Accession ID: MIRT000065 [miRNA, hsa-miR-34b-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34bLinkOut: [miRBase ]
Description Homo sapiens miR-34b stem-loop
Comment Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells . Both arms express mature products in mouse.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34b-5p
Mature Sequence 13| UAGGCAGUGUCAUUAGCUGAUUG |35
Evidence Not_experimental
Experiments
Putative hsa-miR-34b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34b-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , , Western blot
Conditions KATO-III
Location of target site 3'UTR
Tools used in this research Literature survey
Article - Ji, Q. Hao, X. Meng, Y. Zhang, M. Desano, et al.
- BMC Cancer, 2008
BACKGROUND: MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. METHODS: Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. RESULTS: Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. CONCLUSION: Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be correlated to the self-renewal of cancer stem cells. The mechanism of miR-34-mediated suppression of self-renewal appears to be related to the direct modulation of downstream targets Bcl-2, Notch, and HMGA2, indicating that miR-34 may be involved in gastric cancer stem cell self-renewal/differentiation decision-making. Our study suggests that restoration of the tumor suppressor miR-34 may provide a novel molecular therapy for p53-mutant gastric cancer.
LinkOut: [PMID: 18803879]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
12 hsa-miR-34b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000065 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT000066 CREB1 cAMP responsive element binding protein 1 4 2
MIRT000747 MYB v-myb myeloblastosis viral oncogene homolog (avian) 2 1
MIRT000753 CAV1 caveolin 1, caveolae protein, 22kDa 2 1
MIRT000758 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT000762 CDK6 cyclin-dependent kinase 6 2 1
MIRT000764 CDK4 cyclin-dependent kinase 4 2 1
MIRT000767 CCNE2 cyclin E2 2 1
MIRT002466 VEGFA vascular endothelial growth factor A 1 1
MIRT004401 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 2
MIRT004404 SRSF2 serine/arginine-rich splicing factor 2 2 1
MIRT006265 HNF4A hepatocyte nuclear factor 4, alpha 1 1