Accession ID: MIRT000192 [miRNA, hsa-miR-204-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-204LinkOut: [miRBase ]
Description Homo sapiens miR-204 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-204-5p
Mature Sequence 33| UUCCCUUUGUCAUCCUAUGCCU |54
Evidence Experimental
Experiments Cloned
Putative hsa-miR-204-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-204-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Yang, N. Kaur, S. Volinia, S. Greshock, J. et al.
- Cancer Res, 2008
MicroRNAs (miRNA) are approximately 22-nucleotide noncoding RNAs that negatively regulate protein-coding gene expression in a sequence-specific manner via translational inhibition or mRNA degradation. Our recent studies showed that miRNAs exhibit genomic alterations at a high frequency and their expression is remarkably deregulated in ovarian cancer, strongly suggesting that miRNAs are involved in the initiation and progression of this disease. In the present study, we performed miRNA microarray to identify the miRNAs associated with chemotherapy response in ovarian cancer and found that let-7i expression was significantly reduced in chemotherapy-resistant patients (n = 69, P = 0.003). This result was further validated by stem-loop real-time reverse transcription-PCR (n = 62, P = 0.015). Both loss-of-function (by synthetic let-7i inhibitor) and gain-of-function (by retroviral overexpression of let-7i) studies showed that reduced let-7i expression significantly increased the resistance of ovarian and breast cancer cells to the chemotherapy drug, cis-platinum. Finally, using miRNA microarray, we found that decreased let-7i expression was significantly associated with the shorter progression-free survival of patients with late-stage ovarian cancer (n = 72, P = 0.042). This finding was further validated in the same sample set by stem-loop real-time reverse transcription-PCR (n = 62, P = 0.001) and in an independent sample set by in situ hybridization (n = 53, P = 0.049). Taken together, our results strongly suggest that let-7i might be used as a therapeutic target to modulate platinum-based chemotherapy and as a biomarker to predict chemotherapy response and survival in patients with ovarian cancer.
LinkOut: [PMID: 19074899]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-204-5p :: BCL2    [ Functional MTI ]
Validation Method
Article - Ryan, J. Tivnan, A. Fay, J. Bryan, K. et al.
- Br J Cancer, 2012
Background:Neuroblastoma remains a major cause of cancer-linked mortality in children. miR-204 has been used in microRNA expression signatures predictive of neuroblastoma patient survival. The aim of this study was to explore the independent association of miR-204 with survival in a neuroblastoma cohort, and to investigate the phenotypic effects mediated by miR-204 expression in neuroblastoma.Methods:Neuroblastoma cell lines were transiently transfected with miR-204 mimics and assessed for cell viability using MTS assays. Apoptosis levels in cell lines were evaluated by FACS analysis of Annexin V-/propidium iodide-stained cells transfected with miR-204 mimics and treated with chemotherapy drug or vehicle control. Potential targets of miR-204 were validated using luciferase reporter assays.Results:miR-204 expression in primary neuroblastoma tumours was predictive of patient event-free and overall survival, independent of established known risk factors. Ectopic miR-204 expression significantly increased sensitivity to cisplatin and etoposide in vitro. miR-204 direct targeting of the 3' UTR of BCL2 and NTRK2 (TrkB) was confirmed.Conclusion:miR-204 is a novel predictor of outcome in neuroblastoma, functioning, at least in part, through increasing sensitivity to cisplatin by direct targeting and downregulation of anti-apoptotic BCL2. miR-204 also targets full-length NTRK2, a potent oncogene involved with chemotherapy drug resistance in neuroblastoma.British Journal of Cancer advance online publication, 14 August 2012; doi:10.1038/bjc.2012.356 www.bjcancer.com.
LinkOut: [PMID: 22892391]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
398 hsa-miR-204-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000189 MEIS1 Meis homeobox 1 4 2
MIRT000190 HOXA10 homeobox A10 2 2
MIRT000191 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT000192 BCL2 B-cell CLL/lymphoma 2 5 4
MIRT003271 TGFBR1 transforming growth factor, beta receptor 1 2 1
MIRT003272 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 3 2
MIRT003273 SNAI2 snail homolog 2 (Drosophila) 3 2
MIRT003546 MEIS2 Meis homeobox 2 3 1
MIRT004651 SNAI1 snail homolog 1 (Drosophila) 2 1
MIRT005337 SPDEF SAM pointed domain containing ets transcription factor 3 1
MIRT005524 THRB thyroid hormone receptor, beta 4 1
MIRT005784 CDX2 caudal type homeobox 2 1 1
MIRT005814 AKAP1 A kinase (PRKA) anchor protein 1 1 1
MIRT005815 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT005816 AP1S2 adaptor-related protein complex 1, sigma 2 subunit 4 2
MIRT005817 ARHGAP29 Rho GTPase activating protein 29 1 1
MIRT005818 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 2 2
MIRT005819 BCL2L2 BCL2-like 2 4 1
MIRT005820 BIRC2 baculoviral IAP repeat containing 2 4 1
MIRT005821 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT005822 COL5A3 collagen, type V, alpha 3 1 1
MIRT005823 CXCL3 chemokine (C-X-C motif) ligand 3 1 1
MIRT005824 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 3 1
MIRT005825 EZR ezrin 4 2
MIRT005826 FARP1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) 1 1
MIRT005827 FZD1 frizzled family receptor 1 3 1
MIRT005828 HAS2 hyaluronan synthase 2 1 1
MIRT005829 IL11 interleukin 11 2 2
MIRT005830 IL1B interleukin 1, beta 1 1
MIRT005831 IL1RAP interleukin 1 receptor accessory protein 1 1
MIRT005832 IL8 interleukin 8 1 1
MIRT005833 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT005834 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT005835 M6PR mannose-6-phosphate receptor (cation dependent) 4 1
MIRT005836 MAPRE2 microtubule-associated protein, RP/EB family, member 2 1 1
MIRT005837 MYOC myocilin, trabecular meshwork inducible glucocorticoid response 1 1
MIRT005838 PLAT plasminogen activator, tissue 1 1
MIRT005839 PLAUR plasminogen activator, urokinase receptor 1 1
MIRT005840 RAB22A RAB22A, member RAS oncogene family 4 3
MIRT005841 RAB40B RAB40B, member RAS oncogene family 4 2
MIRT005842 SERINC3 serine incorporator 3 3 1
MIRT005843 SERP1 stress-associated endoplasmic reticulum protein 1 4 1
MIRT005844 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT005845 TCF12 transcription factor 12 4 2
MIRT005846 TCF4 transcription factor 4 3 1
MIRT006344 FOXC1 forkhead box C1 3 2
MIRT006449 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 2 1
MIRT006460 CREB5 cAMP responsive element binding protein 5 3 1
MIRT006461 ELOVL6 ELOVL fatty acid elongase 6 3 1
MIRT006895 RUNX2 runt-related transcription factor 2 3 1
MIRT007100 SOX4 SRY (sex determining region Y)-box 4 4 3
MIRT007101 EFNB2 ephrin-B2 3 1
MIRT007116 ALPL alkaline phosphatase, liver/bone/kidney 1 1
MIRT007117 SOST sclerostin 1 1
MIRT024972 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 1 1
MIRT024973 AURKB aurora kinase B 1 1
MIRT024974 CDC25B cell division cycle 25 homolog B (S. pombe) 1 1
MIRT024975 ARPC1B actin related protein 2/3 complex, subunit 1B, 41kDa 1 1
MIRT024976 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT024977 HMGA2 high mobility group AT-hook 2 1 1
MIRT024978 FBN2 fibrillin 2 1 1
MIRT024979 ERF Ets2 repressor factor 1 1
MIRT024980 EFNB1 ephrin-B1 1 1
MIRT024981 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) 1 1
MIRT024982 CTSC cathepsin C 1 1
MIRT024983 CDH11 cadherin 11, type 2, OB-cadherin (osteoblast) 1 1
MIRT024984 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 1 1
MIRT024985 ITGB4 integrin, beta 4 1 1
MIRT024986 HOXB7 homeobox B7 1 1
MIRT024987 BMP1 bone morphogenetic protein 1 1 1
MIRT047009 BPTF bromodomain PHD finger transcription factor 1 1
MIRT047010 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT047011 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT047012 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT047013 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT047014 RPLP1 ribosomal protein, large, P1 1 1
MIRT047015 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT047016 CCNT2 cyclin T2 1 1
MIRT047017 IPO7 importin 7 1 1
MIRT047018 TEC transient erythroblastopenia of childhood 1 1
MIRT047019 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT047020 HACL1 2-hydroxyacyl-CoA lyase 1 1 1
MIRT047021 ENO1 enolase 1, (alpha) 1 1
MIRT047022 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT047023 BRD2 bromodomain containing 2 1 1
MIRT047024 HIST2H4B histone cluster 2, H4b 1 1
MIRT047025 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT047026 RPL3 ribosomal protein L3 1 1
MIRT047027 BEX2 brain expressed X-linked 2 1 1
MIRT053029 SMAD4 SMAD family member 4 2 1
MIRT053127 SIRT1 sirtuin 1 3 1
MIRT053186 NTRK2 neurotrophic tyrosine kinase, receptor, type 2 3 2
MIRT054194 USP47 ubiquitin specific peptidase 47 3 1
MIRT054350 ANKRD13A ankyrin repeat domain 13A 3 1
MIRT054636 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 1
MIRT054791 TMPRSS3 transmembrane protease, serine 3 3 1
MIRT054864 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 3 1
MIRT054865 VIM vimentin 3 1
MIRT057024 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT084443 SOWAHC sosondowah ankyrin repeat domain family member C 1 1
MIRT095328 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT107788 SLC1A1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 1 1
MIRT130078 TXNIP thioredoxin interacting protein 1 1
MIRT162735 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 2 1
MIRT167968 ATXN1 ataxin 1 1 1
MIRT185714 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT198272 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 1 1
MIRT248292 HOXC8 homeobox C8 1 2
MIRT280117 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT343780 PHF13 PHD finger protein 13 1 1
MIRT437447 BDNF brain-derived neurotrophic factor 3 1
MIRT438340 TRPM3 transient receptor potential cation channel, subfamily M, member 3 2 1
MIRT438387 SIX1 SIX homeobox 1 2 1
MIRT438706 HMX1 H6 family homeobox 1 3 1
MIRT438783 MAP2K1 mitogen-activated protein kinase kinase 1 2 1
MIRT444934 CACNA1C calcium channel, voltage-dependent, L type, alpha 1C subunit 1 1
MIRT446104 TSC22D2 TSC22 domain family, member 2 1 1
MIRT448696 LIPC lipase, hepatic 1 1
MIRT451889 SOD2 superoxide dismutase 2, mitochondrial 1 2
MIRT469641 RACGAP1 Rac GTPase activating protein 1 1 4
MIRT483171 PLCXD3 phosphatidylinositol-specific phospholipase C, X domain containing 3 1 2
MIRT486361 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 2
MIRT487494 IL1F10 interleukin 1 family, member 10 (theta) 1 2
MIRT489335 BCAN brevican 1 4
MIRT489589 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT497081 TLK2 tousled-like kinase 2 1 1
MIRT497312 TMEFF2 transmembrane protein with EGF-like and two follistatin-like domains 2 1 1
MIRT497628 ZNF576 zinc finger protein 576 1 1
MIRT504153 OPN5 opsin 5 1 2
MIRT504461 EID2B EP300 interacting inhibitor of differentiation 2B 1 1
MIRT512991 SEZ6L seizure related 6 homolog (mouse)-like 1 2
MIRT513814 MTA3 metastasis associated 1 family, member 3 1 1
MIRT520548 TPPP tubulin polymerization promoting protein 1 4
MIRT521793 POU2F2 POU class 2 homeobox 2 1 1
MIRT526374 LSAMP limbic system-associated membrane protein 1 1
MIRT526585 CCDC43 coiled-coil domain containing 43 1 1
MIRT531116 ZYG11B zyg-11 homolog B (C. elegans) 1 1
MIRT532253 TBPL2 TATA box binding protein like 2 1 1
MIRT533010 ZFHX3 zinc finger homeobox 3 1 1
MIRT536709 IKZF2 IKAROS family zinc finger 2 (Helios) 1 2
MIRT539418 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT546867 RAB10 RAB10, member RAS oncogene family 1 2
MIRT556123 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT562146 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT567133 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT569807 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT570337 VAV3 vav 3 guanine nucleotide exchange factor 1 4
MIRT609200 CDH8 cadherin 8, type 2 1 1
MIRT609832 ZBTB22 zinc finger and BTB domain containing 22 1 1
MIRT611459 ZWILCH Zwilch, kinetochore associated, homolog (Drosophila) 1 1
MIRT611808 FCRL4 Fc receptor-like 4 1 1
MIRT612418 SP1 Sp1 transcription factor 1 1
MIRT612506 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT613280 BRD4 bromodomain containing 4 1 1
MIRT613767 TTC38 tetratricopeptide repeat domain 38 1 1
MIRT613806 ATP6AP1L ATPase, H+ transporting, lysosomal accessory protein 1-like 1 1
MIRT614152 CEP97 centrosomal protein 97kDa 1 2
MIRT615114 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT615191 CLUAP1 clusterin associated protein 1 1 1
MIRT615213 ARSE arylsulfatase E (chondrodysplasia punctata 1) 1 1
MIRT615255 DPF2 D4, zinc and double PHD fingers family 2 1 1
MIRT615985 FSTL4 follistatin-like 4 1 1
MIRT616717 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT616907 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT617031 SYT6 synaptotagmin VI 1 1
MIRT617069 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT617165 SLC16A5 solute carrier family 16, member 5 (monocarboxylic acid transporter 6) 1 1
MIRT617324 DPF3 D4, zinc and double PHD fingers, family 3 1 1
MIRT617363 C21orf62 chromosome 21 open reading frame 62 1 1
MIRT617472 AP5B1 adaptor-related protein complex 5, beta 1 subunit 1 1
MIRT618151 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 1 1
MIRT618425 DNAJC30 DnaJ (Hsp40) homolog, subfamily C, member 30 1 1
MIRT618590 TMEM156 transmembrane protein 156 1 1
MIRT618668 RPP40 ribonuclease P/MRP 40kDa subunit 1 1
MIRT618806 HLA-DRB5 major histocompatibility complex, class II, DR beta 5 1 1
MIRT618849 A1CF APOBEC1 complementation factor 1 1
MIRT619603 MKKS McKusick-Kaufman syndrome 1 1
MIRT619801 CDC42EP4 CDC42 effector protein (Rho GTPase binding) 4 1 1
MIRT619979 ZSCAN22 zinc finger and SCAN domain containing 22 1 1
MIRT620000 C1orf64 chromosome 1 open reading frame 64 1 1
MIRT620043 ODF4 outer dense fiber of sperm tails 4 1 1
MIRT620223 VN1R1 vomeronasal 1 receptor 1 1 1
MIRT620590 GALNT10 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) 1 1
MIRT621144 RNF122 ring finger protein 122 1 1
MIRT621383 CLNK cytokine-dependent hematopoietic cell linker 1 1
MIRT622219 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT622356 SAMD5 sterile alpha motif domain containing 5 1 1
MIRT622865 PDF peptide deformylase (mitochondrial) 1 1
MIRT623050 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT623490 KCTD11 potassium channel tetramerisation domain containing 11 1 1
MIRT623661 HRK harakiri, BCL2 interacting protein (contains only BH3 domain) 1 1
MIRT623732 GTDC1 glycosyltransferase-like domain containing 1 1 1
MIRT623838 GAN gigaxonin 1 1
MIRT623853 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT624097 DNAJC16 DnaJ (Hsp40) homolog, subfamily C, member 16 1 1
MIRT624382 CDH4 cadherin 4, type 1, R-cadherin (retinal) 1 1
MIRT624480 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT624683 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT624757 ANGPTL2 angiopoietin-like 2 1 1
MIRT624864 ABHD15 abhydrolase domain containing 15 1 1
MIRT625843 PAQR7 progestin and adipoQ receptor family member VII 1 1
MIRT626403 BID BH3 interacting domain death agonist 1 1
MIRT626949 PRDM2 PR domain containing 2, with ZNF domain 1 1
MIRT627373 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT627557 SMAD6 SMAD family member 6 1 1
MIRT627606 SFT2D2 SFT2 domain containing 2 1 1
MIRT628245 ETF1 eukaryotic translation termination factor 1 1 1
MIRT630665 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT631539 AS3MT arsenic (+3 oxidation state) methyltransferase 1 1
MIRT632077 ALDH1A2 aldehyde dehydrogenase 1 family, member A2 1 1
MIRT632192 ZKSCAN4 zinc finger with KRAB and SCAN domains 4 1 1
MIRT635072 MICA MHC class I polypeptide-related sequence A 1 1
MIRT636432 MARCH1 membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase 1 1
MIRT636591 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT638422 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT638756 EPHA4 EPH receptor A4 1 1
MIRT638969 ARHGAP6 Rho GTPase activating protein 6 1 1
MIRT639064 NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 1 1
MIRT639169 SHOX2 short stature homeobox 2 1 1
MIRT639560 TMTC2 transmembrane and tetratricopeptide repeat containing 2 1 1
MIRT639761 GPR45 G protein-coupled receptor 45 1 1
MIRT639841 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT640773 GLP1R glucagon-like peptide 1 receptor 1 1
MIRT640840 CHRDL1 chordin-like 1 1 1
MIRT640922 POU2F1 POU class 2 homeobox 1 1 1
MIRT641313 ATXN7 ataxin 7 1 1
MIRT641338 CCR5 chemokine (C-C motif) receptor 5 (gene/pseudogene) 1 1
MIRT641470 B4GALNT3 beta-1,4-N-acetyl-galactosaminyl transferase 3 1 1
MIRT641505 STC2 stanniocalcin 2 1 1
MIRT641627 KIAA1244 KIAA1244 1 1
MIRT641843 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT642148 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT642184 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT642781 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 1 1
MIRT642877 SAMD1 sterile alpha motif domain containing 1 1 1
MIRT642907 KIAA0754 KIAA0754 1 1
MIRT642950 XRRA1 X-ray radiation resistance associated 1 1 1
MIRT643293 PHKG1 phosphorylase kinase, gamma 1 (muscle) 1 1
MIRT643659 MYOCD myocardin 1 1
MIRT643805 ABCC12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 1 1
MIRT644042 WWC2 WW and C2 domain containing 2 1 1
MIRT644058 IQCE IQ motif containing E 1 1
MIRT644148 C4orf3 chromosome 4 open reading frame 3 1 1
MIRT644464 ZNF747 zinc finger protein 747 1 1
MIRT644583 SPOP speckle-type POZ protein 1 1
MIRT644654 SNX9 sorting nexin 9 1 1
MIRT644962 STEAP4 STEAP family member 4 1 1
MIRT645023 MAGEB4 melanoma antigen family B, 4 1 1
MIRT645357 SPNS1 spinster homolog 1 (Drosophila) 1 1
MIRT645433 ATF6B activating transcription factor 6 beta 1 1
MIRT645828 INADL InaD-like (Drosophila) 1 1
MIRT646199 DUSP10 dual specificity phosphatase 10 1 1
MIRT646249 PRSS38 protease, serine, 38 1 1
MIRT646286 SH3BP5L SH3-binding domain protein 5-like 1 1
MIRT646348 CPT1B carnitine palmitoyltransferase 1B (muscle) 1 1
MIRT646389 SLC22A6 solute carrier family 22 (organic anion transporter), member 6 1 1
MIRT646405 HLA-DRB1 major histocompatibility complex, class II, DR beta 1 1 1
MIRT646450 ZNF705A zinc finger protein 705A 1 1
MIRT646525 ELP2 elongator acetyltransferase complex subunit 2 1 2
MIRT646745 MUC4 mucin 4, cell surface associated 1 1
MIRT646765 WDR3 WD repeat domain 3 1 1
MIRT646889 C6orf132 chromosome 6 open reading frame 132 1 1
MIRT647180 ANKRD45 ankyrin repeat domain 45 1 1
MIRT647672 HTR1F 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled 1 1
MIRT647958 FBXO31 F-box protein 31 1 1
MIRT648220 TM4SF20 transmembrane 4 L six family member 20 1 1
MIRT648241 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT648255 GP2 glycoprotein 2 (zymogen granule membrane) 1 1
MIRT648388 ZNF22 zinc finger protein 22 1 1
MIRT648774 KLHL40 kelch repeat and BTB (POZ) domain containing 5 1 1
MIRT648806 ZNF689 zinc finger protein 689 1 1
MIRT649275 C17orf64 chromosome 17 open reading frame 64 1 1
MIRT649355 SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 1 1
MIRT649398 SH2D4A SH2 domain containing 4A 1 1
MIRT649526 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT649770 MRPS27 mitochondrial ribosomal protein S27 1 2
MIRT650427 BBS9 Bardet-Biedl syndrome 9 1 1
MIRT650772 POP4 processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT650842 SEMA4G sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G 1 1
MIRT650856 UNC13D unc-13 homolog D (C. elegans) 1 1
MIRT650915 VASH1 vasohibin 1 1 1
MIRT651125 ZNF48 zinc finger protein 48 1 1
MIRT651132 ZNF398 zinc finger protein 398 1 1
MIRT651162 ZNF362 zinc finger protein 362 1 1
MIRT651482 WWC3 WWC family member 3 1 1
MIRT651555 WISP1 WNT1 inducible signaling pathway protein 1 1 1
MIRT651768 VASP vasodilator-stimulated phosphoprotein 1 1
MIRT651901 UFD1L ubiquitin fusion degradation 1 like (yeast) 1 1
MIRT651975 UBE2J1 ubiquitin-conjugating enzyme E2, J1 1 1
MIRT652065 TTC39B tetratricopeptide repeat domain 39B 1 1
MIRT652446 TMEM236 transmembrane protein 236 1 1
MIRT652685 TIAF1 TGFB1-induced anti-apoptotic factor 1 1 1
MIRT652933 SYNGR1 synaptogyrin 1 1 1
MIRT652953 SYAP1 synapse associated protein 1 1 1
MIRT653148 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT653233 SOS2 son of sevenless homolog 2 (Drosophila) 1 1
MIRT653324 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT653496 SLC43A2 solute carrier family 43, member 2 1 1
MIRT653554 SLC38A7 solute carrier family 38, member 7 1 1
MIRT653914 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT654163 RORB RAR-related orphan receptor B 1 1
MIRT654178 RNMTL1 RNA methyltransferase like 1 1 1
MIRT654341 RBM27 RNA binding motif protein 27 1 1
MIRT654514 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT654555 RAB14 RAB14, member RAS oncogene family 1 1
MIRT654559 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT654604 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT654821 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT654833 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT654994 PLCG1 phospholipase C, gamma 1 1 1
MIRT655093 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 1 1
MIRT655433 PALM2-AKAP2 PALM2-AKAP2 readthrough 1 1
MIRT655543 PADI2 peptidyl arginine deiminase, type II 1 2
MIRT655620 ONECUT3 one cut homeobox 3 1 1
MIRT655764 NPTX1 neuronal pentraxin I 1 1
MIRT655823 NOTCH1 notch 1 1 1
MIRT655846 NGDN neuroguidin, EIF4E binding protein 1 1
MIRT655992 MYRF chromosome 11 open reading frame 9 1 1
MIRT656048 MYLK4 myosin light chain kinase family, member 4 1 1
MIRT656251 MEX3A mex-3 homolog A (C. elegans) 1 1
MIRT656309 MESDC1 mesoderm development candidate 1 1 1
MIRT656363 MDFI MyoD family inhibitor 1 2
MIRT656410 MCTP1 multiple C2 domains, transmembrane 1 1 1
MIRT656609 LRRC55 leucine rich repeat containing 55 1 1
MIRT656795 KNTC1 kinetochore associated 1 1 1
MIRT656929 KIAA1462 KIAA1462 1 1
MIRT656955 KIAA1324L KIAA1324-like 1 1
MIRT657358 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT657486 HCAR2 hydroxycarboxylic acid receptor 2 1 1
MIRT658024 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT658121 FNBP1L formin binding protein 1-like 1 1
MIRT658264 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT658332 FAM83F family with sequence similarity 83, member F 1 1
MIRT658439 FAM167B family with sequence similarity 167, member B 1 1
MIRT658623 ENAH enabled homolog (Drosophila) 1 1
MIRT658827 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT658969 DNAJB5 DnaJ (Hsp40) homolog, subfamily B, member 5 1 2
MIRT659099 DENR density-regulated protein 1 1
MIRT659684 CD28 CD28 molecule 1 1
MIRT659711 CCDC93 coiled-coil domain containing 93 1 1
MIRT659862 CAPRIN1 cell cycle associated protein 1 1 1
MIRT659902 CAMK2G calcium/calmodulin-dependent protein kinase II gamma 1 1
MIRT659934 CACHD1 cache domain containing 1 1 1
MIRT660059 C12orf5 chromosome 12 open reading frame 5 1 1
MIRT660082 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT660230 BMPR1A bone morphogenetic protein receptor, type IA 1 1
MIRT660285 BLOC1S5 biogenesis of lysosomal organelles complex-1, subunit 5, muted 1 1
MIRT660362 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 1 1
MIRT660684 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT660701 AMOTL2 angiomotin like 2 1 1
MIRT660769 ALDH6A1 aldehyde dehydrogenase 6 family, member A1 1 1
MIRT660778 AKAP2 A kinase (PRKA) anchor protein 2 1 1
MIRT660849 AFF4 AF4/FMR2 family, member 4 1 1
MIRT660888 ADCYAP1R1 adenylate cyclase activating polypeptide 1 (pituitary) receptor type I 1 1
MIRT661631 UGT2B28 UDP glucuronosyltransferase 2 family, polypeptide B28 1 1
MIRT661657 ZNF623 zinc finger protein 623 1 1
MIRT662216 CCRL2 chemokine (C-C motif) receptor-like 2 1 1
MIRT662353 AKAP13 A kinase (PRKA) anchor protein 13 1 2
MIRT662469 SERPINF2 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 1 1
MIRT663297 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT664820 NOX5 NADPH oxidase, EF-hand calcium binding domain 5 1 1
MIRT666018 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT666035 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT666217 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT666431 SH2B3 SH2B adaptor protein 3 1 1
MIRT666806 PRLR prolactin receptor 1 1
MIRT667320 MYO18A myosin XVIIIA 1 1
MIRT668001 HCFC2 host cell factor C2 1 1
MIRT668237 FZD8 frizzled family receptor 8 1 1
MIRT669585 AK2 adenylate kinase 2 1 1
MIRT683214 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT683219 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT703849 ETV3 ets variant 3 1 1
MIRT707109 C11orf74 chromosome 11 open reading frame 74 1 1
MIRT708672 LY6G6D lymphocyte antigen 6 complex, locus G6D 1 1
MIRT709771 LY6G6F lymphocyte antigen 6 complex, locus G6F 1 1
MIRT712685 NUDT7 nudix (nucleoside diphosphate linked moiety X)-type motif 7 1 1
MIRT713624 MED8 mediator complex subunit 8 1 1
MIRT713975 ASIC4 acid-sensing (proton-gated) ion channel family member 4 1 1
MIRT714746 ZNF385D zinc finger protein 385D 1 1
MIRT715044 NUPL2 nucleoporin like 2 1 1
MIRT715238 DHODH dihydroorotate dehydrogenase (quinone) 1 1
MIRT715629 ZBTB8B zinc finger and BTB domain containing 8B 1 1
MIRT716094 HARS histidyl-tRNA synthetase 1 1
MIRT716156 RBM48 RNA binding motif protein 48 1 1
MIRT717452 ADORA3 adenosine A3 receptor 1 1
MIRT718176 HLCS holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) 1 1
MIRT719258 CD44 CD44 molecule (Indian blood group) 1 1
MIRT719819 LRRC4 leucine rich repeat containing 4 1 1
MIRT720869 ADCY5 adenylate cyclase 5 1 1
MIRT720971 ZBTB43 zinc finger and BTB domain containing 43 1 1
MIRT722165 MRPS15 mitochondrial ribosomal protein S15 1 1
MIRT722273 LURAP1 leucine rich adaptor protein 1 1 1
MIRT722371 SEC31B SEC31 homolog B (S. cerevisiae) 1 1
MIRT724363 ASGR1 asialoglycoprotein receptor 1 1 1
MIRT725064 ZCCHC24 zinc finger, CCHC domain containing 24 1 1
MIRT725152 SLC43A1 solute carrier family 43, member 1 1 1
MIRT725295 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*