Accession ID: MIRT000153 [miRNA, hsa-miR-210-3p :: FGFRL1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-210LinkOut: [miRBase ]
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Mature Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-210-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: FGFRL1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Huang, X. Ding, L. Bennewith, K. L. Tong, et al.
- Mol Cell, 2009
Previous studies have suggested that the HIF transcription factors can both activate and inhibit gene expression. Here we show that HIF1 regulates the expression of mir-210 in a variety of tumor types through a hypoxia-responsive element. Expression analysis in primary head and neck tumor samples indicates that mir-210 may serve as an in vivo marker for tumor hypoxia. By Argonaute protein immunoprecipitation, we identified 50 potential mir-210 targets and validated randomly selected ones. The majority of these 50 genes are not classical hypoxia-inducible genes, suggesting mir-210 represses genes expressed under normoxia that are no longer necessary to adapt and survive in a hypoxic environment. When human head and neck or pancreatic tumor cells ectopically expressing mir-210 were implanted into immunodeficient mice, mir-210 repressed initiation of tumor growth. Taken together, these data implicate an important role for mir-210 in regulating the hypoxic response of tumor cells and tumor growth.
LinkOut: [PMID: 19782034]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: FGFRL1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot ,
Conditions HE3 , HEEpiC , KYSE-150 , KYSE-170 , KYSE-190 , KYSE-590
Disease esophageal squamous cell carcinoma;
Location of target site 3'UTR
Tools used in this research MicroCosm , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-210 targets FGFRL1 3'-UTR directly ...

- Tsuchiya, S. Fujiwara, T. Sato, F. Shimada, et al., 2011, The Journal of biological chemistry.

Article - Tsuchiya, S. Fujiwara, T. Sato, F. Shimada, et al.
- The Journal of biological chemistry, 2011
The importance of microRNAs (miRNAs) in human malignancies has been well recognized. Here, we report that the expression of microRNA-210 (miR-210) is down-regulated in human esophageal squamous cell carcinoma and derived cell lines. Marked decreases in the level of miR-210 were observed especially in poorly differentiated carcinomas. We found that miR-210 inhibits cancer cell survival and proliferation by inducing cell death and cell cycle arrest in G(1)/G(0) and G(2)/M. Finally, we identified fibroblast growth factor receptor-like 1 (FGFRL1) as a target of miR-210 in esophageal squamous cell carcinoma and demonstrated that FGFRL1 accelerates cancer cell proliferation by preventing cell cycle arrest in G(1)/G(0). Taken together, our findings show an important role for miR-210 as a tumor-suppressive microRNA with effects on cancer cell proliferation.
LinkOut: [PMID: 21044961]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-210-3p :: FGFRL1    [ Functional MTI ]
Validation Method
Article - Riley, K. J. Rabinowitz, G. S. Yario, T. A. et al.
- EMBO J, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
111 hsa-miR-210-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 2 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 pim-1 oncogene 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor-like 1 6 3
MIRT000156 RAD52 RAD52 homolog (S. cerevisiae) 4 3
MIRT001930 NPTX1 neuronal pentraxin I 3 2
MIRT002024 EFNA3 ephrin-A3 5 7
MIRT003153 BDNF brain-derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase, beta polypeptide 4 1
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1-like (S. cerevisiae) 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 KIAA1161 3 1
MIRT003163 ISCU iron-sulfur cluster scaffold homolog (E. coli) 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1-like 4 1
MIRT003166 DENND6A DENN/MADD domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 4 1
MIRT003168 CDK10 cyclin-dependent kinase 10 3 1
MIRT003169 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 3 1
MIRT003170 CBX1 chromobox homolog 1 3 1
MIRT003171 XIST X (inactive)-specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL Nipped-B homolog (Drosophila) 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase, class VI, type 11C 3 1
MIRT003183 APC adenomatous polyposis coli 3 1
MIRT003184 E2F3 E2F transcription factor 3 5 4
MIRT003185 ACVR1B activin A receptor, type IB 2 1
MIRT003916 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2 1
MIRT003917 XPA xeroderma pigmentosum, complementation group A 2 1
MIRT004672 MNT MAX binding protein 4 2
MIRT006326 AIFM3 apoptosis-inducing factor, mitochondrion-associated, 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 2 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor (p90, CD71) 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT047006 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT047007 SCN1B sodium channel, voltage-gated, type I, beta subunit 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid (17-beta) dehydrogenase 1 2 1
MIRT054098 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 4 2
MIRT054099 SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 5 3
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae) 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family, member A1 4 1
MIRT054204 FOXN3 forkhead box N3 4 1
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin-like growth factor binding protein 3 4 1
MIRT054207 COL4A2 collagen, type IV, alpha 2 4 1
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase, 40kDa 4 1
MIRT054209 EHD2 EH-domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamic acid-rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 2 1
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3, alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1, E3 ubiquitin protein ligase 1 2
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 3 1
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator homolog A (yeast) 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 2
MIRT440570 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT440866 CSNK1E casein kinase 1, epsilon 1 1
MIRT472232 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT473190 MITF microphthalmia-associated transcription factor 1 1
MIRT477856 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT497528 ZNF607 zinc finger protein 607 1 1
MIRT509770 SERTM1 serine-rich and transmembrane domain containing 1 1 3
MIRT524407 CNTNAP5 contactin associated protein-like 5 1 2
MIRT535209 PKIA protein kinase (cAMP-dependent, catalytic) inhibitor alpha 1 2
MIRT554511 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 2
MIRT558069 ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) 1 1
MIRT572273 KCNJ6 potassium inwardly-rectifying channel, subfamily J, member 6 1 1
MIRT574255 DOCK7 dedicator of cytokinesis 7 1 2
MIRT575621 Foxn3 forkhead box N3 1 1
MIRT575742 Zfp618 zinc fingerprotein 618 1 1
MIRT609050 VAMP4 vesicle-associated membrane protein 4 1 1
MIRT611143 TNRC6B trinucleotide repeat containing 6B 1 2
MIRT699226 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT703060 GTDC1 glycosyltransferase-like domain containing 1 1 1
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*