Accession ID: MIRT000312 [miRNA, hsa-miR-143-3p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-143LinkOut: [miRBase ]
Description Homo sapiens miR-143 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse has a 1 nt 3' extension (A), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-143-3p
Mature Sequence 61| UGAGAUGAAGCACUGUAGCUC |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-143-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_0333    LinkOut: [ RefSeq ]
Other Transcripts NM_0049   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_0333|3'UTR
   1 TAATCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTA
  81 AAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTA
 161 CAAGTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAG
 241 ACTGTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGA
 321 GTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATG
 401 CAGTTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTA
 481 TTCTGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACAT
 561 TGAGGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAAT
 641 GTAAAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATT
 721 TTTTCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGA
 801 TAAATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATT
 881 TTGGGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAAT
 961 TAAATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATA
1041 GTTTTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAA
1121 GGCCAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTG
1201 TCATGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGG
1281 TCCTGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAAC
1361 TCAAAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAA
1441 TCTCTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAAT
1521 AATGCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATG
1601 GCATGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTT
1681 TGAGGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATG
1761 TAATTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACAC
1841 CATCTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCT
1921 TCTTCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCC
2001 CTAACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTT
2081 ATTTCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGAT
2161 GCTTTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTAT
2241 CCAGTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACA
2321 GTAATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTT
2401 TTTGGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCC
2481 AGGTTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTG
2561 TATTTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTG
2641 GCCTCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAA
2721 GGCACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTA
2801 CTAAGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCA
2881 GCTCTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAG
2961 GAATAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTA
3041 TGTCAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAA
3121 TAGTTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGAT
3201 TTCTGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTC
3281 TACACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGT
3361 AGATGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAG
3441 AGATTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTT
3521 TTTTTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATT
3601 TGAGTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTA
3681 TAGGTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTA
3761 CAGTTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAA
3841 CTTTTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATA
3921 ATTGTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGG
4001 ATAGCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAG
4081 TTCTTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAG
4161 GTAATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAG
4241 AGCTAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCAT
4321 TTTTCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTT
4401 GTATAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTT
4481 TCCATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAAC
4561 TTTTAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAA
4641 TTATTGTAATGTAATAAAAATAGTTACAGTGACAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , , qRT-PCR ,
Conditions LoVo
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar
Article - Chen, X. Guo, X. Zhang, H. Xiang, Y. Chen, et al.
- Oncogene, 2009
Dysregulated expression of microRNAs (miRNAs) is associated with a variety of diseases, including colorectal cancer. By comparing more than 200 miRNAs in 13 pairs of matched colorectal cancer and normal adjacent tissue samples through qRT-PCR and microarray analysis, we found a widespread disruption of miRNA expression during colorectal tumorigenesis. In particular, among a panel of presumed targets generated by in silico analysis that may interact with these aberrantly expressed miRNAs, KRAS oncogene has been further experimentally validated as the target of miR-143. First, an inverse correlation between KRAS protein and miR-143 in vivo was found. Second, KRAS expression in Lovo cells was significantly abolished by treatment with miR-143 mimic, whereas miR-143 inhibitor increased KRAS protein level. Third, luciferase reporter assay confirmed that miR-143 directly recognize the 3'-untranslated region of KRAS transcripts. Four, Lovo cells treated with miR-143 inhibitor showed a stimulated cell proliferation, whereas miR-143 overexpression had an opposite effect. Finally, inhibition of KRAS expression by miR-143 inhibits constitutive phosphorylation of ERK1/2. Taken together, the present study provides the first evidences that miR-143 is significant in suppressing colorectal cancer cell growth through inhibition of KRAS translation.
LinkOut: [PMID: 19137007]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: KRAS    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions The human urinary transitional carcinoma cell lines T24 and EJ
Disease bladder cancer;
Location of target site 3'UTR
Tools used in this research DIANA-microT , miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miRNA-143 may regulate the protein level of RAS at the posttranscriptional level.//Consistently RAS protein expression was also significantly decreased in miRNA-143 transfected cells compared with nonspecific miRNA transfected cells. ...

- Lin, T. Dong, W. Huang, J. Pan, Q. Fan, X. et al., 2009, J Urol.

Article - Lin, T. Dong, W. Huang, J. Pan, Q. Fan, X. et al.
- J Urol, 2009
PURPOSE: We investigated the expression and involvement of miRNA in bladder cancer. MATERIALS AND METHODS: An miRNA array was used to examine the differential expression of miRNA in tumor tissues and normal matched controls. The expression of miRNA-143 was confirmed by Northern blot and real-time polymerase chain reaction. The functional role of miRNA-143 in bladder cancer was studied by examining cell proliferation and oncogene expression after miRNA-143 transfection into 2 transitional carcinoma cell lines. RESULTS: miRNA profiling of human bladder cancer and matched normal urothelial epithelium controls revealed that 37 miRNAs were up-regulated and 38 were down-regulated in cancer tissues, of which the expression of miRNA-143 was 13.7 times lower in tumor than in the matched control. Consistent with microarray data, Northern blot analysis and real-time polymerase chain reaction confirmed that miRNA-143 expression was significantly down-regulated in bladder tumor tissues compared with normal adjacent tissues. The expression of miRNA-143 was not detected in the 2 human bladder cancer cell lines EJ and T24. Interestingly miRNA-143 transfection into EJ and T24 cells significantly inhibited cell proliferation. RAS protein expression in cancer tissues was much higher than in adjacent controls. Consistently RAS protein expression was also significantly decreased in miRNA-143 transfected cells compared with nonspecific miRNA transfected cells. CONCLUSIONS: miRNAs are differentially expressed in bladder cancer tissues. miRNA-143 may function as a tumor suppressor in bladder transitional cell carcinoma.
LinkOut: [PMID: 19157460]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-143-3p :: KRAS    [ Functional MTI ]
Validation Method Western blot
Conditions TE-1
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... The specific sequences and positions of the binding sites pairing with miR-143 in 3′-UTR of MAPK7 (ERK5), KRAS, BCL-2. ...

- Ni, Y. Meng, L. Wang, L. Dong, W. Shen, H. et al., 2012, Gene.

Article - Ni, Y. Meng, L. Wang, L. Dong, W. Shen, H. et al.
- Gene, 2012
Esophageal cancer is one of the most common cancers worldwide with a poor prognosis. MicroRNAs(miRNAs) are a class of naturally occurring small noncoding RNAs and play an important role in cancer initiation and development. In this study, we demonstrate that the expression levels of miR-143 and miR-145 were significantly decreased in ESCC tissues in comparison with adjacent normal esophageal squamous tissues(NESTs). Furthermore, an inverse correlation between miR-143 and tumor invasion depth and lymph node metastasis was observed. The enforced expression of miR-143 induced growth suppression and apoptosis of ESCC cells. Rescue of miR-143 significantly suppressed the ESCC cells migration and invasion capabilities. Moreover, we show that functions of miR-143 in ESCC are mediated at least in part by the inhibition of extracellular signal regulated kinase-5(ERK-5) activity. These results prove that miR-143 may act as a tumor suppressor in ESCC.
LinkOut: [PMID: 23276710]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
20 hsa-miR-143-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000312 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 3
MIRT000314 KLF4 Kruppel-like factor 4 (gut) 1 2
MIRT000458 MYO6 myosin VI 4 7
MIRT000716 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 4 2
MIRT003060 FNDC3B fibronectin type III domain containing 3B 4 3
MIRT003759 MAPK7 mitogen-activated protein kinase 7 5 14
MIRT003964 COX2 cytochrome c oxidase subunit II 1 1
MIRT004242 COL1A1 collagen, type I, alpha 1 3 2
MIRT005644 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 3 2
MIRT005771 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 3 2
MIRT006301 HK2 hexokinase 2 1 4
MIRT006316 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 3 1
MIRT006362 FHIT fragile histidine triad gene 1 1
MIRT006469 MACC1 metastasis associated in colon cancer 1 3 1
MIRT006757 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT006846 JAG1 jagged 1 (Alagille syndrome) 4 1
MIRT007179 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT007256 MDM2 Mdm2 p53 binding protein homolog (mouse) 1 1
MIRT007348 BCL2 B-cell CLL/lymphoma 2 1 2
MIRT021540 MMP13 matrix metallopeptidase 13 (collagenase 3) 2 1