Accession ID: MIRT000153 [miRNA, hsa-miR-210-3p :: FGFRL1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-210LinkOut: [miRBase ]
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Mature Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-210-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGFRL1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FGFR5, FHFR
Description fibroblast growth factor receptor-like 1
Transcript NM_0010043    LinkOut: [ RefSeq ]
Other Transcripts NM_0010043 , NM_0219   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGFRL1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGFRL1
(miRNA target sites are highlighted)
>FGFRL1|NM_0010043|3'UTR
   1 TAGACGGCACCGTATCTGCAGTGGGCACGGGGGGGCCGGCCAGACAGGCAGACTGGGAGGATGGAGGACGGAGCTGCAGA
  81 CGAAGGCAGGGGACCCATGGCGAGGAGGAATGGCCAGCACCCCAGGCAGTCTGTGTGTGAGGCATAGCCCCTGGACACAC
 161 ACACACAGACACACACACTGCCTGGATGCATGTATGCACACACATGCGCGCACACGTGCTCCCTGAAGGCACACGTACGC
 241 ACACACGCACATGCACAGATATGCCGCCTGGGCACACAGATAAGCTGCCCAAATGCACGCACACGCACAGAGACATGCCA
 321 GAACATACAAGGACATGCTGCCTGAACATACACACGCACACCCATGCGCAGATGTGCTGCCTGGACACACACACACACAC
 401 GGATATGCTGTCTGGACGCACACACGTGCAGATATGGTATCCGGACACACACGTGCACAGATATGCTGCCTGGACACACA
 481 GATAATGCTGCCTTGACACACACATGCACGGATATTGCCTGGACACACACACACACACGTGTGCACAGATATGCTGTCTG
 561 GACACGCACACACATGCAGATATGCTGCCTGGACACACACTTCCAGACACACGTGCACAGGCGCAGATATGCTGCCTGGA
 641 CACACGCAGATATGCTGTCTAGTCACACACACACGCAGACATGCTGTCCGGACACACACACGCATGCACAGATATGCTGT
 721 CCGGACACACACACGCACGCAGATATGCTGCCTGGACACACACACAGATAATGCTGCCTCAACACTCACACACGTGCAGA
 801 TATTGCCTGGACACACACATGTGCACAGATATGCTGTCTGGACATGCACACACGTGCAGATATGCTGTCCGGATACACAC
 881 GCACGCACACATGCAGATATGCTGCCTGGGCACACACTTCCGGACACACATGCACACACAGGTGCAGATATGCTGCCTGG
 961 ACACACGCAGACTGACGTGCTTTTGGGAGGGTGTGCCGTGAAGCCTGCAGTACGTGTGCCGTGAGGCTCATAGTTGATGA
1041 GGGACTTTCCCTGCTCCACCGTCACTCCCCCAACTCTGCCCGCCTCTGTCCCCGCCTCAGTCCCCGCCTCCATCCCCGCC
1121 TCTGTCCCCTGGCCTTGGCGGCTATTTTTGCCACCTGCCTTGGGTGCCCAGGAGTCCCCTACTGCTGTGGGCTGGGGTTG
1201 GGGGCACAGCAGCCCCAAGCCTGAGAGGCTGGAGCCCATGGCTAGTGGCTCATCCCCACTGCATTCTCCCCCTGACACAG
1281 AGAAGGGGCCTTGGTATTTATATTTAAGAAATGAAGATAATATTAATAATGATGGAAGGAAGACTGGGTTGCAGGGACTG
1361 TGGTCTCTCCTGGGGCCCGGGACCCGCCTGGTCTTTCAGCCATGCTGATGACCACACCCCGTCCAGGCCAGACACCACCC
1441 CCCACCCCACTGTCGTGGTGGCCCCAGATCTCTGTAATTTTATGTAGAGTTTGAGCTGAAGCCCCGTATATTTAATTTAT
1521 TTTGTTAAACATGAAAGTGCATCCTTTCCCTCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agucgGCGACAG---UGUGCGUGUc 5'
               :||||||   ||||||||| 
Target 5' agataTGCTGTCTGGACACGCACAc 3'
547 - 571 169.00 -23.30
2
miRNA  3' aguCGGC-GAC----A-GUGUGCGUGUc 5'
             ||:| |||    | |||||||||| 
Target 5' catGCTGCCTGAACATACACACGCACAc 3'
334 - 361 161.00 -20.50
3
miRNA  3' agucgGCGACAG-UGUGCGUGUc 5'
               :|||||| : ||||||| 
Target 5' ggataTGCTGTCTGGACGCACAc 3'
401 - 423 161.00 -21.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: FGFRL1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Huang, X. Ding, L. Bennewith, K. L. Tong, et al.
- Mol Cell, 2009
Previous studies have suggested that the HIF transcription factors can both activate and inhibit gene expression. Here we show that HIF1 regulates the expression of mir-210 in a variety of tumor types through a hypoxia-responsive element. Expression analysis in primary head and neck tumor samples indicates that mir-210 may serve as an in vivo marker for tumor hypoxia. By Argonaute protein immunoprecipitation, we identified 50 potential mir-210 targets and validated randomly selected ones. The majority of these 50 genes are not classical hypoxia-inducible genes, suggesting mir-210 represses genes expressed under normoxia that are no longer necessary to adapt and survive in a hypoxic environment. When human head and neck or pancreatic tumor cells ectopically expressing mir-210 were implanted into immunodeficient mice, mir-210 repressed initiation of tumor growth. Taken together, these data implicate an important role for mir-210 in regulating the hypoxic response of tumor cells and tumor growth.
LinkOut: [PMID: 19782034]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: FGFRL1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot ,
Conditions HE3 , HEEpiC , KYSE-150 , KYSE-170 , KYSE-190 , KYSE-590
Disease esophageal squamous cell carcinoma;
Location of target site 3'UTR
Tools used in this research MicroCosm , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-210 targets FGFRL1 3'-UTR directly ...

- Tsuchiya, S. Fujiwara, T. Sato, F. Shimada, et al., 2011, The Journal of biological chemistry.

Article - Tsuchiya, S. Fujiwara, T. Sato, F. Shimada, et al.
- The Journal of biological chemistry, 2011
The importance of microRNAs (miRNAs) in human malignancies has been well recognized. Here, we report that the expression of microRNA-210 (miR-210) is down-regulated in human esophageal squamous cell carcinoma and derived cell lines. Marked decreases in the level of miR-210 were observed especially in poorly differentiated carcinomas. We found that miR-210 inhibits cancer cell survival and proliferation by inducing cell death and cell cycle arrest in G(1)/G(0) and G(2)/M. Finally, we identified fibroblast growth factor receptor-like 1 (FGFRL1) as a target of miR-210 in esophageal squamous cell carcinoma and demonstrated that FGFRL1 accelerates cancer cell proliferation by preventing cell cycle arrest in G(1)/G(0). Taken together, our findings show an important role for miR-210 as a tumor-suppressive microRNA with effects on cancer cell proliferation.
LinkOut: [PMID: 21044961]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
55 hsa-miR-210-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 2 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 pim-1 oncogene 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor-like 1 5 2
MIRT000156 RAD52 RAD52 homolog (S. cerevisiae) 4 3
MIRT001930 NPTX1 neuronal pentraxin I 3 2
MIRT002024 EFNA3 ephrin-A3 4 5
MIRT003153 BDNF brain-derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase, beta polypeptide 4 1
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1-like (S. cerevisiae) 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 KIAA1161 3 1
MIRT003163 ISCU iron-sulfur cluster scaffold homolog (E. coli) 6 5
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1-like 4 1
MIRT003166 DENND6A family with sequence similarity 116, member A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 4 1
MIRT003168 CDK10 cyclin-dependent kinase 10 3 1
MIRT003169 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 3 1
MIRT003170 CBX1 chromobox homolog 1 (HP1 beta homolog Drosophila ) 3 1
MIRT003171 XIST X (inactive)-specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL Nipped-B homolog (Drosophila) 3 1
MIRT003176 MIB1 mindbomb homolog 1 (Drosophila) 3 1
MIRT003177 HECTD1 HECT domain containing 1 3 1
MIRT003178 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase, class VI, type 11C 3 1
MIRT003183 APC adenomatous polyposis coli 3 1
MIRT003184 E2F3 E2F transcription factor 3 4 3
MIRT003185 ACVR1B activin A receptor, type IB 2 1
MIRT003916 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2 1
MIRT003917 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT004672 MNT MAX binding protein 4 1
MIRT006326 AIFM3 apoptosis-inducing factor, mitochondrion-associated, 3 1 1
MIRT006519 CASP8AP2 caspase 8 associated protein 2 2 1
MIRT006663 VMP1 transmembrane protein 49 3 1
MIRT006830 TFRC transferrin receptor (p90, CD71) 2 1
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT047006 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT047007 SCN1B sodium channel, voltage-gated, type I, beta 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1