Accession ID: MIRT000234 [miRNA, hsa-miR-181c-5p :: GATA6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-181cLinkOut: [miRBase ]
Synonyms MIRN181C, mir-181c, MIR181C
Description Homo sapiens miR-181c stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-181c-5p
Mature Sequence 27| AACAUUCAACCUGUCGGUGAGU |48
Evidence Experimental
Experiments Cloned
Putative hsa-miR-181c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-181c-5p :: GATA6    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Ji, J. Yamashita, T. Budhu, A. Forgues, M. et al.
- Hepatology, 2009
MicroRNAs (miRNAs) are endogenous small noncoding RNAs that regulate gene expression with functional links to tumorigenesis. Hepatocellular carcinoma (HCC) is the most common type of liver cancer, and it is heterogeneous in clinical outcomes and biological activities. Recently, we have identified a subset of highly invasive epithelial cell adhesion molecule (EpCAM)(+) HCC cells from alpha-fetoprotein (AFP)(+) tumors with cancer stem/progenitor cell features, that is, the abilities to self-renew, differentiate, and initiate aggressive tumors in vivo. Here, using a global microarray-based miRNA profiling approach followed by validation with quantitative reverse transcription polymerase chain reaction, we have demonstrated that conserved miR-181 family members were up-regulated in EpCAM(+)AFP(+) HCCs and in EpCAM(+) HCC cells isolated from AFP(+) tumors. Moreover, miR-181 family members were highly expressed in embryonic livers and in isolated hepatic stem cells. Importantly, inhibition of miR-181 led to a reduction in EpCAM(+) HCC cell quantity and tumor initiating ability, whereas exogenous miR-181 expression in HCC cells resulted in an enrichment of EpCAM(+) HCC cells. We have found that miR-181 could directly target hepatic transcriptional regulators of differentiation (for example, caudal type homeobox transcription factor 2 [CDX2] and GATA binding protein 6 [GATA6]) and an inhibitor of Wnt/beta-catenin signaling (nemo-like kinase [NLK]). Taken together, our results define a novel regulatory link between miR-181s and human EpCAM(+) liver cancer stem/progenitor cells and imply that molecular targeting of miR-181 may eradicate HCC.
LinkOut: [PMID: 19585654]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
18 hsa-miR-181c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000233 NLK nemo-like kinase 2 1
MIRT000234 GATA6 GATA binding protein 6 2 1
MIRT000235 CDX2 caudal type homeobox 2 2 1
MIRT003209 NOTCH2 notch 2 4 1
MIRT003210 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 1
MIRT003211 NOTCH4 notch 4 4 1
MIRT003499 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT006845 Tnf tumor necrosis factor 3 1
MIRT006877 TRIM2 tripartite motif containing 2 1 1
MIRT006878 SIRT1 sirtuin 1 1 1
MIRT006896 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT007221 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT025034 IL2 interleukin 2 3 1
MIRT047219 TUB tubby homolog (mouse) 1 1
MIRT047220 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT047221 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT047222 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1 1
MIRT047223 ISCA1 iron-sulfur cluster assembly 1 homolog (S. cerevisiae) 1 1