Accession ID: MIRT000137 [miRNA, hsa-miR-221-3p :: CDKN1B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-221LinkOut: [miRBase ]
Synonyms MIRN221, miRNA221, mir-221, MIR221
Description Homo sapiens miR-221 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-221-3p
Mature Sequence 65| AGCUACAUUGUCUGCUGGGUUUC |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-221-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDKN4, KIP1, MEN1B, MEN4, P27KIP1
Description cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Transcript NM_0040    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1B
(miRNA target sites are highlighted)
>CDKN1B|NM_0040|3'UTR
   1 TAAACAGCTCGAATTAAGAATATGTTTCCTTGTTTATCAGATACATCACTGCTTGATGAAGCAAGGAAGATATACATGAA
  81 AATTTTAAAAATACATATCGCTGACTTCATGGAATGGACATCCTGTATAAGCACTGAAAAACAACAACACAATAACACTA
 161 AAATTTTAGGCACTCTTAAATGATCTGCCTCTAAAAGCGTTGGATGTAGCATTATGCAATTAGGTTTTTCCTTATTTGCT
 241 TCATTGTACTACCTGTGTATATAGTTTTTACCTTTTATGTAGCACATAAACTTTGGGGAAGGGAGGGCAGGGTGGGGCTG
 321 AGGAACTGACGTGGAGCGGGGTATGAAGAGCTTGCTTTGATTTACAGCAAGTAGATAAATATTTGACTTGCATGAAGAGA
 401 AGCAATTTTGGGGAAGGGTTTGAATTGTTTTCTTTAAAGATGTAATGTCCCTTTCAGAGACAGCTGATACTTCATTTAAA
 481 AAAATCACAAAAATTTGAACACTGGCTAAAGATAATTGCTATTTATTTTTACAAGAAGTTTATTCTCATTTGGGAGATCT
 561 GGTGATCTCCCAAGCTATCTAAAGTTTGTTAGATAGCTGCATGTGGCTTTTTTAAAAAAGCAACAGAAACCTATCCTCAC
 641 TGCCCTCCCCAGTCTCTCTTAAAGTTGGAATTTACCAGTTAATTACTCAGCAGAATGGTGATCACTCCAGGTAGTTTGGG
 721 GCAAAAATCCGAGGTGCTTGGGAGTTTTGAATGTTAAGAATTGACCATCTGCTTTTATTAAATTTGTTGACAAAATTTTC
 801 TCATTTTCTTTTCACTTCGGGCTGTGTAAACACAGTCAAAATAATTCTAAATCCCTCGATATTTTTAAAGATCTGTAAGT
 881 AACTTCACATTAAAAAATGAAATATTTTTTAATTTAAAGCTTACTCTGTCCATTTATCCACAGGAAAGTGTTATTTTTCA
 961 AGGAAGGTTCATGTAGAGAAAAGCACACTTGTAGGATAAGTGAAATGGATACTACATCTTTAAACAGTATTTCATTGCCT
1041 GTGTATGGAAAAACCATTTGAAGTGTACCTGTGTACATAACTCTGTAAAAACACTGAAAAATTATACTAACTTATTTATG
1121 TTAAAAGATTTTTTTTAATCTAGACAATATACAAGCCAAAGTGGCATGTTTTGTGCATTTGTAAATGCTGTGTTGGGTAG
1201 AATAGGTTTTCCCCTCTTTTGTTAAATAATATGGCTATGCTTAAAAGGTTGCATACTGAGCCAAGTATAATTTTTTGTAA
1281 TGTGTGAAAAAGATGCCAATTATTGTTACACATTAAGTAATCAATAAAGAAAACTTCCATAGCTATT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cuuugggUCGUCUGUUACAUCGa 5'
                 |||:   :||||||| 
Target 5' ctctaaaAGCGTTGGATGTAGCa 3'
189 - 211 148.00 -11.50
2
miRNA  3' cuuugggucgucuguUACAUCGa 5'
                         ||||||| 
Target 5' tagtttttaccttttATGTAGCa 3'
262 - 284 140.00 -8.30
3
miRNA  3' cuUUGGGUCGUCUGU-----UACAUCGa 5'
            |::::: :|||:|     ||||:|| 
Target 5' aaAGTTTGTTAGATAGCTGCATGTGGCt 3'
581 - 608 137.00 -14.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , ,
Conditions LNCaP , PC3 , 22Rv1
Location of target site 3'UTR
Tools used in this research miRNAMap
Original Description (Extracted from the article) ... p27Kip1 Is a Target of miR-221/222//Fig. 3 shows that the presence of miR-221, miR-222, or miR-221 and miR-222 in tandem strongly affected luciferase expression ( 50%), measured as relative luciferase activity ...

- Galardi, S. Mercatelli, N. Giorda, E. et al., 2007, J Biol Chem.

Article - Galardi, S. Mercatelli, N. Giorda, E. et al.
- J Biol Chem, 2007
MicroRNAs are short regulatory RNAs that negatively modulate protein expression at a post-transcriptional level and are deeply involved in the pathogenesis of several types of cancers. Here we show that miR-221 and miR-222, encoded in tandem on chromosome X, are overexpressed in the PC3 cellular model of aggressive prostate carcinoma, as compared with LNCaP and 22Rv1 cell line models of slowly growing carcinomas. In all cell lines tested, we show an inverse relationship between the expression of miR-221 and miR-222 and the cell cycle inhibitor p27(Kip1). We recognize two target sites for the microRNAs in the 3' untranslated region of p27 mRNA, and we show that miR-221/222 ectopic overexpression directly results in p27 down-regulation in LNCaP cells. In those cells, we demonstrate that the ectopic overexpression of miR-221/222 strongly affects their growth potential by inducing a G(1) to S shift in the cell cycle and is sufficient to induce a powerful enhancement of their colony-forming potential in soft agar. Consistently, miR-221 and miR-222 knock-down through antisense LNA oligonucleotides increases p27(Kip1) in PC3 cells and strongly reduces their clonogenicity in vitro. Our results suggest that miR-221/222 can be regarded as a new family of oncogenes, directly targeting the tumor suppressor p27(Kip1), and that their overexpression might be one of the factors contributing to the oncogenesis and progression of prostate carcinoma through p27(Kip1) down-regulation.
LinkOut: [PMID: 17569667]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Conditions glioblastoma cell , HeLa , MCF-7 , MDA-MB-231 , U87
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... we identified miR-221 as a suppressor of endogenous p27Kip1 expression.//this result indicates that both predicted sites are required for miR-221&222 effects.//we have identified and verified miR-221&222 as potent suppressors of p27Kip1 expression. ...

- le Sage, C. Nagel, R. Egan, D. A. Schrier, et al., 2007, EMBO J.

Article - le Sage, C. Nagel, R. Egan, D. A. Schrier, et al.
- EMBO J, 2007
MicroRNAs (miRNAs) are potent post-transcriptional regulators of protein coding genes. Patterns of misexpression of miRNAs in cancer suggest key functions of miRNAs in tumorigenesis. However, current bioinformatics tools do not entirely support the identification and characterization of the mode of action of such miRNAs. Here, we used a novel functional genetic approach and identified miR-221 and miR-222 (miR-221&222) as potent regulators of p27(Kip1), a cell cycle inhibitor and tumor suppressor. Using miRNA inhibitors, we demonstrate that certain cancer cell lines require high activity of miR-221&222 to maintain low p27(Kip1) levels and continuous proliferation. Interestingly, high levels of miR-221&222 appear in glioblastomas and correlate with low levels of p27(Kip1) protein. Thus, deregulated expression of miR-221&222 promotes cancerous growth by inhibiting the expression of p27(Kip1).
LinkOut: [PMID: 17627278]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other , Reporter assay
Conditions U87MG , A172
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... These data show that p27Kip1 is a direct target for microRNAs 221 and 222, and suggest a role for these microRNAs in promoting the aggressive growth of human glioblastoma. ...

- Gillies, J. K. Lorimer, I. A., 2007, Cell Cycle.

Article - Gillies, J. K. Lorimer, I. A.
- Cell Cycle, 2007
Levels of p27(Kip1), a key negative regulator of the cell cycle, are often decreased in cancer. In most cancers, levels of p27(Kip1) mRNA are unchanged and increased proteolysis of the p27(Kip1) protein is thought to be the primary mechanism for its downregulation. Here we show that p27(Kip1) protein levels are also downregulated by microRNAs in cancer cells. We used RNA interference to reduce Dicer levels in human glioblastoma cell lines and found that this caused an increase in p27(Kip1) levels and a decrease in cell proliferation. When the coding sequence for the 3'UTR of the p27(Kip1) mRNA was inserted downstream of a luciferase reporter gene, Dicer depletion also enhanced expression of the reporter gene product. The microRNA target site software TargetScan predicts that the 3'UTR of p27(Kip1) mRNA contains multiple sites for microRNAs. These include two sites for microRNA 221 and 222, which have been shown to be upregulated in glioblastoma relative to adjacent normal brain tissue. The genes for microRNA 221 and microRNA 222 occupy adjacent sites on the X chromosome; their expression appears to be coregulated and they also appear to have the same target specificity. Antagonism of either microRNA 221 or 222 in glioblastoma cells also caused an increase in p27(Kip1) levels and enhanced expression of the luciferase reporter gene fused to the p27(Kip1) 3'UTR. These data show that p27(Kip1) is a direct target for microRNAs 221 and 222, and suggest a role for these microRNAs in promoting the aggressive growth of human glioblastoma.
LinkOut: [PMID: 17721077]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions HeLa
Location of target site 3'UTR
Tools used in this research mirGen , miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... These results indicate that both the miRs interfere with CDKN1B translation via direct interaction with the 3`-UTR ...

- Visone, R. Russo, L. Pallante, P. De et al., 2007, Endocr Relat Cancer.

Article - Visone, R. Russo, L. Pallante, P. De et al.
- Endocr Relat Cancer, 2007
We have recently reported that MicroRNAs (miR)-221 and miR-222 were up-regulated in human thyroid papillary carcinomas in comparison with the normal thyroid tissue. Bioinformatic analysis proposed the p27(Kip1) protein, a key regulator of cell cycle, as a candidate target for the miR-221/222 cluster. Here, we report that the enforced expression of miR-221 and miR-222 was able to reduce p27(Kip1) protein levels in thyroid carcinoma and HeLa cells in the absence of significant changes in specific p27(Kip1) mRNA levels. This effect is direct as miR-221 and miR-222 negatively regulate the expression of the 3'-untranslated region-based reporter construct from the p27(Kip1) gene, and is dependent on two target sites in this region. Consistent with these results, an enforced expression of the miR-221 and miR-222 induced the thyroid papillary carcinoma cell line (TPC-1) to progress to the S phase of the cell cycle. It is likely that the negative regulation of p27(Kip1) by miR-221 and miR-222 might also have a role in vivo since we report an inverse correlation between miR-221 and miR-222 up-regulation and down-regulation of the p27(Kip1) protein levels in human thyroid papillary carcinomas. Therefore, the data reported here demonstrate that miR-221 and miR-222 are endogenous regulators of p27(Kip1) protein expression, and thereby, the cell cycle.
LinkOut: [PMID: 17914108]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot ,
Conditions MCF7 , HEK293
Location of target site 3'UTR
Original Description (Extracted from the article) ... Both p27 and LATS2 harbor at their 3'UTR two nearby evolutionary conserved target sequences for miRNA-221 or -372, respectively, that are required and sufficient for miRNA function ...

- Kedde, M. Strasser, M. J. Boldajipour, B. et al., 2007, Cell.

Article - Kedde, M. Strasser, M. J. Boldajipour, B. et al.
- Cell, 2007
MicroRNAs (miRNAs) are inhibitors of gene expression capable of controlling processes in normal development and cancer. In mammals, miRNAs use a seed sequence of 6-8 nucleotides (nt) to associate with 3' untranslated regions (3'UTRs) of mRNAs and inhibit their expression. Intriguingly, occasionally not only the miRNA-targeting site but also sequences in its vicinity are highly conserved throughout evolution. We therefore hypothesized that conserved regions in mRNAs may serve as docking platforms for modulators of miRNA activity. Here we demonstrate that the expression of dead end 1 (Dnd1), an evolutionary conserved RNA-binding protein (RBP), counteracts the function of several miRNAs in human cells and in primordial germ cells of zebrafish by binding mRNAs and prohibiting miRNAs from associating with their target sites. These effects of Dnd1 are mediated through uridine-rich regions present in the miRNA-targeted mRNAs. Thus, our data unravel a novel role of Dnd1 in protecting certain mRNAs from miRNA-mediated repression.
LinkOut: [PMID: 18155131]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Garofalo, M. Quintavalle, C. Di Leva, G. et al.
- Oncogene, 2008
To define novel pathways that regulate susceptibility to tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in non-small cell lung cancer (NSCLC), we have performed genome-wide expression profiling of microRNAs (miRs). We show that in TRAIL-resistant NSCLC cells, levels of different miRs are increased, and in particular, miR-221 and -222. We demonstrate that these miRs impair TRAIL-dependent apoptosis by inhibiting the expression of key functional proteins. Indeed, transfection with anti-miR-221 and -222 rendered CALU-1-resistant cells sensitive to TRAIL. Conversely, H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of Kit and p27(kip1) mRNAs, but interfere with TRAIL signaling mainly through p27(kip1). In conclusion, we show that high expression levels of miR-221 and -222 are needed to maintain the TRAIL-resistant phenotype, thus making these miRs as promising therapeutic targets or diagnostic tool for TRAIL resistance in NSCLC.
LinkOut: [PMID: 18246122]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , ,
Conditions T98G , K562
Location of target site 3'UTR
Tools used in this research TargetCombo , TargetScan , PicTar
Original Description (Extracted from the article) ... Our results show that miR-221 and miR-222 both directly target the 3 untranslated regions of p27 and p57 mRNAs to reduce reporter gene expression, as well as diminish p27 and p57 protein levels. //miR-221 or miR-222 oligonucleotides significantly reduced p57 3`UTR-luciferase and p27 3`UTR-luciferase reporter activities by 60% and 77%, respectively (Fig. 3B) ...

- Medina, R. Zaidi, S. K. Liu, C. G. Stein, et al., 2008, Cancer Res.

Article - Medina, R. Zaidi, S. K. Liu, C. G. Stein, et al.
- Cancer Res, 2008
MicroRNAs (miRNA) have tumor suppressive and oncogenic potential in human cancer, but whether and how miRNAs control cell cycle progression is not understood. To address this question, we carried out a comprehensive analysis of miRNA expression during serum stimulation of quiescent human cells. Time course analyses revealed that four miRNAs are up-regulated and >100 miRNAs are down-regulated, as cells progress beyond the G(1)-S phase transition. We analyzed the function of two up-regulated miRNAs (miR-221 and miR-222) that are both predicted to target the cell growth suppressive cyclin-dependent kinase inhibitors p27 and p57. Our results show that miR-221 and miR-222 both directly target the 3' untranslated regions of p27 and p57 mRNAs to reduce reporter gene expression, as well as diminish p27 and p57 protein levels. Functional studies show that miR-221 and miR-222 prevent quiescence when elevated during growth factor deprivation and induce precocious S-phase entry, thereby triggering cell death. Thus, the physiologic up-regulation of miR-221 and miR-222 is tightly linked to a cell cycle checkpoint that ensures cell survival by coordinating competency for initiation of S phase with growth factor signaling pathways that stimulate cell proliferation.
LinkOut: [PMID: 18413744]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions Human melanoma cell lines
Disease melanoma;
Location of target site 3'UTR
Tools used in this research PicTar , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Moreover, we provide evidences of miR-221 and miR-222 capabilities to regulate two distinct but functionally convergent pathways of melanocyte transformation through the cyclin-dependent kinase inhibitor 1B (p27Kip1/CDKN1B) on one side and c-KIT and its downstream genes on the other.//To investigate the direct interaction between the miRs and p27 mRNA and the relative functionalities of the putative binding sites, we separately cloned the four ‘‘seeds’’ downstream to the luciferase open reading frame. Interestingly, only the presence of wild-type ‘‘seed-1’’ caused a 70% inhibition of the luciferase activity, whereas visible but not significant effects were observed for the other three sites (Fig. 6C; data not shown). ...

- Felicetti, F. Errico, M. C. Bottero, L. et al., 2008, Cancer Res.

Article - Felicetti, F. Errico, M. C. Bottero, L. et al.
- Cancer Res, 2008
The incidence of cutaneous melanoma is steadily increasing. Although several molecular abnormalities have been associated with melanoma progression, the mechanisms underlying the differential gene expression are still largely unknown and targeted therapies are not yet available. Noncoding small RNAs, termed microRNAs (miR), have been recently reported to play important roles in major cellular processes, including those involved in cancer development and progression. We have identified the promyelocytic leukemia zinc finger (PLZF) transcription factor as a repressor of miR-221 and miR-222 by direct binding to their putative regulatory region. Specifically, PLZF silencing in melanomas unblocks miR-221 and miR-222, which in turn controls the progression of the neoplasia through down-modulation of p27Kip1/CDKN1B and c-KIT receptor, leading to enhanced proliferation and differentiation blockade of the melanoma cells, respectively. In vitro and in vivo functional studies, including the use of antisense "antagomir" oligonucleotides, confirmed the key role of miR-221/-222 in regulating the progression of human melanoma; this suggests that targeted therapies suppressing miR-221/-222 may prove beneficial in advanced melanoma.
LinkOut: [PMID: 18417445]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Fornari, F. Gramantieri, L. Ferracin, M. et al.
- Oncogene, 2008
The identification of target mRNAs is a key step for assessing the role of aberrantly expressed microRNAs in human cancer. MiR-221 is upregulated in human hepatocellular carcinoma (HCC) as well as in other malignancies. One proven target of miR-221 is CDKN1B/p27, whose downregulation affects HCC prognosis. Here, we proved that the cyclin-dependent kinase inhibitor (CDKI) CDKN1C/p57 is also a direct target of miR-221. Indeed, downregulation of both CDKN1B/p27 and CDKN1C/p57 occurs in response to miR-221 transfection into HCC-derived cells and a significant upregulation of both CDKN1B/p27 and CDKN1C/p57 occurs in response to antimiR-221 transfection. A direct interaction of miR-221 with a target site on the 3' UTR of CDKN1C/p57 mRNA was also demonstrated. By controlling these two CDKIs, upregulation of miR-221 can promote growth of HCC cells by increasing the number of cells in S-phase. To assess the relevance of these studies in primary tumors, matched HCC and cirrhosis samples were assayed for miR-221, for CDKN1B/p27 and CDKN1C/p57 expression. MiR-221 was upregulated in 71% of HCCs, whereas CDKN1B/p27 and CDKN1C/p57 proteins were downregulated in 77% of cases. A significant inverse correlation between miR-221 and both CDKN1B/p27 and CDKN1C/p57 was found in HCCs. In conclusion, we suggest that miR-221 has an oncogenic function in hepatocarcinogenesis by targeting CDKN1B/p27 and CDKN1C/p57, hence promoting proliferation by controlling cell-cycle inhibitors. These findings establish a basis toward the development of therapeutic strategies aimed at blocking miR-221 in HCC.
LinkOut: [PMID: 18521080]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions MCF-7
Location of target site 3'UTR
Original Description (Extracted from the article) ... p27Kip1, a target of miR-221/222, imparts tamoxifen sensitivity to MCF-7 cells.//The protein level of the cell cycle inhibitor p27Kip1, a known target of miR-221/222, was reduced by 50% in OHTR cells and by 28–50% in miR-221/222-overexpressing MCF-7 cells. ...

- Miller, T. E. Ghoshal, K. Ramaswamy, B. et al., 2008, J Biol Chem.

Article - Miller, T. E. Ghoshal, K. Ramaswamy, B. et al.
- J Biol Chem, 2008
We explored the role of microRNAs (miRNAs) in acquiring resistance to tamoxifen, a drug successfully used to treat women with estrogen receptor-positive breast cancer. miRNA microarray analysis of MCF-7 cell lines that are either sensitive (parental) or resistant (4-hydroxytamoxifen-resistant (OHT(R))) to tamoxifen showed significant (>1.8-fold) up-regulation of eight miRNAs and marked down-regulation (>50%) of seven miRNAs in OHT(R) cells compared with parental MCF-7 cells. Increased expression of three of the most promising up-regulated (miR-221, miR-222, and miR-181) and down-regulated (miR-21, miR-342, and miR-489) miRNAs was validated by real-time reverse transcription-PCR. The expression of miR-221 and miR-222 was also significantly (2-fold) elevated in HER2/neu-positive primary human breast cancer tissues that are known to be resistant to endocrine therapy compared with HER2/neu-negative tissue samples. Ectopic expression of miR-221/222 rendered the parental MCF-7 cells resistant to tamoxifen. The protein level of the cell cycle inhibitor p27(Kip1), a known target of miR-221/222, was reduced by 50% in OHT(R) cells and by 28-50% in miR-221/222-overexpressing MCF-7 cells. Furthermore, overexpression of p27(Kip1) in the resistant OHT(R) cells caused enhanced cell death when exposed to tamoxifen. This is the first study demonstrating a relationship between miR-221/222 expression and HER2/neu overexpression in primary breast tumors that are generally resistant to tamoxifen therapy. This finding also provides the rationale for the application of altered expression of specific miRNAs as a predictive tamoxifen-resistant breast cancer marker.
LinkOut: [PMID: 18708351]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Fujita, Y. Kojima, K. Hamada, N. Ohhashi, et al.
- Biochem Biophys Res Commun, 2008
Tumor suppressor p53 transcriptionally regulates expression of microRNA-34a, which confers translational inhibition and mRNA degradation of genes involved in cell cycle control and apoptosis. In various cancers, miR-34a expression is lost or reduced. Here, we investigated the role of miR-34a in prostate cancer cell lines. MiR-34a expression was markedly reduced in p53-null PC3 cells and p53-mutated DU145 cells compared with LNCaP cells expressing wild-type p53. In PC3 cell, ectopic expression of miR-34a decreased the SIRT1 mRNA and protein levels as well as protein levels of known direct target genes. Reporter assays revealed that miR-34a-induced SIRT1 inhibition occurred at the transcriptional but not post-transcriptional level despite the presence of a potential miR-34a binding site within its 3'-UTR. Ectopic miR-34a expression resulted in cell cycle arrest and growth inhibition and attenuated chemoresistance to anticancer drug camptothecin by inducing apoptosis, suggesting a potential role of miR-34a for the treatment of p53-defective prostate cancer.
LinkOut: [PMID: 18834855]
Experimental Support 12 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Felicetti, F. Errico, M. C. Segnalini, P. et al.
- Expert Rev Anticancer Ther, 2008
MicroRNAs (miRNAs) represent a new family of small noncoding RNAs that negatively regulate gene expression. Recent studies demonstrated miRNA involvement in all the main biological processes, including tumor development as a consequence of an aberrant deregulated expression. Growing evidence is showing the capability of miRNA expression profiles to unequivocally distinguish between normal and neoplastic tissues, leading to the identification of new diagnostic and/or prognostic molecular markers. In addition, miRNAs might eventually represent new targets to aim at as innovative therapeutic approaches, particularly relevant in those types of cancer, such as melanoma, which are still lacking effective traditional therapies. In particular, the inhibition of miRNA-221 and -222, which are abnormally expressed in melanoma and favor the induction of the malignant phenotype by downregulating c-KIT receptor and p27Kip, might in the future represent an efficient treatment for translation into the clinical setting.
LinkOut: [PMID: 18983236]
Experimental Support 13 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions Human PASMC
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-221 Targets c-Kit and p27Kip1 in PASMC.//In this study we demonstrate that PDGF induces the expression of miR-221, which results in down-regulation of c-kit and p27Kip1 in human primary pulmonary artery smooth muscle cells (PASMC). ...

- Davis, B. N. Hilyard, A. C. Nguyen, P. H. et al., 2009, J Biol Chem.

Article - Davis, B. N. Hilyard, A. C. Nguyen, P. H. et al.
- J Biol Chem, 2009
The platelet-derived growth factor (PDGF) signaling pathway is a critical regulator of animal development and homeostasis. Activation of the PDGF pathway leads to neointimal proliferative responses to artery injury; it promotes a switch of vascular smooth muscle cells (vSMC) to a less contractile phenotype by inhibiting the SMC-specific gene expression and increasing the rate of proliferation and migration. The molecular mechanism for these pleiotropic effects of PDGFs has not been fully described. Here, we identify the microRNA-221 (miR-221), a small noncoding RNA, as a modulator of the phenotypic change of vSMCs in response to PDGF signaling. We demonstrate that miR-221 is transcriptionally induced upon PDGF treatment in primary vSMCs, leading to down-regulation of the targets c-Kit and p27Kip1. Down-regulation of p27Kip1 by miR-221 is critical for PDGF-mediated induction of cell proliferation. Additionally, decreased c-Kit causes inhibition of SMC-specific contractile gene transcription by reducing the expression of Myocardin (Myocd), a potent SMC-specific nuclear coactivator. Our study demonstrates that PDGF signaling, by modulating the expression of miR-221, regulates two critical determinants of the vSMC phenotype; they are SMC gene expression and cell proliferation.
LinkOut: [PMID: 19088079]
Experimental Support 14 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Western blot , Northern blot ,
Conditions LNCaP
Location of target site 3'UTR
Tools used in this research Literature survey
Original Description (Extracted from the article) ... Western blot analysis performed on protein extracts from miR-221 expressing tumors showed a clear reduction of p27 levels, as compared to control samples (Fig. 1F) ...

- Mercatelli, N. Coppola, V. Bonci, D. Miele, et al., 2008, PLoS One.

Article - Mercatelli, N. Coppola, V. Bonci, D. Miele, et al.
- PLoS One, 2008
BACKGROUND: MiR-221 and miR-222 are two highly homologous microRNAs whose upregulation has been recently described in several types of human tumors, for some of which their oncogenic role was explained by the discovery of their target p27, a key cell cycle regulator. We previously showed this regulatory relationship in prostate carcinoma cell lines in vitro, underlying the role of miR-221/222 as inducers of proliferation and tumorigenicity. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe a number of in vivo approaches confirming our previous data. The ectopic overexpression of miR-221 is able, per se, to confer a high growth advantage to LNCaP-derived tumors in SCID mice. Consistently, the anti-miR-221/222 antagomir treatment of established subcutaneous tumors derived from the highly aggressive PC3 cell line, naturally expressing high levels of miR-221/222, reduces tumor growth by increasing intratumoral p27 amount; this effect is long lasting, as it is detectable as long as 25 days after the treatment. Furthermore, we provide evidence in favour of a clinical relevance of the role of miR-221/222 in prostate carcinoma, by showing their general upregulation in patient-derived primary cell lines, where we find a significant inverse correlation with p27 expression. CONCLUSIONS/SIGNIFICANCE: These findings suggest that modulating miR-221/222 levels may have a therapeutic potential in prostate carcinoma.
LinkOut: [PMID: 19107213]
Experimental Support 15 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Liu, X. Cheng, Y. Zhang, S. Lin, Y. Yang, et al.
- Circ Res, 2009
MicroRNAs (miRNAs) comprise a novel class of endogenous, small, noncoding RNAs that negatively regulate gene expression. Functionally, an individual miRNA is as important as a transcription factor because it is able to regulate the expression of its multiple target genes. Recently, miR-221 and miR-222 have been found to play a critical role in cancer cell proliferation. However, their roles in vascular smooth muscle cell (VSMC) biology are currently unknown. In the present study, the time course changes and cellular distribution of miR-221 and miR-222 expression were identified in rat carotid arteries after angioplasty, in which their expression was upregulated and localized in VSMCs in the injured vascular walls. In cultured VSMCs, miR-221 and miR-222 expression was increased by growth stimulators. Knockdown of miR-221 and miR-222 resulted in decreased VSMC proliferation in vitro. Using both gain-of-function and loss-of-function approaches, we found that p27(Kip1) and p57(Kip2) were 2 target genes that were involved in miR-221- and miR-222-mediated effect on VSMC growth. Finally, knockdown of miR-221 and miR-222 in rat carotid arteries suppressed VSMC proliferation in vivo and neointimal lesion formation after angioplasty. The results indicate that miR-221 and miR-222 are novel regulators for VSMC proliferation and neointimal hyperplasia. These findings may also represent promising therapeutic targets in proliferative vascular diseases.
LinkOut: [PMID: 19150885]
Experimental Support 16 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... We show that miR-25 targets p57 through the 3 UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. ...

- Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al., 2009, Nucleic Acids Res.

Article - Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al.
- Nucleic Acids Res, 2009
microRNAs (miRNAs) play integral roles in diverse processes including tumorigenesis. miRNA gene loci are often found in close conjunction, and such clustered miRNA genes are transcribed from a common promoter to generate polycistronic primary transcript. The primary transcript (pri-miRNA) is then processed by two RNase III proteins to release the mature miRNAs. Although it has been speculated that the miRNAs in the same cluster may play related biological functions, this has not been experimentally addressed. Here we report that the miRNAs in two clusters (miR-106b approximately 93 approximately 25 and miR-222 approximately 221) suppress the Cip/Kip family members of Cdk inhibitors (p57(Kip2), p21(Cip1) and p27(Kip1)). We show that miR-25 targets p57 through the 3'-UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. Ectopic expression of these miRNAs results in activation of Cdk2 and facilitation of G1/S phase transition. Consistent with these results, both clusters are abnormally upregulated in gastric cancer tissues compared to the corresponding normal tissues. Ectopic expression of miR-222 cluster enhanced tumor growth in the mouse xenograft model. Our study demonstrates the functional associations between clustered miRNAs and further implicates that effective cancer treatment may require a combinatorial approach to target multiple oncogenic miRNA clusters.
LinkOut: [PMID: 19153141]
Experimental Support 17 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Immunohistochemistry , In situ hybridization , Luciferase reporter assay , Northern blot , Western blot ,
Conditions U251
Disease glioma;
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... UTR. To further confirm if the 3'UTR of p27kip1 has miR-221 and miR-222 specific binding sequences, we transfected the cells with pGL3-p27-3'UTR, pGL3-p27- 3'UTR-DM (mutant) and pGL3 control plasmids. As-miR-221/ 222 significantly enhanced the luciferase activity (Fig. 2A and B).// ...

- Zhang, C. Kang, C. You, Y. Pu, P. Yang, W. et al., 2009, Int J Oncol.

Article - Zhang, C. Kang, C. You, Y. Pu, P. Yang, W. et al.
- Int J Oncol, 2009
MicroRNAs are short regulatory RNAs that negatively modulate protein expression at a post-transcriptional level. Emerging evidence suggests that altered regulation of miRNA may be involved in the pathogenesis of several types of cancers. In the current study, an inverse relationship between the expression of miR-221/miR-222 and the cell cycle inhibitor p27Kip1 was identified in U251 glioma cells. Co-suppression of miR-221/222 directly resulted in the up-regulation of p27Kip1 in the tested cells, consequently, affects their growth potential by reducing a G1 to S shift in the cell cycle. Consistently, miR-221/222 knocked-down through antisense 2'-OME-oligonucleotides increased p27Kip1 in U251 glioma subcutaneous mice and strongly reduced tumor growth in vivo through up regulation of p27Kip1. Our results suggest that miR-221/222 is a regulator of the tumor suppressor gene p27Kip1, and co-suppression of miR-221/222 expression in advanced gliomas may inhibit glioma cell proliferation by a mechanism involving the up-regulation of p27Kip1 in vitro and in vivo.
LinkOut: [PMID: 19424584]
Experimental Support 18 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Kotani, A. Ha, D. Hsieh, J. Rao, P. K. et al.
- Blood, 2009
MLL-AF4 Acute Lymphocytic Leukemia (ALL) has a poor prognosis. MicroRNAs (miRNA) are small noncoding RNAs that post-transcriptionally regulate expression of target mRNAs. Our analysis of data published by Lu etc. (1), showed that expression of miR-128b and miR-221 is downregulated in MLL rearranged ALL relative to other types of ALL. Re-expression of these miRNAs cooperatively sensitizes two cultured lines of MLL-AF4 ALL cells to glucocorticoids. Target genes downregulated by miR-128b include MLL, AF4, and both MLL-AF4 and AF4-MLL fusion genes; miR-221 downregulates CDKN1B. These results demonstrate that downregulation of miR-128b and miR-221 is implicated in glucocorticoid resistance, that restoration of their levels is a potentially promising therapeutic in MLL-AF4 ALL.
LinkOut: [PMID: 19749093]
Experimental Support 19 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions C2C12
Location of target site 3'UTR
Original Description (Extracted from the article) ... p27 inversely correlated with miR-221 and miR-222 expression, and indeed we show that p27 mRNA is a direct target of these miRNAs ...

- Cardinali, B. Castellani, L. Fasanaro, P. et al., 2009, PLoS One.

Article - Cardinali, B. Castellani, L. Fasanaro, P. et al.
- PLoS One, 2009
BACKGROUND: MicroRNAs (miRNAs) are a class of small non-coding RNAs that have recently emerged as important regulators of gene expression. They negatively regulate gene expression post-transcriptionally by translational repression and target mRNA degradation. miRNAs have been shown to play crucial roles in muscle development and in regulation of muscle cell proliferation and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: By comparing miRNA expression profiling of proliferating myoblasts versus differentiated myotubes, a number of modulated miRNAs, not previously implicated in regulation of myogenic differentiation, were identified. Among these, miR-221 and miR-222 were strongly down-regulated upon differentiation of both primary and established myogenic cells. Conversely, miR-221 and miR-222 expression was restored in post-mitotic, terminally differentiated myotubes subjected to Src tyrosine kinase activation. By the use of specific inhibitors we provide evidence that expression of miR-221 and miR-222 is under the control of the Ras-MAPK pathway. Both in myoblasts and in myotubes, levels of the cell cycle inhibitor p27 inversely correlated with miR-221 and miR-222 expression, and indeed we show that p27 mRNA is a direct target of these miRNAs in myogenic cells. Ectopic expression of miR-221 and miR-222 in myoblasts undergoing differentiation induced a delay in withdrawal from the cell cycle and in myogenin expression, followed by inhibition of sarcomeric protein accumulation. When miR-221 and miR-222 were expressed in myotubes undergoing maturation, a profound alteration of myofibrillar organization was observed. CONCLUSIONS/SIGNIFICANCE: miR-221 and miR-222 have been found to be modulated during myogenesis and to play a role both in the progression from myoblasts to myocytes and in the achievement of the fully differentiated phenotype. Identification of miRNAs modulating muscle gene expression is crucial for the understanding of the circuits controlling skeletal muscle differentiation and maintenance.
LinkOut: [PMID: 19859555]
Experimental Support 20 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method immunohistochemistry , Microarray , qRT-PCR
Conditions brain tumor
Original Description (Extracted from the article) ... The deregulated expression of miR221/222 was demonstrated to inhibit the expression of the tumor suppressor and inhibitor of cell cycle p27Kip1.//MiR-221 and miR-222 were upregulated in ATRT and their expression inversely correlated with p27Kip1 mRNA expression.//The inverse correlation between miR-221/222 and p27Kip1 expression was also observed at the protein level. ...

- Sredni, S. T. Bonaldo Mde, F. Costa, F. F. et al., 2010, Childs Nerv Syst.

Article - Sredni, S. T. Bonaldo Mde, F. Costa, F. F. et al.
- Childs Nerv Syst, 2010
PURPOSE: The aim of this study is to search for new therapeutic targets for atypical teratoid-rhabdoid tumors (ATRT). METHODS: To achieve this, we compared the expression of 365 microRNAs among ATRT, medulloblastomas, and normal brain. RESULTS: MiR-221 and miR-222 were within the top differentially expressed microRNAs. The deregulated expression of miR221/222 was demonstrated to inhibit the expression of the tumor suppressor and inhibitor of cell cycle p27(Kip1). Here, we demonstrated the negative regulation of p27(Kip1) by miR-221/222 in ATRT using microarray, real-time reverse transcriptase polymerase chain reaction, and immunohistochemistry. CONCLUSION: As anti-miR therapy was recently proposed as an alternative treatment for cancer, these findings suggest that anti-miR-221/222 therapy might have therapeutic potential in ATRT.
LinkOut: [PMID: 20012062]
Experimental Support 21 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Northern blot , qRT-PCR , Western blot
Conditions HCC
Disease adult primary liver cancer
Location of target site 3'UTR
Original Description (Extracted from the article) ... However, there was no difference in the mRNA expression levels of p27 by qPCR, suggesting a translational inhibition of p27 and not mRNA degradation. Finally, in transfected HeLa and 293T cells, overexpression with vectors expressing miR-221 ...

- Pineau, P. Volinia, S. McJunkin, K. et al., 2010, Proc Natl Acad Sci U S A.

Article - Pineau, P. Volinia, S. McJunkin, K. et al.
- Proc Natl Acad Sci U S A, 2010
MicroRNA (miRNAs) are negative regulators of gene expression and can function as tumor suppressors or oncogenes. Expression patterns of miRNAs and their role in the pathogenesis of hepatocellular carcinoma (HCC) are still poorly understood. We profiled miRNA expression in tissue samples (104 HCC, 90 adjacent cirrhotic livers, 21 normal livers) as well as in 35 HCC cell lines. A set of 12 miRNAs (including miR-21, miR-221/222, miR-34a, miR-519a, miR-93, miR-96, and let-7c) was linked to disease progression from normal liver through cirrhosis to full-blown HCC. miR-221/222, the most up-regulated miRNAs in tumor samples, are shown to target the CDK inhibitor p27 and to enhance cell growth in vitro. Conversely, these activities can be efficiently inhibited by an antagomiR specific for miR-221. In addition, we show, using a mouse model of liver cancer, that miR-221 overexpression stimulates growth of tumorigenic murine hepatic progenitor cells. Finally, we identified DNA damage-inducible transcript 4 (DDIT4), a modulator of mTOR pathway, as a bona fide target of miR-221. Taken together, these data reveal an important contribution for miR-221 in hepatocarcinogenesis and suggest a role for DDIT4 dysregulation in this process. Thus, the use of synthetic inhibitors of miR-221 may prove to be a promising approach to liver cancer treatment.
LinkOut: [PMID: 20018759]
Experimental Support 22 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: CDKN1B    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
252 hsa-miR-221-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000137 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 24
MIRT000140 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 2
MIRT000141 BMF Bcl2 modifying factor 4 1
MIRT000434 FOXO3 forkhead box O3 4 1
MIRT001780 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 5 12
MIRT001971 HOXB5 homeobox B5 1 1
MIRT002272 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 5 5
MIRT002335 TMED7 transmembrane emp24 protein transport domain containing 7 4 9
MIRT003358 DDIT4 DNA-damage-inducible transcript 4 6 2
MIRT003359 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 5 1
MIRT003360 TBK1 TANK-binding kinase 1 4 1
MIRT003361 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 2 1
MIRT003362 DKK2 dickkopf homolog 2 (Xenopus laevis) 2 1
MIRT003363 CREBZF CREB/ATF bZIP transcription factor 2 1
MIRT003364 BRAP BRCA1 associated protein 2 1
MIRT003365 USP18 ubiquitin specific peptidase 18 2 1
MIRT003366 ARIH2 ariadne homolog 2 (Drosophila) 2 1
MIRT003367 BBC3 BCL2 binding component 3 4 3
MIRT003368 HMGXB4 HMG box domain containing 4 2 1
MIRT003452 TIMP3 TIMP metallopeptidase inhibitor 3 3 4
MIRT003757 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 2 1
MIRT004430 ICAM1 intercellular adhesion molecule 1 3 2
MIRT004484 FOS FBJ murine osteosarcoma viral oncogene homolog 4 2
MIRT004753 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 5 1
MIRT005295 NAIP NLR family, apoptosis inhibitory protein 2 1
MIRT005320 ESR1 estrogen receptor 1 4 1
MIRT005475 TICAM1 toll-like receptor adaptor molecule 1 4 1
MIRT005585 PTEN phosphatase and tensin homolog 4 3
MIRT005714 SELE selectin E 1 1
MIRT005785 TP53 tumor protein p53 1 1
MIRT005787 CORO1A coronin, actin binding protein, 1A 2 2
MIRT005789 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT006018 DIRAS3 DIRAS family, GTP-binding RAS-like 3 3 1
MIRT006063 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT006376 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006841 TRPS1 trichorhinophalangeal syndrome I 4 1
MIRT006917 CERS2 LAG1 homolog, ceramide synthase 2 3 1
MIRT007377 FMR1 fragile X mental retardation 1 1 1
MIRT024137 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT024138 ABHD3 abhydrolase domain containing 3 1 1
MIRT024139 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT024140 SPTSSA chromosome 14 open reading frame 147 1 1
MIRT024141 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT024142 NR2C2AP nuclear receptor 2C2-associated protein 1 1
MIRT024143 APOL2 apolipoprotein L, 2 1 1
MIRT024144 TDRP chromosome 8 open reading frame 42 1 1
MIRT024145 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT024146 TMEM168 transmembrane protein 168 1 1
MIRT024147 TUB tubby homolog (mouse) 1 1
MIRT024148 ZNF652 zinc finger protein 652 1 1
MIRT024149 DVL2 dishevelled, dsh homolog 2 (Drosophila) 2 1
MIRT024150 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT024151 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT024152 KLF9 Kruppel-like factor 9 1 1
MIRT024153 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT024154 TMEM64 transmembrane protein 64 1 1
MIRT024155 GID8 chromosome 20 open reading frame 11 1 1
MIRT024156 ZNF571 zinc finger protein 571 1 1
MIRT024157 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT024158 ATL2 atlastin GTPase 2 1 1
MIRT024159 E2F3 E2F transcription factor 3 1 1
MIRT024160 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT024161 CXorf38 chromosome X open reading frame 38 1 1
MIRT024162 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT024163 NHSL1 NHS-like 1 1 1
MIRT024164 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT024165 WDR61 WD repeat domain 61 1 1
MIRT024166 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 1
MIRT024167 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT024168 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT024169 RNF20 ring finger protein 20 1 1
MIRT024170 PHF12 PHD finger protein 12 1 1
MIRT024171 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT024172 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT024173 LYSMD1 LysM, putative peptidoglycan-binding, domain containing 1 1 1
MIRT024174 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT024175 TIPARP TCDD-inducible poly(ADP-ribose) polymerase 1 1
MIRT024176 GPR107 G protein-coupled receptor 107 1 1
MIRT024177 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT024178 STAMBP STAM binding protein 1 1
MIRT024179 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT024180 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT024181 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT024182 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT024183 RNF4 ring finger protein 4 1 1
MIRT024184 ASXL3 additional sex combs like 3 (Drosophila) 1 1
MIRT024185 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT024186 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT024187 RNF44 ring finger protein 44 1 1
MIRT024188 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT024189 ZNF275 zinc finger protein 275 1 1
MIRT024190 TMEM132B transmembrane protein 132B 1 1
MIRT024191 CCSAP chromosome 1 open reading frame 96 1 1
MIRT024192 BRD1 bromodomain containing 1 1 1
MIRT024193 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT024194 FBXO28 F-box protein 28 1 1
MIRT024195 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT024196 PANK3 pantothenate kinase 3 1 1
MIRT024197 ZKSCAN8 zinc finger protein 192 1 1
MIRT024198 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT024199 UBE2J1 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) 1 1
MIRT024200 MIDN midnolin 1 1
MIRT024201 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT024202 ATXN1 ataxin 1 1 2
MIRT024203 POGZ pogo transposable element with ZNF domain 1 1
MIRT024204 PPP1R15B protein phosphatase 1, regulatory (inhibitor) subunit 15B 1 1
MIRT024205 HECTD2 HECT domain containing 2 1 1
MIRT024206 POU3F2 POU class 3 homeobox 2 1 1
MIRT024207 HOXC10 homeobox C10 1 1
MIRT024208 MEOX2 mesenchyme homeobox 2 2 1
MIRT024209 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT046837 RUNDC3B RUN domain containing 3B 1 1
MIRT046838 TRAF4 TNF receptor-associated factor 4 1 1
MIRT046839 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT046840 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT046841 RBM33 RNA binding motif protein 33 1 1
MIRT046842 CROT carnitine O-octanoyltransferase 1 1
MIRT046843 ACTB actin, beta 1 1
MIRT046844 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT046845 USP28 ubiquitin specific peptidase 28 1 1
MIRT046846 PALB2 partner and localizer of BRCA2 1 1
MIRT046847 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT046848 YY1 YY1 transcription factor 1 1
MIRT046849 PLP2 proteolipid protein 2 (colonic epithelium-enriched) 1 1
MIRT046850 PXN paxillin 1 1
MIRT046851 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT046852 RPS24 ribosomal protein S24 1 1
MIRT046853 TSN translin 1 1
MIRT046854 HIST1H3D histone cluster 1, H3d 1 1
MIRT046855 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT046856 PSMD4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1 1
MIRT046857 PELO pelota homolog (Drosophila) 1 1
MIRT046859 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT046860 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT046861 HIST2H3D histone cluster 2, H3d 1 1
MIRT046862 MTSS1L metastasis suppressor 1-like 1 1
MIRT046863 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046864 NOP58 NOP58 ribonucleoprotein homolog (yeast) 1 1
MIRT046865 TUBA1C tubulin, alpha 1c 1 1
MIRT046866 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT046867 TMEM248 chromosome 7 open reading frame 42 1 1
MIRT046868 RAB5C RAB5C, member RAS oncogene family 1 1
MIRT046869 RPL15 ribosomal protein L15 1 1
MIRT046870 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT046871 LPHN2 latrophilin 2 1 1
MIRT046872 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT046873 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT046874 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT046875 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT046876 B4GALT2 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 1 1
MIRT046877 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT046878 PEX19 peroxisomal biogenesis factor 19 1 1
MIRT046879 PITPNM1 phosphatidylinositol transfer protein, membrane-associated 1 1 1
MIRT046880 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT046881 KIF16B kinesin family member 16B 1 1
MIRT046882 SEPHS1 selenophosphate synthetase 1 1 1
MIRT046883 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT046884 SF1 splicing factor 1 1 1
MIRT046885 RHOA ras homolog gene family, member A 1 1
MIRT046886 RBM39 RNA binding motif protein 39 1 1
MIRT046887 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT046888 FLNA filamin A, alpha 1 1
MIRT046889 CCDC142 coiled-coil domain containing 142 1 1
MIRT046890 ZYX zyxin 1 1
MIRT046891 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT046892 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT046893 MDFIC MyoD family inhibitor domain containing 1 1
MIRT046894 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT046895 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT046896 UBC ubiquitin C 1 1
MIRT046897 UQCR10 ubiquinol-cytochrome c reductase, complex III subunit X 1 1
MIRT046898 ADD1 adducin 1 (alpha) 1 1
MIRT046899 HECTD1 HECT domain containing 1 1 1
MIRT046900 FUS fused in sarcoma 1 1
MIRT046901 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT046902 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT046903 RPL21 ribosomal protein L21 1 1
MIRT046904 WDR34 WD repeat domain 34 1 1
MIRT046905 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT046906 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT046907 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
MIRT046908 EVL Enah/Vasp-like 1 1
MIRT046909 NCL nucleolin 1 1
MIRT046910 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT046911 PEG10 paternally expressed 10 1 1
MIRT046912 ANKRD28 ankyrin repeat domain 28 1 1
MIRT046913 TMEM183A transmembrane protein 183A 1 1
MIRT046914 LDHB lactate dehydrogenase B 1 1
MIRT046915 TRIM28 tripartite motif-containing 28 1 1
MIRT046916 NUP210 nucleoporin 210kDa 1 1
MIRT046917 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT046918 PEX1 peroxisomal biogenesis factor 1 1 1
MIRT046919 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT046920 SRP68 signal recognition particle 68kDa 1 1
MIRT046921 NUF2 NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT046922 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT046923 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT046924 CLIC1 chloride intracellular channel 1 1 1
MIRT046925 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT046926 NFYC nuclear transcription factor Y, gamma 1 1
MIRT046927 PHF21A PHD finger protein 21A 1 1
MIRT046928 TSC22D2 TSC22 domain family, member 2 1 1
MIRT046929 PKM pyruvate kinase, muscle 1 1
MIRT046930 CENPT centromere protein T 1 1
MIRT046931 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT046932 LAMTOR5 hepatitis B virus x interacting protein 1 1
MIRT046933 MIEN1 chromosome 17 open reading frame 37 1 1
MIRT046934 RPS7 ribosomal protein S7 1 1
MIRT046935 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT046936 IQCE IQ motif containing E 1 1
MIRT046937 RPLP0 ribosomal protein, large, P0 1 1
MIRT046938 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT046939 CDC25C cell division cycle 25 homolog C (S. pombe) 1 1
MIRT046940 TOB2 transducer of ERBB2, 2 1 1
MIRT046941 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT046942 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT046943 SPAG5 sperm associated antigen 5 1 1
MIRT046944 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT046945 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT046946 SAPCD2 chromosome 9 open reading frame 140 1 1
MIRT046947 NFYA nuclear transcription factor Y, alpha 1 1
MIRT046948 KHSRP KH-type splicing regulatory protein 1 1
MIRT046949 AMOT angiomotin 1 1
MIRT046950 POLG polymerase (DNA directed), gamma 1 1
MIRT046951 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT046952 FBN3 fibrillin 3 1 1
MIRT046953 SPRYD3 SPRY domain containing 3 1 1
MIRT046954 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT046955 BAG3 BCL2-associated athanogene 3 1 1
MIRT046956 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT046957 PRDM16 PR domain containing 16 1 1
MIRT046958 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT046959 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT046960 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT046961 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046962 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT046963 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT046964 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT046965 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT046966 RBM6 RNA binding motif protein 6 1 1
MIRT046967 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT046968 CNRIP1 cannabinoid receptor interacting protein 1 1 1
MIRT046969 NUP205 nucleoporin 205kDa 1 1
MIRT046970 DENR density-regulated protein 1 1
MIRT046971 ACTG1 actin, gamma 1 1 1
MIRT046972 ZNF35 zinc finger protein 35 1 1
MIRT046973 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT046974 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 1 1
MIRT046975 CABYR calcium binding tyrosine-(Y)-phosphorylation regulated 1 1
MIRT046976 MFN2 mitofusin 2 1 1
MIRT046977 ARHGAP42 Rho GTPase activating protein 42 1 1
MIRT046978 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1