Accession ID: MIRT000065 [miRNA, hsa-miR-34b-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34bLinkOut: [miRBase ]
Description Homo sapiens miR-34b stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells . Both arms express mature products in mouse.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34b-5p
Mature Sequence 13| UAGGCAGUGUCAUUAGCUGAUUG |35
Evidence Not_experimental
Experiments
Putative hsa-miR-34b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2, PPP1R50
Description B-cell CLL/lymphoma 2
Transcript NM_000633    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_000633|3'UTR
   1 AGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACC
  81 ATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACAC
 161 AACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATT
 241 AAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCAC
 321 CGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCATCT
 401 GAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGTGTT
 481 CATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCTCCC
 561 TGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAGATG
 641 GACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTTTTT
 721 AAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTATAT
 801 TCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTTGAG
 881 GAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCTTTT
 961 AGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACTGGC
1041 CTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCAAGA
1121 AAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGGAGC
1201 CACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATGGTG
1281 AAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCTTGG
1361 CCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAGGTG
1441 TCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAAAAC
1521 CTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGGTGG
1601 GGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGAATC
1681 AGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGTACT
1761 CTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGTTTT
1841 TAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTGATT
1921 CTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCACTGA
2001 GGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCCCTT
2081 TGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATGTTT
2161 GGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGACCT
2241 TTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTC
2321 ATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGC
2401 CAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATTTTA
2481 TGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAATGGA
2561 GTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTTTAA
2641 TATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAGGTC
2721 ACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCAGCC
2801 TCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTAAAA
2881 ACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATCTAA
2961 TTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTCTTT
3041 ATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACTTTC
3121 CAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCCCTC
3201 GCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATTTGG
3281 CAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAAACA
3361 AGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGTTTT
3441 ATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGGAGT
3521 TATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGAGTG
3601 AACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTCTAA
3681 TTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTACTCT
3761 ATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGATCT
3841 TATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGCTTA
3921 TGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACAAAG
4001 GACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGAAGT
4081 TTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGTGAC
4161 AAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCGTTT
4241 GGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAACAGG
4321 ATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTTTAT
4401 AAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTCCAT
4481 GTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATGAAT
4561 GGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCTGCA
4641 TACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTATTA
4721 ATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCAGAT
4801 AGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGCTTT
4881 CTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTATTTT
4961 TGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTACCTT
5041 CCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTAAGG
5121 ATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTGGAA
5201 AAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATACTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUAGUCGAUUACUGUGACGGau 5'
            |||||||| |  :||||||  
Target 5' gaATCAGCTATT--TACTGCCaa 3'
190 - 210 153.00 -20.60
2
miRNA  3' guuagUCGAUU----ACUG--UGACGGAu 5'
               :|||||    ||:|  :|||||| 
Target 5' acgggGGCTAATTGCTGGCTGGCTGCCTt 3'
2721 - 2749 142.00 -17.30
3
miRNA  3' guUAGUCGAUU--ACUGUGACGGau 5'
            | |:|:| |  ||: ||||||  
Target 5' gtACCGGTTCATCTGG-ACTGCCcc 3'
4567 - 4590 134.00 -12.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34b-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , , Western blot
Conditions KATO-III
Location of target site 3'UTR
Tools used in this research Literature survey
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
97 hsa-miR-34b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000065 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT000066 CREB1 cAMP responsive element binding protein 1 4 2
MIRT000747 MYB v-myb myeloblastosis viral oncogene homolog (avian) 2 1
MIRT000753 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT000758 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT000762 CDK6 cyclin-dependent kinase 6 3 2
MIRT000764 CDK4 cyclin-dependent kinase 4 2 1
MIRT000767 CCNE2 cyclin E2 2 1
MIRT002466 VEGFA vascular endothelial growth factor A 1 1
MIRT004401 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 5
MIRT004404 SRSF2 serine/arginine-rich splicing factor 2 2 1
MIRT006265 HNF4A hepatocyte nuclear factor 4, alpha 1 1
MIRT053287 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 4 2
MIRT054051 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 2 1
MIRT054055 AXIN2 axin 2 2 1
MIRT056014 ARL5B ADP-ribosylation factor-like 5B 1 1
MIRT061581 BTG2 BTG family, member 2 1 3
MIRT065787 HOXC8 homeobox C8 1 3
MIRT106657 MTDH metadherin 1 4
MIRT254768 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 3
MIRT314156 MARVELD2 MARVEL domain containing 2 1 1
MIRT317928 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 1
MIRT349235 EVI5L ecotropic viral integration site 5-like 1 1
MIRT395048 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 1 1
MIRT438401 CD274 CD274 molecule 2 1
MIRT447167 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT451113 RPS19 ribosomal protein S19 1 1
MIRT451593 HIRIP3 HIRA interacting protein 3 1 1
MIRT453172 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT456969 SPAM1 sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) 1 1
MIRT461143 ZNF264 zinc finger protein 264 1 1
MIRT461882 ZNF317 zinc finger protein 317 1 1
MIRT462755 EFNB1 ephrin-B1 1 1
MIRT465528 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT470485 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT474888 KCTD5 potassium channel tetramerisation domain containing 5 1 1
MIRT475348 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT477237 ETF1 eukaryotic translation termination factor 1 1 1
MIRT478653 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT480601 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT481573 ARIH2 ariadne homolog 2 (Drosophila) 1 1
MIRT486072 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT487467 ANKRD42 ankyrin repeat domain 42 1 1
MIRT488802 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT488968 KCNJ11 potassium inwardly-rectifying channel, subfamily J, member 11 1 4
MIRT494734 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT495458 PNMAL2 paraneoplastic Ma antigen family-like 2 1 1
MIRT495490 VTI1B vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 1 1
MIRT495725 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT495771 ZNF546 zinc finger protein 546 1 1
MIRT495803 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT495823 TMEM151A transmembrane protein 151A 1 1
MIRT496075 ATP1B4 ATPase, Na+/K+ transporting, beta 4 polypeptide 1 1
MIRT496099 SNX17 sorting nexin 17 1 1
MIRT496136 RBL1 retinoblastoma-like 1 (p107) 1 1
MIRT496178 TRIM73 tripartite motif containing 73 1 1
MIRT496232 TRIM74 tripartite motif containing 74 1 1
MIRT496261 SHROOM2 shroom family member 2 1 1
MIRT496276 SLC2A13 solute carrier family 2 (facilitated glucose transporter), member 13 1 1
MIRT496288 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT496496 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT496541 EBI3 Epstein-Barr virus induced 3 1 1
MIRT496607 TAGLN transgelin 1 1
MIRT498849 LITAF lipopolysaccharide-induced TNF factor 1 2
MIRT500556 XBP1P1 X-box binding protein 1 pseudogene 1 1 3
MIRT502344 GIGYF1 GRB10 interacting GYF protein 1 1 2
MIRT503037 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT505362 TMEM167A transmembrane protein 167A 1 1
MIRT507269 FERMT2 fermitin family member 2 1 1
MIRT508982 CXorf38 chromosome X open reading frame 38 1 1
MIRT510467 ZDHHC18 zinc finger, DHHC-type containing 18 1 1
MIRT512940 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 2
MIRT525297 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT530765 ZNF582 zinc finger protein 582 1 1
MIRT531961 TBC1D1 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 1 1
MIRT542617 XIAP X-linked inhibitor of apoptosis 1 1
MIRT547843 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT548041 GOLIM4 golgi integral membrane protein 4 1 1
MIRT550427 ORC4 origin recognition complex, subunit 4 1 1
MIRT551372 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT551590 HDGFRP2 hepatoma-derived growth factor-related protein 2 1 1
MIRT553092 UBXN2A UBX domain protein 2A 1 2
MIRT555846 PAPD7 PAP associated domain containing 7 1 2
MIRT557313 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 1
MIRT557429 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT559317 ATXN1 ataxin 1 1 1
MIRT565215 TROVE2 TROVE domain family, member 2 1 1
MIRT566263 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT574104 VASN vasorin 1 1
MIRT576571 Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 1 1
MIRT608810 ITGA11 integrin, alpha 11 1 2
MIRT613166 DDA1 DET1 and DDB1 associated 1 1 1
MIRT614598 IRF2BPL interferon regulatory factor 2 binding protein-like 1 1
MIRT636054 ZSCAN29 zinc finger and SCAN domain containing 29 1 2
MIRT654597 PURA purine-rich element binding protein A 1 1
MIRT671746 ZNF451 zinc finger protein 451 1 1
MIRT693799 RHOG ras homolog family member G 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*