Accession ID: MIRT000044 [miRNA, hsa-miR-504-5p :: DRD1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-504LinkOut: [miRBase ]
Synonyms MIRN504, hsa-mir-504, MIR504
Description Homo sapiens miR-504 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-504-5p
Mature Sequence 13| AGACCCUGGUCUGCACUCUAUC |34
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-504-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DRD1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DADR, DRD1A
Description dopamine receptor D1
Transcript NM_000794    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DRD1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DRD1
(miRNA target sites are highlighted)
>DRD1|NM_000794|3'UTR
   1 ACTCGCAGATGAATCCTGCCACACATGCTCATCCCAAAAGCTAGAGGAGATTGCTCTGGGGCTTGCTATTAAGAAACTAA
  81 GGTACGGTGAGACTCTGAGGTGTCAGGAGAGCCCTCTGCTGCTTTCCAACACACAATTAACTCCGTTTCCAAATACATTC
 161 CAGTGTATTTTCTGTGTTGTTCATAGTCAATCAAACAGGGACACTACAAACATGGGGAGCCATAAGGGACATGTCTTTGG
 241 CTTCAGAATTGTTTTTAGAAATTTATTCTTATCTTAGGATTTACCAAATAGGGCAAAGAATCAACAGTGAACAGCTTCAC
 321 TTAAAATCAAATTTTTCTGGGAAGAAAATGAGATGGGTTGAGTTTGCTGTATACAAACAGGTGCTAACACTGTTCCCAGC
 401 AAAGTTTTCAGATTGTAAAGGTAGGTGCATGCCTTCATAAATTATTTCTAAAACATTAATTGAGGCTTACAGTAGGAGTG
 481 AGAAATTTTTTTCCAGAATTGAGAGATGTTTTGTTGATATTGGTTCTATTTATTTATTGTATATATGGATATTTTTAATT
 561 TATGATATAATAAATATATATTTATCATATTTAATAGGATAAATTAATGAGTTTTATCCAAGACCTTACAACCACATTTC
 641 TGGCCATTTAACTAGCACTTTATAAGCCAATGAAGCAAACACACAGACTCTGTGAGATTCTAAATGTTCATGTGTAACTT
 721 CTAGAAACACAGCAGAAACTGATAGATAAGGGAATAAAGTTGAAATGATTCCTTAAAATTCATGGACACAGATAAATGCA
 801 AGGTGAGAATTGACAAATGCTATAAATGCTTTCTTTTTCTGAAAAGATTTTGAAAAATTTAAAAAAGTATAGCTACTACT
 881 GTGTTCAAAACGTTTTAAATGACAAATGACTTTCCCAGGGGAATTTGCAGTTCTGTAAATATCTTAAATAAAAGCCAACT
 961 TAAGAAGAGCCCAGCATTAAATTTACGATCTTAGGTGGTAATGAAAAGTATATGCTGCTTTGTATTTATGTAAAATAATT
1041 GGCCCTCTCCATCTTTTCTCATTTCATGTGTCAGGTAGTTTTTCTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cuAUC--UCACGUCUGGUCCCAGa 5'
            |||  | | || | ||||| | 
Target 5' caTAGTCAAT-CA-AACAGGGACa 3'
182 - 203 116.00 -9.49
2
miRNA  3' cuaucucacgucuGGUCCCaga 5'
                       ||||||   
Target 5' acaaatgactttcCCAGGGgaa 3'
902 - 923 105.00 -9.92
3
miRNA  3' cuaucUCACGUCUGGUCCCAga 5'
               | | ||  |||| ||  
Target 5' ttccaAATACATTCCAGTGTat 3'
147 - 168 101.00 -7.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-504-5p :: DRD1    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Article - Huang, W. Li, M. D.
- Biol Psychiatry, 2009
BACKGROUND: Previously, we reported that dopamine D1 receptor gene (DRD1) is associated with nicotine dependence (ND) and demonstrated that two alleles (A and G) of polymorphism rs686 in the 3'-untranslated region (3'UTR) of DRD1 are expressed differentially. However, the mechanism underlying the differential expression remains to be determined. We hypothesize that it is caused by miRNA targeting. METHODS: We first used the MicroInspector algorithm to identify microRNAs (miRNAs) potentially targeting the rs686 polymorphism in the DRD1 3'UTR and then employed a luciferase reporter assay combined with site-directed mutagenesis to test the predicted miRNA targeting. We also examined the miRNA targeting of DRD1 with a gene expression assay. RESULTS: Of two miRNAs predicted by computational analyses, we found that miR-504, not miR-296, upregulated reporter luciferase activity and increased DRD1 expression by targeting the DRD1 3' UTR, whereas inhibition of miR-504, not miR-296, had the opposite effect. Furthermore, we showed that the direct binding of miR-504 to the DRD1 3'UTR, verified by site-directed mutagenesis, causes a significant expression difference between the two alleles. CONCLUSIONS: miR-504 up-regulates DRD1 expression by direct binding to the 3'UTR, which leads to differential allele-specific expression of DRD1.
LinkOut: [PMID: 19135651]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
101 hsa-miR-504-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000044 DRD1 dopamine receptor D1 2 1
MIRT004457 VEGFA vascular endothelial growth factor A 2 1
MIRT016249 BAX BCL2-associated X protein 1 1
MIRT016251 GADD45A growth arrest and DNA-damage-inducible, alpha 1 1
MIRT016252 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT016253 BBC3 BCL2 binding component 3 1 1
MIRT016254 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT016255 TCEAL1 transcription elongation factor A (SII)-like 1 2 1
MIRT016256 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 2 1
MIRT016257 TP53 tumor protein p53 3 1
MIRT041072 P2RY13 purinergic receptor P2Y, G-protein coupled, 13 1 1
MIRT041073 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT041074 ZNF814 zinc finger protein 814 1 1
MIRT041075 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT041076 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT041077 TXNRD1 thioredoxin reductase 1 1 1
MIRT041078 RAI1 retinoic acid induced 1 1 1
MIRT041079 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT041080 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041081 PDLIM1 PDZ and LIM domain 1 1 1
MIRT041082 FAM208B family with sequence similarity 208, member B 1 1
MIRT041083 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT041084 TMEM8A transmembrane protein 8A 1 1
MIRT041085 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT041086 BRD2 bromodomain containing 2 1 1
MIRT041087 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT041088 CNOT8 CCR4-NOT transcription complex, subunit 8 1 1
MIRT041089 RPL10 ribosomal protein L10 1 1
MIRT041090 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT041091 CENPBD1 CENPB DNA-binding domains containing 1 1 1
MIRT041092 SF3B1 splicing factor 3b, subunit 1, 155kDa 1 1
MIRT041093 MTFP1 mitochondrial fission process 1 1 1
MIRT438313 CDK6 cyclin-dependent kinase 6 1 1
MIRT438352 TFF1 trefoil factor 1 3 1
MIRT443009 KBTBD12 kelch repeat and BTB (POZ) domain containing 12 1 1
MIRT448052 SFRP1 secreted frizzled-related protein 1 1 1
MIRT457649 ZNF69 zinc finger protein 69 1 1
MIRT458626 TRIM72 tripartite motif containing 72 1 1
MIRT466176 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT472583 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 1
MIRT473576 MAT2A methionine adenosyltransferase II, alpha 1 3
MIRT485155 RASL10B RAS-like, family 10, member B 1 1
MIRT490063 PRRT2 proline-rich transmembrane protein 2 1 1
MIRT493015 NANOS1 nanos homolog 1 (Drosophila) 1 1
MIRT499425 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 5
MIRT506956 HOXB3 homeobox B3 1 2
MIRT507100 GPCPD1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) 1 1
MIRT508101 ANKRD33B ankyrin repeat domain 33B 1 2
MIRT522215 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT530327 TNFRSF10D tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain 1 1
MIRT531042 ZNF502 zinc finger protein 502 1 1
MIRT532580 GSS glutathione synthetase 1 1
MIRT534841 RAB15 RAB15, member RAS oncogene family 1 1
MIRT536820 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT538303 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT546344 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 1 1
MIRT546704 RORA RAR-related orphan receptor A 1 2
MIRT549222 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 2
MIRT549623 TMEM101 transmembrane protein 101 1 1
MIRT549931 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT550163 ZNF223 zinc finger protein 223 1 2
MIRT550555 ARSK arylsulfatase family, member K 1 1
MIRT553402 TRIM2 tripartite motif containing 2 1 2
MIRT554084 SNX4 sorting nexin 4 1 2
MIRT556962 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT558525 CSRNP3 cysteine-serine-rich nuclear protein 3 1 1
MIRT558565 CRLF3 cytokine receptor-like factor 3 1 2
MIRT560946 TPM4 tropomyosin 4 1 2
MIRT561628 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT562174 HOXA13 homeobox A13 1 1
MIRT568635 ACVR2A activin A receptor, type IIA 1 1
MIRT574908 Plcg2 phospholipase C, gamma 2 1 1
MIRT575177 Atg9a autophagy related 9A 1 1
MIRT611972 PKD1 polycystic kidney disease 1 (autosomal dominant) 1 1
MIRT613623 CLASP1 cytoplasmic linker associated protein 1 1 2
MIRT635830 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 2
MIRT637344 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 2
MIRT643205 JAK3 Janus kinase 3 1 1
MIRT650232 SIGLEC9 sialic acid binding Ig-like lectin 9 1 1
MIRT655940 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT662021 ZNF445 zinc finger protein 445 1 1
MIRT662037 FUT2 fucosyltransferase 2 (secretor status included) 1 1
MIRT666873 POU2F2 POU class 2 homeobox 2 1 1
MIRT684310 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT687333 OSMR oncostatin M receptor 1 1
MIRT689008 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT695137 PRY2 PTPN13-like, Y-linked 2 1 1
MIRT695154 PRY PTPN13-like, Y-linked 1 1
MIRT700695 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT703269 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT708941 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT709200 SAPCD2 suppressor APC domain containing 2 1 1
MIRT709572 PDE4A phosphodiesterase 4A, cAMP-specific 1 1
MIRT711295 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT712425 MACROD2 MACRO domain containing 2 1 1
MIRT713941 PIGR polymeric immunoglobulin receptor 1 1
MIRT714124 TMED9 transmembrane emp24 protein transport domain containing 9 1 1
MIRT714630 KIAA1143 KIAA1143 1 1
MIRT724046 SMIM14 chromosome 4 open reading frame 34 1 1
MIRT724649 PKDREJ polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin) 1 1
MIRT725476 GRAP2 GRB2-related adaptor protein 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*