Accession ID: MIRT000312 [miRNA, hsa-miR-143-3p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-143LinkOut: [miRBase ]
Description Homo sapiens miR-143 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse has a 1 nt 3' extension (A), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-143-3p
Mature Sequence 61| UGAGAUGAAGCACUGUAGCUC |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-143-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_033360    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_033360|3'UTR
   1 TCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAA
  81 AGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTACAA
 161 GTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAGACT
 241 GTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGAGTT
 321 TTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATGCAG
 401 TTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTATTC
 481 TGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACATTGA
 561 GGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAATGTA
 641 AAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATTTTT
 721 TCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGATAA
 801 ATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATTTTG
 881 GGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAATTAA
 961 ATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATAGTT
1041 TTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAAGGC
1121 CAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTGTCA
1201 TGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGGTCC
1281 TGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAACTCA
1361 AAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAATCT
1441 CTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAATAAT
1521 GCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATGGCA
1601 TGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTTTGA
1681 GGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATGTAA
1761 TTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACACCAT
1841 CTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCTTCT
1921 TCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCCCTA
2001 ACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTTATT
2081 TCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGATGCT
2161 TTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTATCCA
2241 GTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACAGTA
2321 ATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTTTTT
2401 GGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCCAGG
2481 TTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTGTAT
2561 TTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTGGCC
2641 TCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAAGGC
2721 ACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTACTA
2801 AGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCAGCT
2881 CTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAGGAA
2961 TAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTATGT
3041 CAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAATAG
3121 TTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGATTTC
3201 TGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTCTAC
3281 ACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGTAGA
3361 TGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAGAGA
3441 TTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTTTTT
3521 TTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATTTGA
3601 GTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTATAG
3681 GTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTACAG
3761 TTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAACTT
3841 TTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATAATT
3921 GTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGGATA
4001 GCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAGTTC
4081 TTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAGGTA
4161 ATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAGAGC
4241 TAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCATTTT
4321 TCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTTGTA
4401 TAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTTTCC
4481 ATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAACTTT
4561 TAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAATTA
4641 TTGTAATGTAATAAAAATAGTTACAGTGAC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cuCGAUGUC--ACG-----AAGUAGAGu 5'
            |:|||||  |||     |||||||| 
Target 5' aaGTTACAGTTTGCACAAGTTCATCTCa 3'
3752 - 3779 165.00 -20.20
2
miRNA  3' cuCGAUGUCACGAAGUAGAGu 5'
            |:|| |     ||||||| 
Target 5' atGTTAAAAGAAGTCATCTCa 3'
1707 - 1727 143.00 -11.64
3
miRNA  3' cucgAU-GUCACGAAGUAGAGu 5'
              || :||||  ||||||: 
Target 5' tccaTATTAGTG--TCATCTTg 3'
1921 - 1940 137.00 -9.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , , qRT-PCR ,
Conditions LoVo
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Article - Chen, X. Guo, X. Zhang, H. Xiang, Y. Chen, et al.
- Oncogene, 2009
Dysregulated expression of microRNAs (miRNAs) is associated with a variety of diseases, including colorectal cancer. By comparing more than 200 miRNAs in 13 pairs of matched colorectal cancer and normal adjacent tissue samples through qRT-PCR and microarray analysis, we found a widespread disruption of miRNA expression during colorectal tumorigenesis. In particular, among a panel of presumed targets generated by in silico analysis that may interact with these aberrantly expressed miRNAs, KRAS oncogene has been further experimentally validated as the target of miR-143. First, an inverse correlation between KRAS protein and miR-143 in vivo was found. Second, KRAS expression in Lovo cells was significantly abolished by treatment with miR-143 mimic, whereas miR-143 inhibitor increased KRAS protein level. Third, luciferase reporter assay confirmed that miR-143 directly recognize the 3'-untranslated region of KRAS transcripts. Four, Lovo cells treated with miR-143 inhibitor showed a stimulated cell proliferation, whereas miR-143 overexpression had an opposite effect. Finally, inhibition of KRAS expression by miR-143 inhibits constitutive phosphorylation of ERK1/2. Taken together, the present study provides the first evidences that miR-143 is significant in suppressing colorectal cancer cell growth through inhibition of KRAS translation.
LinkOut: [PMID: 19137007]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: KRAS    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions The human urinary transitional carcinoma cell lines T24 and EJ
Disease bladder cancer;
Location of target site 3'UTR
Tools used in this research DIANA-microT , miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miRNA-143 may regulate the protein level of RAS at the posttranscriptional level.//Consistently RAS protein expression was also significantly decreased in miRNA-143 transfected cells compared with nonspecific miRNA transfected cells. ...

- Lin, T. Dong, W. Huang, J. Pan, Q. Fan, X. et al., 2009, J Urol.

Article - Lin, T. Dong, W. Huang, J. Pan, Q. Fan, X. et al.
- J Urol, 2009
PURPOSE: We investigated the expression and involvement of miRNA in bladder cancer. MATERIALS AND METHODS: An miRNA array was used to examine the differential expression of miRNA in tumor tissues and normal matched controls. The expression of miRNA-143 was confirmed by Northern blot and real-time polymerase chain reaction. The functional role of miRNA-143 in bladder cancer was studied by examining cell proliferation and oncogene expression after miRNA-143 transfection into 2 transitional carcinoma cell lines. RESULTS: miRNA profiling of human bladder cancer and matched normal urothelial epithelium controls revealed that 37 miRNAs were up-regulated and 38 were down-regulated in cancer tissues, of which the expression of miRNA-143 was 13.7 times lower in tumor than in the matched control. Consistent with microarray data, Northern blot analysis and real-time polymerase chain reaction confirmed that miRNA-143 expression was significantly down-regulated in bladder tumor tissues compared with normal adjacent tissues. The expression of miRNA-143 was not detected in the 2 human bladder cancer cell lines EJ and T24. Interestingly miRNA-143 transfection into EJ and T24 cells significantly inhibited cell proliferation. RAS protein expression in cancer tissues was much higher than in adjacent controls. Consistently RAS protein expression was also significantly decreased in miRNA-143 transfected cells compared with nonspecific miRNA transfected cells. CONCLUSIONS: miRNAs are differentially expressed in bladder cancer tissues. miRNA-143 may function as a tumor suppressor in bladder transitional cell carcinoma.
LinkOut: [PMID: 19157460]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: KRAS    [ Functional MTI ]
Validation Method
Article - Pagliuca, A. Valvo, C. Fabrizi, E. di et al.
- Oncogene, 2012
MicroRNAs (miRNAs) from the gene cluster miR-143-145 are diminished in cells of colorectal tumor origin when compared with normal colon epithelia. Until now, no report has addressed the coordinate action of these miRNAs in colorectal cancer (CRC). In this study, we performed a comprehensive molecular and functional analysis of the miRNA cluster regulatory network. First, we evaluated proliferation, migration, anchorage-independent growth and chemoresistance in the colon tumor cell lines after miR-143 and miR-145 restoration. Then, we assessed the contribution of single genes targeted by miR-143 and miR-145 by reinforcing their expression and checking functional recovery. Restoring miR-143 and miR-145 in colon cancer cells decreases proliferation, migration and chemoresistance. We identified cluster of differentiation 44 (CD44), Kruppel-like factor 5 (KLF5), Kirsten rat sarcoma 2 viral oncogene homolog (KRAS) and v-Raf murine sarcoma viral oncogene homolog B1 (BRAF) as proteins targeted by miR-143 and miR-145. Their re-expression can partially revert a decrease in transformation properties caused by the overexpression of miR-143 and miR-145. In addition, we determined a set of mRNAs that are diminished after reinforcing miR-143 and miR-145 expression. The whole transcriptome analysis ascertained that downregulated transcripts are enriched in predicted target genes in a statistically significant manner. A number of additional genes, whose expression decreases as a direct or indirect consequence of miR-143 and miR-145, reveals a complex regulatory network that affects cell signaling pathways involved in transformation. In conclusion, we identified a coordinated program of gene repression by miR-143 and miR-145, in CRC, where either of the two miRNAs share a target transcript, or where the target transcripts share a common signaling pathway. Major mediators of the oncosuppression by miR-143 and miR-145 are genes belonging to the growth factor receptor-mitogen-activated protein kinase network and to the p53 signaling pathway.Oncogene advance online publication, 5 November 2012; doi:10.1038/onc.2012.495.
LinkOut: [PMID: 23128394]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: KRAS    [ Functional MTI ]
Validation Method Western blot
Conditions TE-1
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... The specific sequences and positions of the binding sites pairing with miR-143 in 3′-UTR of MAPK7 (ERK5), KRAS, BCL-2. ...

- Ni, Y. Meng, L. Wang, L. Dong, W. Shen, H. et al., 2012, Gene.

Article - Ni, Y. Meng, L. Wang, L. Dong, W. Shen, H. et al.
- Gene, 2012
Esophageal cancer is one of the most common cancers worldwide with a poor prognosis. MicroRNAs(miRNAs) are a class of naturally occurring small noncoding RNAs and play an important role in cancer initiation and development. In this study, we demonstrate that the expression levels of miR-143 and miR-145 were significantly decreased in ESCC tissues in comparison with adjacent normal esophageal squamous tissues(NESTs). Furthermore, an inverse correlation between miR-143 and tumor invasion depth and lymph node metastasis was observed. The enforced expression of miR-143 induced growth suppression and apoptosis of ESCC cells. Rescue of miR-143 significantly suppressed the ESCC cells migration and invasion capabilities. Moreover, we show that functions of miR-143 in ESCC are mediated at least in part by the inhibition of extracellular signal regulated kinase-5(ERK-5) activity. These results prove that miR-143 may act as a tumor suppressor in ESCC.
LinkOut: [PMID: 23276710]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
158 hsa-miR-143-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000312 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 4
MIRT000314 KLF4 Kruppel-like factor 4 (gut) 1 2
MIRT000458 MYO6 myosin VI 4 7
MIRT000716 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 4 3
MIRT003060 FNDC3B fibronectin type III domain containing 3B 4 3
MIRT003759 MAPK7 mitogen-activated protein kinase 7 5 16
MIRT003964 COX2 cytochrome c oxidase subunit II 1 1
MIRT004242 COL1A1 collagen, type I, alpha 1 4 3
MIRT005644 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 2
MIRT005771 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 3 2
MIRT006301 HK2 hexokinase 2 3 5
MIRT006316 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 3 1
MIRT006362 FHIT fragile histidine triad 1 1
MIRT006469 MACC1 metastasis associated in colon cancer 1 3 1
MIRT006757 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 3 2
MIRT006846 JAG1 jagged 1 4 1
MIRT007179 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT007256 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT007348 BCL2 B-cell CLL/lymphoma 2 4 4
MIRT021540 MMP13 matrix metallopeptidase 13 (collagenase 3) 3 2
MIRT052912 SDC1 syndecan 1 3 1
MIRT053082 RREB1 ras responsive element binding protein 1 3 1
MIRT053215 CD44 CD44 molecule (Indian blood group) 3 1
MIRT053217 KLF5 Kruppel-like factor 5 (intestinal) 3 1
MIRT053218 BRAF v-raf murine sarcoma viral oncogene homolog B1 3 1
MIRT053639 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT053640 CHST10 carbohydrate sulfotransferase 10 1 1
MIRT053641 MAPK1 mitogen-activated protein kinase 1 2 3
MIRT053642 COL5A1 collagen, type V, alpha 1 1 1
MIRT053643 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 1 1
MIRT053644 SMAD3 SMAD family member 3 1 1
MIRT053645 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT053646 COL5A2 collagen, type V, alpha 2 1 1
MIRT053647 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 1 1
MIRT054257 IGF1R insulin-like growth factor 1 receptor 3 1
MIRT083963 RAB22A RAB22A, member RAS oncogene family 1 2
MIRT095674 RBM27 RNA binding motif protein 27 1 2
MIRT104018 USP42 ubiquitin specific peptidase 42 1 3
MIRT114769 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT178097 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT192240 BTF3L4 basic transcription factor 3-like 4 1 2
MIRT197416 KAT7 K(lysine) acetyltransferase 7 1 1
MIRT294390 ZNF264 zinc finger protein 264 1 2
MIRT348502 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT364788 PRRC2B proline-rich coiled-coil 2B 1 1
MIRT392564 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT437418 TNF tumor necrosis factor 2 1
MIRT437449 NR2C2 nuclear receptor subfamily 2, group C, member 2 3 1
MIRT438056 IL13RA1 interleukin 13 receptor, alpha 1 2 1
MIRT438300 DYT10 dystonia 10 1 1
MIRT438362 COL3A1 collagen, type III, alpha 1 2 1
MIRT438363 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 3 1
MIRT438605 LIMK1 LIM domain kinase 1 2 1
MIRT438817 HNF4A hepatocyte nuclear factor 4, alpha 1 1
MIRT443068 CASP5 caspase 5, apoptosis-related cysteine peptidase 1 1
MIRT443952 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1 1
MIRT444773 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 1 1
MIRT446698 PAPPA pregnancy-associated plasma protein A, pappalysin 1 1 1
MIRT447386 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 1 1
MIRT449324 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT449720 C1orf61 chromosome 1 open reading frame 61 1 1
MIRT450534 PGLS 6-phosphogluconolactonase 1 1
MIRT455653 YARS tyrosyl-tRNA synthetase 1 1
MIRT460080 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 1 1
MIRT461002 SYT7 synaptotagmin VII 1 1
MIRT463471 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT464503 UCK2 uridine-cytidine kinase 2 1 1
MIRT466680 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 2
MIRT467792 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT467864 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT468170 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468661 SECISBP2L SECIS binding protein 2-like 1 3
MIRT469389 RER1 RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) 1 1
MIRT470349 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT472272 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472421 NCKAP1 NCK-associated protein 1 1 1
MIRT474387 KLK10 kallikrein-related peptidase 10 1 1
MIRT475966 GXYLT1 glucoside xylosyltransferase 1 1 2
MIRT478706 CSRNP2 cysteine-serine-rich nuclear protein 2 1 1
MIRT481012 BBC3 BCL2 binding component 3 1 2
MIRT483101 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT490496 GLRA3 glycine receptor, alpha 3 1 1
MIRT492650 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT497536 ZNF607 zinc finger protein 607 1 1
MIRT500647 TUBB2A tubulin, beta 2A class IIa 1 3
MIRT512678 ENO4 enolase family member 4 1 1
MIRT516289 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT516446 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 1 2
MIRT516980 OR7D2 olfactory receptor, family 7, subfamily D, member 2 1 1
MIRT519473 SPTLC2 serine palmitoyltransferase, long chain base subunit 2 1 1
MIRT520114 XIAP X-linked inhibitor of apoptosis 1 2
MIRT521965 PHAX phosphorylated adaptor for RNA export 1 2
MIRT528757 RPS27 ribosomal protein S27 1 3
MIRT529372 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 2
MIRT537167 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT539673 ZBTB44 zinc finger and BTB domain containing 44 1 2
MIRT546394 STOX2 storkhead box 2 1 2
MIRT555989 NFYB nuclear transcription factor Y, beta 1 1
MIRT562149 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT567218 IER5 immediate early response 5 1 1
MIRT568005 COMMD2 COMM domain containing 2 1 1
MIRT571032 CENPP centromere protein P 1 1
MIRT572784 ZNF277 zinc finger protein 277 1 1
MIRT573165 SLC30A9 solute carrier family 30 (zinc transporter), member 9 1 1
MIRT609129 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT609287 OAS3 2'-5'-oligoadenylate synthetase 3, 100kDa 1 1
MIRT613433 GALNT6 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6) 1 1
MIRT613773 TTC38 tetratricopeptide repeat domain 38 1 1
MIRT616648 LRAT lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) 1 2
MIRT620622 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT630895 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT636529 FAXC failed axon connections homolog (Drosophila) 1 2
MIRT641397 NUBPL nucleotide binding protein-like 1 1
MIRT641415 SCN2B sodium channel, voltage-gated, type II, beta subunit 1 1
MIRT642531 CERS4 ceramide synthase 4 1 1
MIRT643189 HYPK huntingtin interacting protein K 1 1
MIRT652153 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT652605 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT659374 CREG2 cellular repressor of E1A-stimulated genes 2 1 1
MIRT661609 C2orf15 chromosome 2 open reading frame 15 1 1
MIRT666343 SKAP2 src kinase associated phosphoprotein 2 1 1
MIRT670417 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT671125 ZNF573 zinc finger protein 573 1 1
MIRT671158 ANKRD9 ankyrin repeat domain 9 1 1
MIRT671341 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT671872 ZNF429 zinc finger protein 429 1 1
MIRT671977 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT672067 KIAA0930 KIAA0930 1 1
MIRT672657 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 2
MIRT672676 GTF2H5 general transcription factor IIH, polypeptide 5 1 1
MIRT672774 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT672932 LRRC2 leucine rich repeat containing 2 1 1
MIRT673162 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT673275 RUNDC1 RUN domain containing 1 1 1
MIRT673335 THAP1 THAP domain containing, apoptosis associated protein 1 1 1
MIRT673354 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT673670 ZNF440 zinc finger protein 440 1 1
MIRT673907 DCTN6 dynactin 6 1 1
MIRT674099 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT674404 MYCBP c-myc binding protein 1 1
MIRT674528 PRR23A proline rich 23A 1 1
MIRT674796 NPR1 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 1 1
MIRT675069 FGD6 FYVE, RhoGEF and PH domain containing 6 1 1
MIRT675083 CCR6 chemokine (C-C motif) receptor 6 1 1
MIRT675129 FSD2 fibronectin type III and SPRY domain containing 2 1 1
MIRT679404 IL10RB interleukin 10 receptor, beta 1 1
MIRT681189 MYPN myopalladin 1 1
MIRT689232 RPS19 ribosomal protein S19 1 1
MIRT694011 PPIL4 peptidylprolyl isomerase (cyclophilin)-like 4 1 1
MIRT699674 SFT2D2 SFT2 domain containing 2 1 1
MIRT700377 RAB33B RAB33B, member RAS oncogene family 1 1
MIRT701996 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT706216 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706551 GJD2 gap junction protein, delta 2, 36kDa 1 1
MIRT707421 RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 1 1
MIRT710651 GLUL glutamate-ammonia ligase 1 1
MIRT720169 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT724395 ABAT 4-aminobutyrate aminotransferase 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*