Accession ID: MIRT000204 [miRNA, hsa-miR-200a-3p :: DLX5, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200aLinkOut: [miRBase ]
Description Homo sapiens miR-200a stem-loop
Comment miR-200a was cloned from mouse kidney tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200a-3p
Mature Sequence 54| UAACACUGUCUGGUAACGAUGU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-200a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DLX5 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms SHFM1D
Description distal-less homeobox 5
Transcript NM_005221    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DLX5 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DLX5
(miRNA target sites are highlighted)
>DLX5|NM_005221|3'UTR
   1 ATGGGCTGCTCTCTCTTACTCTCTTTTTTGGGACTACTGTGTTTTGCTGTTCTAGAAAATCATAAAGAAAGGAATTCATA
  81 TGGGGAAGTTCGGAAAACTGAAAAAGATTCATGTGTAAAGCTTTTTTTTGCATGTAAGTTATTGCATTTCAAAAGACCCC
 161 CCCTTTTTTTACAGAGGACTTTTTTTGCGCAACTGTGGACACTTTCAATGGTGCCTTGAAATCTATGACCTCAACTTTTC
 241 AAAAGACTTTTTTCAATGTTATTTTAGCCATGTAAATAAGTGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAA
 321 AATTATTTCGACCATGAAAAGCGGAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguAGCAAUGGUC----UGUCACAAu 5'
             || || :::|    || ||||| 
Target 5' ctcTCTTTTTTGGGACTACTGTGTTt 3'
19 - 44 121.00 -7.70
2
miRNA  3' uguagcaauggucugUCACAau 5'
                         |||||  
Target 5' ttagccatgtaaataAGTGTag 3'
264 - 285 100.00 -5.40
3
miRNA  3' uguaGCAAUGGUCUGUCacaau 5'
              | || ::  ||||     
Target 5' ccccCCTTTTTTTACAGaggac 3'
158 - 179 70.00 -6.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: DLX5    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Itoh, T. Nozawa, Y. Akao, Y.
- J Biol Chem, 2009
MicroRNAs (miRs) are endogenously expressed 18-25-nucleotide RNAs that regulate gene expression through translational repression by binding to a target mRNA. Recently, it was indicated that miRs act as key regulators in cell differentiation, cell growth, and cell death. In osteogenesis, several miRs (for example miR-26a, -125b, -133, and -135) regulate osteoblast cell growth or differentiation in human adipose tissue-derived stem cells, mouse mesenchymal ST2 stem cells, and mouse premyogenic C2C12 cells. Additionally, Smad proteins control Drosha-mediated miR maturation. Therefore, miRs are closely related to osteogenesis. Here we investigated miR expression profile by an miR array and identified the candidate miRs, miR-141 and -200a, as pre-osteoblast differentiation-related miRs. The effects of miR-141 and -200a on pre-osteoblast differentiation were examined by using transfection of murine pre-osteoblastic MC3T3-E1 cells with mature miR-141 or -200a and antisense inhibitor for miR-141 or -200a. It was shown that miR-141 and -200a remarkably modulated the BMP-2-induced pre-osteoblast differentiation through the translational repression of Dlx5, which is a bone-generating transcription factor expressed in pre-osteoblast differentiation. Furthermore, it was indicated that Dlx5 is a common target of miR-141 and -200a by using a luciferase reporter assay. Thus, we have observed for the first time that miR-141 and -200a are involved in pre-osteoblast differentiation in part by regulating the expression of Dlx5.
LinkOut: [PMID: 19454767]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
128 hsa-miR-200a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000204 DLX5 distal-less homeobox 5 2 1
MIRT000730 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT000772 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 2 1
MIRT000773 PCDH8 protocadherin 8 2 1
MIRT000774 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001035 ZEB2 zinc finger E-box binding homeobox 2 5 20
MIRT001175 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 4 3
MIRT002480 ZEB1 zinc finger E-box binding homeobox 1 5 13
MIRT002481 SIP1 gem (nuclear organelle) associated protein 2 2 2
MIRT003140 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003141 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT004005 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT004006 GATA6 GATA binding protein 6 3 2
MIRT004007 VCAM1 vascular cell adhesion molecule 1 2 1
MIRT004400 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 2 1
MIRT004524 WASF3 WAS protein family, member 3 2 1
MIRT004549 TFRC transferrin receptor (p90, CD71) 1 1
MIRT004622 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004867 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005752 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT006423 MAPK14 mitogen-activated protein kinase 14 4 2
MIRT006665 CCNE2 cyclin E2 1 1
MIRT006704 KEAP1 kelch-like ECH-associated protein 1 3 1
MIRT006834 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT007290 SMAD2 SMAD family member 2 1 1
MIRT007291 SMAD3 SMAD family member 3 1 1
MIRT007299 YAP1 Yes-associated protein 1 1 1
MIRT020343 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT020345 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT020346 ELMO2 engulfment and cell motility 2 2 1
MIRT020347 ERBB2IP erbb2 interacting protein 2 1
MIRT020348 WDR37 WD repeat domain 37 2 1
MIRT020349 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT020350 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT020351 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT020352 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT020353 RIN2 Ras and Rab interactor 2 1 1
MIRT020354 HOXB5 homeobox B5 1 1
MIRT020355 SEPT7 septin 7 1 1
MIRT020356 KLF11 Kruppel-like factor 11 1 1
MIRT052922 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 1
MIRT053166 TFAM transcription factor A, mitochondrial 2 1
MIRT053353 UBASH3B ubiquitin associated and SH3 domain containing B 4 1
MIRT053604 TP53 tumor protein p53 2 1
MIRT054264 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT054265 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT054371 PTEN phosphatase and tensin homolog 3 2
MIRT054542 HFE hemochromatosis 2 1
MIRT054545 DLC1 deleted in liver cancer 1 2 1
MIRT054553 ATRX alpha thalassemia/mental retardation syndrome X-linked 2 1
MIRT061758 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT072481 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT078341 MED13 mediator complex subunit 13 1 1
MIRT099340 QKI QKI, KH domain containing, RNA binding 1 1
MIRT117486 ADNP2 ADNP homeobox 2 1 1
MIRT126445 ARL5B ADP-ribosylation factor-like 5B 1 5
MIRT127537 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT135564 SPRYD4 SPRY domain containing 4 1 1
MIRT176071 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT176153 PGK1 phosphoglycerate kinase 1 1 1
MIRT227601 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT313184 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT368862 IPO5 importin 5 1 1
MIRT437873 AREG amphiregulin 4 1
MIRT438100 GRB2 growth factor receptor-bound protein 2 1 1
MIRT438675 CDK6 cyclin-dependent kinase 6 3 1
MIRT441429 STXBP2 syntaxin binding protein 2 1 1
MIRT441732 SEPT8 septin 8 1 1
MIRT442158 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT443389 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT447629 NDST4 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4 1 1
MIRT452254 TRAM1 translocation associated membrane protein 1 1 1
MIRT455748 YRDC yrdC domain containing (E. coli) 1 6
MIRT470195 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT473463 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT478508 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT488715 BICD2 bicaudal D homolog 2 (Drosophila) 1 2
MIRT498345 PRELID2 PRELI domain containing 2 1 1
MIRT500583 USP53 ubiquitin specific peptidase 53 1 1
MIRT502259 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 2
MIRT502310 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT502449 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 2
MIRT502530 EPHA2 EPH receptor A2 1 2
MIRT503111 BRD3 bromodomain containing 3 1 1
MIRT505323 TMOD3 tropomodulin 3 (ubiquitous) 1 2
MIRT506628 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506861 KIAA1147 KIAA1147 1 1
MIRT519589 ZNF805 zinc finger protein 805 1 2
MIRT519813 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT529418 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT536478 KIAA1549 KIAA1549 1 1
MIRT537735 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT539039 ATXN7L1 ataxin 7-like 1 1 1
MIRT547112 PIGW phosphatidylinositol glycan anchor biosynthesis, class W 1 1
MIRT548308 EPHA7 EPH receptor A7 1 1
MIRT549102 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT554194 SLC35D1 solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 1 1
MIRT555677 PGAM4 phosphoglycerate mutase family member 4 1 1
MIRT557413 H2AFZ H2A histone family, member Z 1 2
MIRT559958 TRMT112 tRNA methyltransferase 11-2 homolog (S. cerevisiae) 1 1
MIRT564938 XPOT exportin, tRNA 1 1
MIRT568097 CDV3 CDV3 homolog (mouse) 1 1
MIRT573383 KIAA1549L KIAA1549-like 1 1
MIRT614582 LHX1 LIM homeobox 1 1 1
MIRT632224 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT634842 APOOL apolipoprotein O-like 1 1
MIRT639525 ZNF621 zinc finger protein 621 1 1
MIRT645300 ANGPTL7 angiopoietin-like 7 1 1
MIRT654775 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT656541 MACC1 metastasis associated in colon cancer 1 1 1
MIRT663684 CCDC18 coiled-coil domain containing 18 1 1
MIRT682853 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT682940 ZNF292 zinc finger protein 292 1 1
MIRT682959 RPL12 ribosomal protein L12 1 1
MIRT683087 A1BG alpha-1-B glycoprotein 1 1
MIRT692251 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT696502 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT696748 RBM28 RNA binding motif protein 28 1 1
MIRT702209 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT708614 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT709036 TROVE2 TROVE domain family, member 2 1 1
MIRT710918 GLTSCR1L KIAA0240 1 1
MIRT713191 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT714497 HSPA4 heat shock 70kDa protein 4 1 1
MIRT718596 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT723110 CLDND1 claudin domain containing 1 1 1
MIRT723914 PEX11A peroxisomal biogenesis factor 11 alpha 1 1
MIRT725579 CELF1 CUGBP, Elav-like family member 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*