Accession ID: MIRT000046 [miRNA, hsa-miR-451a :: MIF, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-451aLinkOut: [miRBase ]
Description Homo sapiens miR-451a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-451a
Mature Sequence 17| AAACCGUUACCAUUACUGAGUU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-451a Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MIF LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GIF, GLIF, MMIF
Description macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Transcript NM_0024    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MIF LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MIF
(miRNA target sites are highlighted)
>MIF|NM_0024|3'UTR
   1 TAAGAGCCGCAGGGACCCACGCTGTCTGCGCTGGCTCCACCCGGGAACCCGCCGCACGCTGTGTTCTAGGCCCGCCCACC
  81 CCAACCTTCTGGTGGGGAGAAATAAACGGTTTAGAGACT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugagUCAUUACCAUUGCCAAa 5'
               || |||   ||||||| 
Target 5' tggggAGAAAT--AAACGGTTt 3'
93 - 112 149.00 -8.50
2
miRNA  3' uugagucauuaccauUGCCAaa 5'
                         ||| |  
Target 5' ccgggaacccgccgcACGCTgt 3'
41 - 62 68.00 -5.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-451a :: MIF    [ Functional MTI ]
Validation Method ELISA , Luciferase reporter assay , Microarray , qRT-PCR , Western blot , Other
Conditions DLD1 , AGS
Disease gastrointestinal cancer//gastric cancer//colorectal cancer;
Location of target site 3'UTR
Tools used in this research miRBase Target Database
Original Description (Extracted from the article) ... We found that ectopic expression of miR-451 inhibited the expression of the reporter vector containing MIF 3¶UTR but not the reporter vector containing the mutation of the seed–miR-451 binding site (Fig. 5D). These data suggest that MIF is one of the direct targets of miR-451 and that miR-451 can down-regulate MIF at least by decreasing mRNA stability.// ...

- Bandres, E. Bitarte, N. Arias, F. Agorreta, et al., 2009, Clin Cancer Res.

Article - Bandres, E. Bitarte, N. Arias, F. Agorreta, et al.
- Clin Cancer Res, 2009
PURPOSE: microRNAs (miRNA) are small RNAs that function as post-transcriptional regulators of gene expression. Recent evidence has shown that some miRNAs can act as oncogenes or tumor suppressors. This study was conducted to evaluate the potential association of miRNA expression with clinical outcome in patients with gastric cancer. EXPERIMENTAL DESIGN: Expression of 250 human mature miRNAs was measured by real-time PCR on paraffin-embedded tumor samples of 21 patients with gastric cancer stage III uniformly treated with surgical resection followed by chemoradiation. We identified the miRNAs correlated with disease-free and overall survival times, and the results were evaluated including 24 other patients. In vitro cell proliferation and radiosensitivity studies were done to support clinical data. RESULTS: The results revealed that down-regulation of miR-451 was associated with worse prognosis. miR-451 was detected by in situ hybridization in epithelial cells and showed decreased expression in gastric and colorectal cancer versus nontumoral tissues. Overexpression of miR-451 in gastric and colorectal cancer cells reduced cell proliferation and increased sensitivity to radiotherapy. Microarray and bioinformatic analysis identified the novel oncogene macrophage migration inhibitory factor (MIF) as a potential target of miR-451. In fact, overexpression of miR-451 down-regulated mRNA and protein levels of MIF and decreased expression of reporter genes with MIF target sequences. Moreover, we found a significant inverse correlation between miR-451 and MIF expression in tumoral gastric biopsies. CONCLUSIONS: These findings support the role of miR-451 as a regulator of cancer proliferation and open new perspectives for the development of effective therapies for chemoradioresistant cancers.
LinkOut: [PMID: 19318487]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
12 hsa-miR-451a Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000046 MIF macrophage migration inhibitory factor (glycosylation-inhibiting factor) 5 2
MIRT000500 CAB39 calcium binding protein 39 5 2
MIRT005656 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 4 1
MIRT005740 AKT1 v-akt murine thymoma viral oncogene homolog 1 2 1
MIRT005742 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 2 1
MIRT005743 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 2 1
MIRT005744 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT006358 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT006533 RAB14 RAB14, member RAS oncogene family 4 1
MIRT006597 TMED7 transmembrane emp24 protein transport domain containing 7 2 1
MIRT016628 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT016629 UBE2H ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) 1 1