Accession ID: MIRT000204 [miRNA, hsa-miR-200a-3p :: DLX5, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200aLinkOut: [miRBase ]
Description Homo sapiens miR-200a stem-loop
Comment miR-200a was cloned from mouse kidney tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200a-3p
Mature Sequence 54| UAACACUGUCUGGUAACGAUGU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-200a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DLX5 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description distal-less homeobox 5
Transcript NM_0052    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DLX5 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DLX5
(miRNA target sites are highlighted)
>DLX5|NM_0052|3'UTR
   1 TAGATGGGCTGCTCTCTCTTACTCTCTTTTTTGGGACTACTGTGTTTTGCTGTTCTAGAAAATCATAAAGAAAGGAATTC
  81 ATATGGGGAAGTTCGGAAAACTGAAAAAGATTCATGTGTAAAGCTTTTTTTTGCATGTAAGTTATTGCATTTCAAAAGAC
 161 CCCCCCTTTTTTTACAGAGGACTTTTTTTGCGCAACTGTGGACACTTTCAATGGTGCCTTGAAATCTATGACCTCAACTT
 241 TTCAAAAGACTTTTTTCAATGTTATTTTAGCCATGTAAATAAGTGTAGATAGAGGAATTAAACTGTATATTCTGGATAAA
 321 TAAAATTATTTCGACCATGAAAAGCGGAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguAGCAAUGGUC----UGUCACAAu 5'
             || || :::|    || ||||| 
Target 5' ctcTCTTTTTTGGGACTACTGTGTTt 3'
22 - 47 121.00 -7.70
2
miRNA  3' uguagcaauggucugUCACAau 5'
                         |||||  
Target 5' ttagccatgtaaataAGTGTag 3'
267 - 288 100.00 -5.40
3
miRNA  3' uguaGCAAUGGUCUGUCacaau 5'
              | || ::  ||||     
Target 5' ccccCCTTTTTTTACAGaggac 3'
161 - 182 70.00 -6.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: DLX5    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Itoh, T. Nozawa, Y. Akao, Y.
- J Biol Chem, 2009
MicroRNAs (miRs) are endogenously expressed 18-25-nucleotide RNAs that regulate gene expression through translational repression by binding to a target mRNA. Recently, it was indicated that miRs act as key regulators in cell differentiation, cell growth, and cell death. In osteogenesis, several miRs (for example miR-26a, -125b, -133, and -135) regulate osteoblast cell growth or differentiation in human adipose tissue-derived stem cells, mouse mesenchymal ST2 stem cells, and mouse premyogenic C2C12 cells. Additionally, Smad proteins control Drosha-mediated miR maturation. Therefore, miRs are closely related to osteogenesis. Here we investigated miR expression profile by an miR array and identified the candidate miRs, miR-141 and -200a, as pre-osteoblast differentiation-related miRs. The effects of miR-141 and -200a on pre-osteoblast differentiation were examined by using transfection of murine pre-osteoblastic MC3T3-E1 cells with mature miR-141 or -200a and antisense inhibitor for miR-141 or -200a. It was shown that miR-141 and -200a remarkably modulated the BMP-2-induced pre-osteoblast differentiation through the translational repression of Dlx5, which is a bone-generating transcription factor expressed in pre-osteoblast differentiation. Furthermore, it was indicated that Dlx5 is a common target of miR-141 and -200a by using a luciferase reporter assay. Thus, we have observed for the first time that miR-141 and -200a are involved in pre-osteoblast differentiation in part by regulating the expression of Dlx5.
LinkOut: [PMID: 19454767]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
40 hsa-miR-200a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000204 DLX5 distal-less homeobox 5 2 1
MIRT000730 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT000772 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 2 1
MIRT000773 PCDH8 protocadherin 8 2 1
MIRT000774 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001035 ZEB2 zinc finger E-box binding homeobox 2 5 14
MIRT001175 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 4 2
MIRT002480 ZEB1 zinc finger E-box binding homeobox 1 5 11
MIRT002481 SIP1 survival of motor neuron protein interacting protein 1 2 2
MIRT003140 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003141 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT004005 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT004006 GATA6 GATA binding protein 6 2 1
MIRT004007 VCAM1 vascular cell adhesion molecule 1 2 1
MIRT004400 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 2 1
MIRT004524 WASF3 WAS protein family, member 3 2 1
MIRT004549 TFRC transferrin receptor (p90, CD71) 1 1
MIRT004622 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004867 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005752 GDAP1 ganglioside-induced differentiation-associated protein 1 3 1
MIRT006423 MAPK14 mitogen-activated protein kinase 14 3 1
MIRT006665 CCNE2 cyclin E2 1 1
MIRT006704 KEAP1 kelch-like ECH-associated protein 1 3 1
MIRT006834 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT007290 SMAD2 SMAD family member 2 1 1
MIRT007291 SMAD3 SMAD family member 3 1 1
MIRT007299 YAP1 Yes-associated protein 1 1 1
MIRT020343 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT020345 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT020346 ELMO2 engulfment and cell motility 2 2 1
MIRT020347 ERBB2IP erbb2 interacting protein 2 1
MIRT020348 WDR37 WD repeat domain 37 2 1
MIRT020349 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT020350 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT020351 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT020352 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT020353 RIN2 Ras and Rab interactor 2 1 1
MIRT020354 HOXB5 homeobox B5 1 1
MIRT020355 SEPT7 septin 7 1 1
MIRT020356 KLF11 Kruppel-like factor 11 1 1