGTTTTATCCAAGACCTTACAACCACAT
 641 TTCTGGCCATTTAACTAGCACTTTATAAGCCAATGAAGCAAACACACAGACTCTGTGAGATTCTAAATGTTCATGTGTAA
 721 CTTCTAGAAACACAGCAGAAACTGATAGATAAGGGAATAAAGTTGAAATGATTCCTTAAAATTCATGGACACAGATAAAT
 801 GCAAGGTGAGAATTGACAAATGCTATAAATGCTTTCTTTTTCTGAAAAGATTTTGAAAAATTTAAAAAAGTATAGCTACT
 881 ACTGTGTTCAAAACGTTTTAAATGACAAATGACTTTCCCAGGGGAATTTGCAGTTCTGTAAATATCTTAAATAAAAGCCA
 961 ACTTAAGAAGAGCCCAGCATTAAATTTACGATCTTAGGTGGTAATGAAAAGTATATGCTGCTTTGTATTTATGTAAAATA
1041 ATTGGCCCTCTCCATCTTTTCTCATTTCATGTGTCAGGTAGTTTTTCTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cuAUC--UCACGUCUGGUCCCAGa 5'
            |||  | | || | ||||| | 
Target 5' caTAGTCAAT-CA-AACAGGGACa 3'
185 - 206 116.00 -9.49
2
miRNA  3' cuaucucacgucuGGUCCCaga 5'
                       ||||||   
Target 5' acaaatgactttcCCAGGGgaa 3'
905 - 926 105.00 -9.92
3
miRNA  3' cuaucUCACGUCUGGUCCCAga 5'
               | | ||  |||| ||  
Target 5' ttccaAATACATTCCAGTGTat 3'
150 - 171 101.00 -7.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-504-5p :: DRD1    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Article - Huang, W. Li, M. D.
- Biol Psychiatry, 2009
BACKGROUND: Previously, we reported that dopamine D1 receptor gene (DRD1) is associated with nicotine dependence (ND) and demonstrated that two alleles (A and G) of polymorphism rs686 in the 3'-untranslated region (3'UTR) of DRD1 are expressed differentially. However, the mechanism underlying the differential expression remains to be determined. We hypothesize that it is caused by miRNA targeting. METHODS: We first used the MicroInspector algorithm to identify microRNAs (miRNAs) potentially targeting the rs686 polymorphism in the DRD1 3'UTR and then employed a luciferase reporter assay combined with site-directed mutagenesis to test the predicted miRNA targeting. We also examined the miRNA targeting of DRD1 with a gene expression assay. RESULTS: Of two miRNAs predicted by computational analyses, we found that miR-504, not miR-296, upregulated reporter luciferase activity and increased DRD1 expression by targeting the DRD1 3' UTR, whereas inhibition of miR-504, not miR-296, had the opposite effect. Furthermore, we showed that the direct binding of miR-504 to the DRD1 3'UTR, verified by site-directed mutagenesis, causes a significant expression difference between the two alleles. CONCLUSIONS: miR-504 up-regulates DRD1 expression by direct binding to the 3'UTR, which leads to differential allele-specific expression of DRD1.
LinkOut: [PMID: 19135651]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
32 hsa-miR-504-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000044 DRD1 dopamine receptor D1 2 1
MIRT004457 VEGFA vascular endothelial growth factor A 2 1
MIRT016249 BAX BCL2-associated X protein 1 1
MIRT016251 GADD45A growth arrest and DNA-damage-inducible, alpha 1 1
MIRT016252 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT016253 BBC3 BCL2 binding component 3 1 1
MIRT016254 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT016255 TCEAL1 transcription elongation factor A (SII)-like 1 2 1
MIRT016256 MDM2 Mdm2 p53 binding protein homolog (mouse) 2 1
MIRT016257 TP53 tumor protein p53 3 1
MIRT041072 P2RY13 purinergic receptor P2Y, G-protein coupled, 13 1 1
MIRT041073 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT041074 ZNF814 zinc finger protein 814 1 1
MIRT041075 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT041076 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT041077 TXNRD1 thioredoxin reductase 1 1 1
MIRT041078 RAI1 retinoic acid induced 1 1 1
MIRT041079 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT041080 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041081 PDLIM1 PDZ and LIM domain 1 1 1
MIRT041082 FAM208B chromosome 10 open reading frame 18 1 1
MIRT041083 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT041084 TMEM8A transmembrane protein 8A 1 1
MIRT041085 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT041086 BRD2 bromodomain containing 2 1 1
MIRT041087 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT041088 CNOT8 CCR4-NOT transcription complex, subunit 8 1 1
MIRT041089 RPL10 ribosomal protein L10 1 1
MIRT041090 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT041091 CENPBD1 CENPB DNA-binding domains containing 1 1 1
MIRT041092 SF3B1 splicing factor 3b, subunit 1, 155kDa 1 1
MIRT041093 MTFP1 mitochondrial protein 18 kDa 1 1