Accession ID: MIRT000100 [miRNA, hsa-miR-29b-3p :: COL1A1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29b-1LinkOut: [miRBase ]
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Mature Sequence 51| UAGCACCAUUUGAAAUCAGUGUU |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol COL1A1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms OI4
Description collagen, type I, alpha 1
Transcript NM_0000    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on COL1A1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of COL1A1
(miRNA target sites are highlighted)
>COL1A1|NM_0000|3'UTR
   1 TAAACTCCCTCCATCCCAACCTGGCTCCCTCCCACCCAACCAACTTTCCCCCCAACCCGGAAACAGACAAGCAACCCAAA
  81 CTGAACCCCCTCAAAAGCCAAAAAATGGGAGACAATTTCACATGGACTTTGGAAAATATTTTTTTCCTTTGCATTCATCT
 161 CTCAAACTTAGTTTTTATCTTTGACCAACCGAACATGACCAAAAACCAAAAGTGCATTCAACCTTACCAAAAAAAAAAAA
 241 AAAAAAAGAATAAATAAATAACTTTTTAAAAAAGGAAGCTTGGTCCACTTGCTTGAAGACCCATGCGGGGGTAAGTCCCT
 321 TTCTGCCCGTTGGGCTTATGAAACCCCAATGCTGCCCTTTCTGCTCCTTTCTCCACACCCCCCTTGGGGCCTCCCCTCCA
 401 CTCCTTCCCAAATCTGTCTCCCCAGAAGACACAGGAAACAATGTATTGTCTGCCCAGCAATCAAAGGCAATGCTCAAACA
 481 CCCAAGTGGCCCCCACCCTCAGCCCGCTCCTGCCCGCCCAGCACCCCCAGGCCCTGGGGGACCTGGGGTTCTCAGACTGC
 561 CAAAGAAGCCTTGCCATCTGGCGCTCCCATGGCTCTTGCAACATCTCCCCTTCGTTTTTGAGGGGGTCATGCCGGGGGAG
 641 CCACCAGCCCCTCACTGGGTTCGGAGGAGAGTCAGGAAGGGCCACGACAAAGCAGAAACATCGGATTTGGGGAACGCGTG
 721 TCAATCCCTTGTGCCGCAGGGCTGGGCGGGAGAGACTGTTCTGTTCCTTGTGTAACTGTGTTGCTGAAAGACTACCTCGT
 801 TCTTGTCTTGATGTGTCACCGGGGCAACTGCCTGGGGGCGGGGATGGGGGCAGGGTGGAAGCGGCTCCCCATTTTATACC
 881 AAAGGTGCTACATCTATGTGATGGGTGGGGTGGGGAGGGAATCACTGGTGCTATAGAAATTGAGATGCCCCCCCAGGCCA
 961 GCAAATGTTCCTTTTTGTTCAAAGTCTATTTTTATTCCTTGATATTTTTCTTTTTTTTTTTTTTTTTTTGTGGATGGGGA
1041 CTTGTGAATTTTTCTAAAGGTGCTATTTAACATGGGAGGAGAGCGTGTGCGGCTCCAGCCCAGCCCGCTGCTCACTTTCC
1121 ACCCTCTCTCCACCTGCCTCTGGCTTCTCAGGCCTCTGCTCTCCGACCTCTCTCCTCTGAAACCCTCCTCCACAGCTGCA
1201 GCCCATCCTCCCGGCTCCCTCCTAGTCTGTCCTGCGTCCTCTGTCCCCGGGTTTCAGAGACAACTTCCCAAAGCACAAAG
1281 CAGTTTTTCCCCCTAGGGGTGGGAGGAAGCAAAAGACTCTGTACCTATTTTGTATGTGTATAATAATTTGAGATGTTTTT
1361 AATTATTTTGATTGCTGGAATAAAGCATGTGGAAATGACCCAAACATAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugugacuaaAGUUUACCACGAu 5'
                    || | ||||||| 
Target 5' ggggagggaaTC-ACTGGTGCTa 3'
912 - 933 144.00 -12.20
2
miRNA  3' uugugACU---AAAGUUUACCACGAu 5'
               |||   |||| || |||||| 
Target 5' acttgTGAATTTTTCTAAAGGTGCTa 3'
1040 - 1065 138.00 -11.70
3
miRNA  3' uugugacUAAAGU----UUACCACGAu 5'
                 ||||:|    || |||||| 
Target 5' gctccccATTTTATACCAAAGGTGCTa 3'
864 - 890 130.00 -12.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: COL1A1    [ Functional MTI ]
Validation Method Other
Article - Li, Z. Hassan, M. Q. Jafferji, M. Aqeilan, et al.
- J Biol Chem, 2009
Bone tissue arises from mesenchymal cells induced into the osteoblast lineage by essential transcription factors and signaling cascades. MicroRNAs regulate biological processes by binding to mRNA 3'-untranslated region (UTR) sequences to attenuate protein synthesis. Here we performed microRNA profiling and identified miRs that are up-regulated through stages of osteoblast differentiation. Among these are the miR-29, miR-let-7, and miR-26 families that target many collagens and extracellular matrix proteins. We find that miR-29b supports osteoblast differentiation through several mechanisms. miR-29b decreased and anti-miR-29b increased activity of COL1A1, COL5A3, and COL4A2 3'-UTR sequences in reporter assays, as well as endogenous gene expression. These results support a mechanism for regulating collagen protein accumulation during the mineralization stage when miR-29b reaches peak levels. We propose that this mechanism prevents fibrosis and facilitates mineral deposition. Our studies further demonstrate that miR-29b promotes osteogenesis by directly down-regulating known inhibitors of osteoblast differentiation, HDAC4, TGFbeta3, ACVR2A, CTNNBIP1, and DUSP2 proteins through binding to target 3'-UTR sequences in their mRNAs. Thus, miR-29b is a key regulator of development of the osteoblast phenotype by targeting anti-osteogenic factors and modulating bone extracellular matrix proteins.
LinkOut: [PMID: 19342382]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: COL1A1    [ Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay , qRT-PCR ,
Conditions LX-2
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... As a result, the miR- 29b and -218 precursors inhibited luciferase activity derived from the vectors carrying Col1A1 or SP1 30UTRs (Fig. 3D). In contrast, the miR-143 precursors had no effect on luciferase activity of the vec- tor carrying Col1A1 30UTR (Fig. 3D). ...

- Ogawa, T. Iizuka, M. Sekiya, Y. Yoshizato, et al., 2010, Biochem Biophys Res Commun.

Article - Ogawa, T. Iizuka, M. Sekiya, Y. Yoshizato, et al.
- Biochem Biophys Res Commun, 2010
MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression through imperfect base pairing with the 3' untranslated region (3'UTR) of target mRNA. We studied the regulation of alpha 1 (I) collagen (Col1A1) expression by miRNAs in human stellate cells, which are involved in liver fibrogenesis. Among miR-29b, -143, and -218, whose expressions were altered in response to transforming growth factor-beta1 or interferon-alpha stimulation, miR-29b was the most effective suppressor of type I collagen at the mRNA and protein level via its direct binding to Col1A1 3'UTR. miR-29b also had an effect on SP1 expression. These results suggested that miR-29b is involved in the regulation of type I collagen expression by interferon-alpha in hepatic stellate cells. It is anticipated that miR-29b will be used for the regulation of stellate cell activation and lead to antifibrotic therapy.
LinkOut: [PMID: 19913496]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: COL1A1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions PC3 , DU145
Disease prostate cancer
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Collagens are directly targeted by miR-29b ...

- Steele, R. Mott, J. L. Ray, R. B., 2010, Genes Cancer.

Article - Steele, R. Mott, J. L. Ray, R. B.
- Genes Cancer, 2010
c-myc promoter binding protein (MBP-1) is a multi-functional protein known to regulate expression of targets involved in the malignant phenotype. We have previously demonstrated that exogenous expression of MBP-1 inhibits prostate tumor growth, although the mechanism of growth inhibition is not well understood. We hypothesized that MBP-1 may modulate microRNA (miRNA) expression for regulation of prostate cancer cell growth. In this study, we demonstrated that exogenous MBP-1 upregulates miR-29b by 5-9 fold in prostate cancer cells as measured by real-time quantitative reverse transcription-PCR. Subsequent studies indicated that exogenous expression of miR-29b inhibited Mcl-1, COL1A1, and COL4A1. Further, a novel target with potential implications for invasion and metastasis, matrix metallopeptidase-2 (MMP-2), was identified and confirmed to be a miR-29b target in prostate cancer cells. Together our results demonstrated that exogenous expression of miR-29b regulates prostate cancer cell growth by modulating anti-apoptotic and pro-metastatic matrix molecules, implicating therapeutic potential of miR-29b for prostate cancer inhibition.
LinkOut: [PMID: 20657750]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: COL1A1    [ Functional MTI ]
Validation Method Reporter assay
Article - Castoldi, G. Di Gioia, C. R. Bombardi, C. et al.
- J Cell Physiol, 2012
MicroRNAs play an important role in myocardial diseases. MiR-133a regulates cardiac hypertrophy, while miR-29b is involved in cardiac fibrosis. The aim of this study was to evaluate whether miR-133a and miR-29b play a role in myocardial fibrosis caused by Angiotensin II (Ang II)-dependent hypertension. Sprague-Dawley rats were treated for 4 weeks with Ang II (200 ng/kg/min) or Ang II + irbesartan (50 mg/kg/day in drinking water), or saline by osmotic minipumps. At the end of the experimental period, cardiac miR-133a and miR-29b expression was measured by real-time PCR, and myocardial fibrosis was evaluated by morphometric analysis. A computer-based prediction algorithm led to the identification of collagen 1a1 (Col1A1) as a putative target of miR-133a. A reporter plasmid bearing the 3'-untranslated regions (UTRs) of Col1A1 mRNA was constructed and luciferase assay was performed. MiR-133a suppressed the activity of luciferase when the reporter gene was linked to a 3'-UTR segment of Col1A1 (P < 0.01). Mutation of miR-133a binding sites in the 3'-UTR of Col1A1 mRNA abolished miR-133a-mediated repression of reporter gene activity, showing that Col1A1 is a real target of miR-133a. In vivo, Ang II caused an increase in systolic blood pressure (P < 0.0001, tail cuff) and myocardial fibrosis in presence of a decrease in miR-133a (P < 0.01) and miR-29b (P < 0.01), and an increase in Col1A1 expression (P < 0.01). These effects were abolished by Ang II administration + irbesartan. These data demonstrate a relationship between miR-133a and Col1A1, suggesting that myocardial fibrosis occurring in Ang II-dependent hypertension is regulated by the down-regulation of miR-133a and miR-29b through the modulation of Col1A1 expression.
LinkOut: [PMID: 21769867]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: COL1A1    [ Functional MTI ]
Validation Method Microarray , qRT-PCR , Western blot
Conditions CAKI-2 , 786-O , ACHN , caki-2
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... we found that the p85 regulatory subunit of PI3K harbors a binding site for miR-29b at positions 331 to 337 of its 3'UTR. ...

- Li, N. Cui, J. Duan, X. Chen, H. Fan, F., 2012, Invest Ophthalmol Vis Sci.

Article - Li, N. Cui, J. Duan, X. Chen, H. Fan, F.
- Invest Ophthalmol Vis Sci, 2012
Purpose.To evaluate the expression profile of microRNAs (miRNAs) and their roles in human tenon's fibroblasts (HTFs), and to establish a miRNA-based gene silencing method for antifibrosis in vitro.Methods.The miRNA expression profile was analyzed by microarray using quiescent and TGFbeta1-stimulated primary HTFs, respectively. Candidate miRNAs were identified by quantitative RT-PCR. miRNAs potentially targeting fibrosis-related genes were predicted using a published algorithm (TargetScan; Envisioneering Medical Technologies, St. Louis, MO). Predicted fibrosis-related genes regulated by candidate miRNAs were confirmed by transfection of the miRNA into HTF culture (with or without TGFbeta1 treatment), followed by quantitative RT-PCR and Western Blot.Results.Total of 38 miRNAs were identified to be upregulated, and 31 down-regulated, in TGFbeta1-stimulated HTFs. Among those, the miR-29b, down-regulated in TGFbeta1-treated HTFs, targeted a cadre of mRNAs that encode proteins involved in fibrosis, including PI3Kp85a, Sp1, and collagen type I alpha1 (Col1A1). Treatment of HTFs with TGFbeta1 activated the PI3K-Akt-Sp1 pathway and, consequently, induced7 an increase in the expression of type I collagen. Down-regulation of miR-29b by introducing an antisense miRNA into cultured HTFs partly induced the expression of PI3Kp85a, Akt, Sp1 and Col1A1, whereas overexpression of miR-29b inhibited the PI3K-Akt-Sp1 pathway and attenuated the expression of Col1A1.Conclusions.miR-29b acted as a suppressor of type I collagen gene by repressing the PI3K/Akt/Sp1 pathway in HTFs. Overexpression of miR-29b protected subconjunctival tissues against collagen production and fibrosis. These findings provided a novel rationale for the development of miRNA-based strategies for attenuating scar formation after glaucoma filtering surgery.
LinkOut: [PMID: 22297492]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: COL1A1    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions hMSCs
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... Transfecting cells with the LMWP/miR-29b complex showed that ectopic miR-29b in human MSCs signi´Čücantly repressed the luciferase activity of reporter plasmids carrying the COL1A1 and COL5A3, a minor component of bone tissue, 3' -UTRs. ...

- Suh, J. S. Lee, J. Y. Choi, Y. S. Chong, P. et al., 2013, Biomaterials.

Article - Suh, J. S. Lee, J. Y. Choi, Y. S. Chong, P. et al.
- Biomaterials, 2013
Stem cell differentiation is modulated by several key molecules, including cytokines, hormones, and engineered peptides. Emerging evidence suggests that microRNA has potential applications in stem cell engineering, such as in osteoblastic differentiation. MicroRNAs (miRNAs) bind to the 3'-untranslated region (UTR) sequence of target mRNA, thereby attenuating protein synthesis. Our goal was to evaluate the delivery of miRNA, i.e., miRNA-29b, to stem cells to promote osteoblastic differentiation because this miRNA is known to target anti-osteogenic factors gene expression. Despite the important role of miRNAs, their application has been limited due to poor cell/tissue penetration. The authors attempted to overcome this limitation by using a cell-penetrating peptide (CPP) carrier. Herein, the arginine-rich CPP, called the lowmolecular weight protamine (LMWP), is the sequence from natural protamine. We worked out the difficult problem to transfect into hMSCs by the complex with LMWP, and then we investigated synthetic double-stranded miR-29b could be induced osteoblast differentiation.
LinkOut: [PMID: 23478036]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
79 hsa-miR-29b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000096 HDAC4 histone deacetylase 4 2 2
MIRT000097 CTNNBIP1 catenin, beta interacting protein 1 2 2
MIRT000098 COL5A3 collagen, type V, alpha 3 2 2
MIRT000099 COL4A2 collagen, type IV, alpha 2 1 1
MIRT000100 COL1A1 collagen, type I, alpha 1 5 6
MIRT000101 ACVR2A activin A receptor, type IIA 1 1
MIRT000445 SP1 Sp1 transcription factor 5 5
MIRT000684 CDK6 cyclin-dependent kinase 6 4 2
MIRT000930 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT002310 SFPQ splicing factor proline/glutamine-rich 3 1
MIRT002316 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 3 1
MIRT003026 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 4
MIRT003029 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 5
MIRT003287 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 5 7
MIRT003290 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT003661 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 2 1
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet oncogene 1 4 1
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 (membrane-inserted) 3 1
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen, type III, alpha 1 4 2
MIRT005568 COL4A1 collagen, type IV, alpha 1 4 1
MIRT005570 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 4 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 4 2
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor, beta 2 2 1
MIRT006059 TGFB1 transforming growth factor, beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 4 1
MIRT006251 NASP nuclear autoantigenic sperm protein (histone-binding) 2 1
MIRT006486 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 1
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras-like 2 3 1
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon, gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 1 1
MIRT007254 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT027237 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT027238 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 2
MIRT027239 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT048359 SCAF8 RNA binding motif protein 16 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 low density lipoprotein receptor-related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT048365 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT048372 TPD52L2 tumor protein D52-like 2 1 1
MIRT048373 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT048374 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT048375 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT048377 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP chromosome 1 open reading frame 96 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP chromosome 5 open reading frame 13 1 1
MIRT048383 MKI67 antigen identified by monoclonal antibody Ki-67 1 1