Accession ID: MIRT000290 [miRNA, hsa-miR-153-3p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-153-1LinkOut: [miRBase ]
Description Homo sapiens miR-153-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-153-3p
Mature Sequence 54| UUGCAUAGUCACAAAAGUGAUC |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-153-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2, PPP1R50
Description B-cell CLL/lymphoma 2
Transcript NM_000633    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_000633|3'UTR
   1 AGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACC
  81 ATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACAC
 161 AACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATT
 241 AAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCAC
 321 CGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCATCT
 401 GAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGTGTT
 481 CATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCTCCC
 561 TGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAGATG
 641 GACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTTTTT
 721 AAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTATAT
 801 TCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTTGAG
 881 GAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCTTTT
 961 AGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACTGGC
1041 CTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCAAGA
1121 AAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGGAGC
1201 CACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATGGTG
1281 AAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCTTGG
1361 CCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAGGTG
1441 TCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAAAAC
1521 CTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGGTGG
1601 GGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGAATC
1681 AGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGTACT
1761 CTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGTTTT
1841 TAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTGATT
1921 CTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCACTGA
2001 GGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCCCTT
2081 TGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATGTTT
2161 GGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGACCT
2241 TTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTC
2321 ATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGC
2401 CAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATTTTA
2481 TGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAATGGA
2561 GTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTTTAA
2641 TATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAGGTC
2721 ACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCAGCC
2801 TCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTAAAA
2881 ACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATCTAA
2961 TTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTCTTT
3041 ATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACTTTC
3121 CAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCCCTC
3201 GCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATTTGG
3281 CAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAAACA
3361 AGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGTTTT
3441 ATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGGAGT
3521 TATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGAGTG
3601 AACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTCTAA
3681 TTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTACTCT
3761 ATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGATCT
3841 TATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGCTTA
3921 TGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACAAAG
4001 GACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGAAGT
4081 TTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGTGAC
4161 AAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCGTTT
4241 GGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAACAGG
4321 ATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTTTAT
4401 AAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTCCAT
4481 GTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATGAAT
4561 GGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCTGCA
4641 TACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTATTA
4721 ATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCAGAT
4801 AGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGCTTT
4881 CTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTATTTT
4961 TGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTACCTT
5041 CCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTAAGG
5121 ATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTGGAA
5201 AAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATACTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cuagugaaaacacugAUACGUu 5'
                         |||||| 
Target 5' cctgccccaaacaaaTATGCAa 3'
11 - 32 120.00 -7.60
2
miRNA  3' cuagugaaaacacugAUACGUu 5'
                         |||||| 
Target 5' aagcagtagaaataaTATGCAt 3'
44 - 65 120.00 -6.30
3
miRNA  3' cuagugaaaacacugAUACGUu 5'
                         |||||| 
Target 5' gagttaaatagagtaTATGCAc 3'
3095 - 3116 120.00 -5.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-153-3p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other ,
Conditions DBTRG-05MG
Disease GBM cell proliferation;
Location of target site 3'UTR
Tools used in this research mirGen , PicTar , TargetScanS
Original Description (Extracted from the article) ... Western blot analysis indicated that miR-153 downregulated both Bcl-2 and Mcl-1 at the protein levels.//Single strand miR-153 inhibitor, which forms complementary base-pair with endogenous miR-153, efficiently blocked the apoptosis and target protein degradation induced by overexpression of miR-153.//By luciferase reporter assays, we further showed that miR-153 inhibited Bcl-2 and Mcl-1 expressions by directly targeting the 3'UTR regions of their respective mRNAs. ...

- Xu, J. Liao, X. Wong, C., 2010, Int J Cancer.

Article - Xu, J. Liao, X. Wong, C.
- Int J Cancer, 2010
MicroRNA-153 (miR-153) is a brain-specific miRNA that is expressed at a significantly lower level in glioblastoma (GBM) relative to non-neoplastic brain tissue. Although the expression pattern of miR-153 has been extensively established, its target genes and cellular mechanism remain undefined. To investigate into the potential function of miR-153 in glioblastmas, we transfected a GBM cell line DBTRG-05MG with synthetic miR-153 oligos and observed decreased cell proliferation and increased apoptosis. Bioinformatics analysis revealed that anti-apoptosis family member B-cell lymphoma 2 (Bcl-2) and myeloid cell leukemia sequence 1 (Mcl-1) are potential targets of miR-153. Indeed, Western blot analysis indicated that miR-153 downregulated both Bcl-2 and Mcl-1 at the protein levels. Single strand miR-153 inhibitor, which forms complementary base-pair with endogenous miR-153, efficiently blocked the apoptosis and target protein degradation induced by overexpression of miR-153. By luciferase reporter assays, we further showed that miR-153 inhibited Bcl-2 and Mcl-1 expressions by directly targeting the 3'UTR regions of their respective mRNAs.
LinkOut: [PMID: 19676043]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
69 hsa-miR-153-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000290 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT003299 FOXO1 forkhead box O1 3 1
MIRT004080 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 3 2
MIRT004733 SNCA synuclein, alpha (non A4 component of amyloid precursor) 4 1
MIRT005682 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT007098 SNAI1 snail homolog 1 (Drosophila) 3 2
MIRT007099 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT007311 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1
MIRT055604 TRUB1 TruB pseudouridine (psi) synthase homolog 1 (E. coli) 1 2
MIRT057112 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT060615 CTTN cortactin 1 3
MIRT060967 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT093970 SLAIN2 SLAIN motif family, member 2 1 1
MIRT098244 SMIM13 chromosome 6 open reading frame 228 1 1
MIRT144212 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT161847 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT195381 CBFB core-binding factor, beta subunit 1 1
MIRT271965 ARF1 ADP-ribosylation factor 1 1 2
MIRT283176 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT285478 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT367987 CEP350 centrosomal protein 350kDa 1 1
MIRT404220 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT438449 PTEN phosphatase and tensin homolog 3 1
MIRT459877 KIAA1191 KIAA1191 1 2
MIRT465214 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT476175 GOLGA8A golgin A8 family, member A 1 1
MIRT477258 ERGIC2 ERGIC and golgi 2 1 1
MIRT478739 CSNK1A1 casein kinase 1, alpha 1 1 3
MIRT479423 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 4
MIRT488438 ULBP2 UL16 binding protein 2 1 1
MIRT492348 SEPT8 septin 8 1 1
MIRT492508 RAET1L retinoic acid early transcript 1L 1 1
MIRT493176 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT505791 SATB1 SATB homeobox 1 1 2
MIRT518618 STAR steroidogenic acute regulatory protein 1 1
MIRT519579 ZNFX1 zinc finger, NFX1-type containing 1 1 2
MIRT519665 ZNF703 zinc finger protein 703 1 2
MIRT519768 ZNF354B zinc finger protein 354B 1 2
MIRT520254 USP6NL USP6 N-terminal like 1 2
MIRT523458 GOLGA8J golgin A8 family, member J 1 1
MIRT523462 GOLGA8I golgin A8 family, member I 1 1
MIRT525005 ACVR1B activin A receptor, type IB 1 1
MIRT526721 RPS9 ribosomal protein S9 1 1
MIRT527130 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT528269 POLE3 polymerase (DNA directed), epsilon 3, accessory subunit 1 1
MIRT532591 SIX4 SIX homeobox 4 1 1
MIRT533320 UNKL unkempt homolog (Drosophila)-like 1 1
MIRT536451 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT543109 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT552076 MESDC2 mesoderm development candidate 2 1 2
MIRT553047 USP28 ubiquitin specific peptidase 28 1 1
MIRT553957 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT556094 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT559403 GDNF glial cell derived neurotrophic factor 1 2
MIRT561321 ZBTB43 zinc finger and BTB domain containing 43 1 1
MIRT561524 AZF1 azoospermia factor 1 1 1
MIRT562656 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT567578 FEM1C fem-1 homolog c (C. elegans) 1 1
MIRT613284 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 2
MIRT616256 KANK4 KN motif and ankyrin repeat domains 4 1 1
MIRT627880 P2RY1 purinergic receptor P2Y, G-protein coupled, 1 1 1
MIRT628636 ABLIM1 actin binding LIM protein 1 1 1
MIRT638015 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT638269 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT640192 ABCC12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 1 1
MIRT644415 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 2
MIRT659391 COX15 cytochrome c oxidase assembly homolog 15 (yeast) 1 1
MIRT696935 CERK ceramide kinase 1 1
MIRT708039 MED28 mediator complex subunit 28 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*