Accession ID: MIRT000320 [miRNA, hsa-miR-141-3p :: DLX5, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-141LinkOut: [miRBase ]
Description Homo sapiens miR-141 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-141-3p
Mature Sequence 59| UAACACUGUCUGGUAAAGAUGG |80
Evidence Experimental
Experiments Cloned
Putative hsa-miR-141-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DLX5 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms SHFM1D
Description distal-less homeobox 5
Transcript NM_005221    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DLX5 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DLX5
(miRNA target sites are highlighted)
>DLX5|NM_005221|3'UTR
   1 ATGGGCTGCTCTCTCTTACTCTCTTTTTTGGGACTACTGTGTTTTGCTGTTCTAGAAAATCATAAAGAAAGGAATTCATA
  81 TGGGGAAGTTCGGAAAACTGAAAAAGATTCATGTGTAAAGCTTTTTTTTGCATGTAAGTTATTGCATTTCAAAAGACCCC
 161 CCCTTTTTTTACAGAGGACTTTTTTTGCGCAACTGTGGACACTTTCAATGGTGCCTTGAAATCTATGACCTCAACTTTTC
 241 AAAAGACTTTTTTCAATGTTATTTTAGCCATGTAAATAAGTGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAA
 321 AATTATTTCGACCATGAAAAGCGGAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gguAGAAAUGGUC----UGUCACAAu 5'
             ||||| :::|    || ||||| 
Target 5' ctcTCTTTTTTGGGACTACTGTGTTt 3'
19 - 44 129.00 -10.10
2
miRNA  3' gguAGAAAUGGUCU-------GUCACAAu 5'
             |:|| |  |||       || |||| 
Target 5' aacTTTTCAAAAGACTTTTTTCAATGTTa 3'
233 - 261 115.00 -5.90
3
miRNA  3' ggUAGAAAUGGU-C---U-GUCACAau 5'
            ||:|| :||| |   |  |||||  
Target 5' ttATTTTAGCCATGTAAATAAGTGTag 3'
259 - 285 104.00 -8.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-141-3p :: DLX5    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Itoh, T. Nozawa, Y. Akao, Y.
- J Biol Chem, 2009
MicroRNAs (miRs) are endogenously expressed 18-25-nucleotide RNAs that regulate gene expression through translational repression by binding to a target mRNA. Recently, it was indicated that miRs act as key regulators in cell differentiation, cell growth, and cell death. In osteogenesis, several miRs (for example miR-26a, -125b, -133, and -135) regulate osteoblast cell growth or differentiation in human adipose tissue-derived stem cells, mouse mesenchymal ST2 stem cells, and mouse premyogenic C2C12 cells. Additionally, Smad proteins control Drosha-mediated miR maturation. Therefore, miRs are closely related to osteogenesis. Here we investigated miR expression profile by an miR array and identified the candidate miRs, miR-141 and -200a, as pre-osteoblast differentiation-related miRs. The effects of miR-141 and -200a on pre-osteoblast differentiation were examined by using transfection of murine pre-osteoblastic MC3T3-E1 cells with mature miR-141 or -200a and antisense inhibitor for miR-141 or -200a. It was shown that miR-141 and -200a remarkably modulated the BMP-2-induced pre-osteoblast differentiation through the translational repression of Dlx5, which is a bone-generating transcription factor expressed in pre-osteoblast differentiation. Furthermore, it was indicated that Dlx5 is a common target of miR-141 and -200a by using a luciferase reporter assay. Thus, we have observed for the first time that miR-141 and -200a are involved in pre-osteoblast differentiation in part by regulating the expression of Dlx5.
LinkOut: [PMID: 19454767]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
132 hsa-miR-141-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000316 ZEB2 zinc finger E-box binding homeobox 2 4 9
MIRT000317 ZEB1 zinc finger E-box binding homeobox 1 4 7
MIRT000318 SIP1 gem (nuclear organelle) associated protein 2 1 1
MIRT000320 DLX5 distal-less homeobox 5 2 1
MIRT000727 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT001812 KLF5 Kruppel-like factor 5 (intestinal) 2 1
MIRT001813 STK3 serine/threonine kinase 3 2 1
MIRT002285 TGFB2 transforming growth factor, beta 2 3 1
MIRT002308 HMGB1 high mobility group box 1 1 1
MIRT002309 SFPQ splicing factor proline/glutamine-rich 3 1
MIRT002311 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT002951 CLOCK clock homolog (mouse) 4 2
MIRT003279 BRD3 bromodomain containing 3 4 2
MIRT003280 UBAP1 ubiquitin associated protein 1 3 1
MIRT003281 PTEN phosphatase and tensin homolog 4 2
MIRT004621 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004868 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005479 EIF4E eukaryotic translation initiation factor 4E 4 1
MIRT006173 CTBP2 C-terminal binding protein 2 2 1
MIRT006174 CDYL chromodomain protein, Y-like 2 1
MIRT006342 ACVR2B activin A receptor, type IIB 2 1
MIRT006424 MAPK14 mitogen-activated protein kinase 14 4 2
MIRT006709 PPARA peroxisome proliferator-activated receptor alpha 3 1
MIRT006718 NR0B2 nuclear receptor subfamily 0, group B, member 2 1 1
MIRT006730 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 3 1
MIRT021646 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 1 1
MIRT021647 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT021648 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT021649 E2F3 E2F transcription factor 3 1 1
MIRT021650 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT021651 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT021652 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT021653 ELMO2 engulfment and cell motility 2 2 1
MIRT021654 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT021655 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT021656 RIN2 Ras and Rab interactor 2 1 1
MIRT021657 SEPT7 septin 7 1 1
MIRT021658 HOXB5 homeobox B5 1 1
MIRT021659 ERBB2IP erbb2 interacting protein 2 1
MIRT021660 KLF11 Kruppel-like factor 11 1 1
MIRT021661 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT021662 WDR37 WD repeat domain 37 2 1
MIRT035576 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT052905 STAT4 signal transducer and activator of transcription 4 3 1
MIRT052906 YAP1 Yes-associated protein 1 2 1
MIRT053101 CDC25C cell division cycle 25 homolog C (S. pombe) 2 1
MIRT053587 HDGF hepatoma-derived growth factor 3 1
MIRT053761 KEAP1 kelch-like ECH-associated protein 1 4 2
MIRT054275 TAZ tafazzin 4 1
MIRT054429 TIAM1 T-cell lymphoma invasion and metastasis 1 3 1
MIRT054660 TM4SF1 transmembrane 4 L six family member 1 3 1
MIRT054799 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT054811 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 2 1
MIRT054812 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 1
MIRT061757 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT072480 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT078340 MED13 mediator complex subunit 13 1 1
MIRT099339 QKI QKI, KH domain containing, RNA binding 1 1
MIRT117485 ADNP2 ADNP homeobox 2 1 1
MIRT126444 ARL5B ADP-ribosylation factor-like 5B 1 5
MIRT127534 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT135563 SPRYD4 SPRY domain containing 4 1 1
MIRT176070 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT176151 PGK1 phosphoglycerate kinase 1 1 1
MIRT227600 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT313183 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT368861 IPO5 importin 5 1 1
MIRT437487 MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 3 1
MIRT437904 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 2 1
MIRT438256 ZMPSTE24 zinc metallopeptidase STE24 homolog (S. cerevisiae) 1 1
MIRT441430 STXBP2 syntaxin binding protein 2 1 1
MIRT441733 SEPT8 septin 8 1 1
MIRT442159 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT443390 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT447630 NDST4 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4 1 1
MIRT452255 TRAM1 translocation associated membrane protein 1 1 1
MIRT455749 YRDC yrdC domain containing (E. coli) 1 6
MIRT470196 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT473464 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT478509 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT488716 BICD2 bicaudal D homolog 2 (Drosophila) 1 2
MIRT498346 PRELID2 PRELI domain containing 2 1 1
MIRT500582 USP53 ubiquitin specific peptidase 53 1 1
MIRT502258 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 2
MIRT502309 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT502450 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 2
MIRT502531 EPHA2 EPH receptor A2 1 2
MIRT505324 TMOD3 tropomodulin 3 (ubiquitous) 1 2
MIRT506629 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506862 KIAA1147 KIAA1147 1 1
MIRT519590 ZNF805 zinc finger protein 805 1 2
MIRT519814 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT529419 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT536479 KIAA1549 KIAA1549 1 1
MIRT537734 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT539040 ATXN7L1 ataxin 7-like 1 1 1
MIRT547111 PIGW phosphatidylinositol glycan anchor biosynthesis, class W 1 1
MIRT548122 GATA6 GATA binding protein 6 1 1
MIRT548307 EPHA7 EPH receptor A7 1 1
MIRT549101 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT554195 SLC35D1 solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 1 1
MIRT555678 PGAM4 phosphoglycerate mutase family member 4 1 1
MIRT557412 H2AFZ H2A histone family, member Z 1 2
MIRT559959 TRMT112 tRNA methyltransferase 11-2 homolog (S. cerevisiae) 1 1
MIRT564939 XPOT exportin, tRNA 1 1
MIRT568098 CDV3 CDV3 homolog (mouse) 1 1
MIRT573384 KIAA1549L KIAA1549-like 1 1
MIRT614583 LHX1 LIM homeobox 1 1 1
MIRT632225 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT634843 APOOL apolipoprotein O-like 1 1
MIRT639526 ZNF621 zinc finger protein 621 1 1
MIRT645301 ANGPTL7 angiopoietin-like 7 1 1
MIRT654776 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT656542 MACC1 metastasis associated in colon cancer 1 1 1
MIRT663685 CCDC18 coiled-coil domain containing 18 1 1
MIRT682854 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT682941 ZNF292 zinc finger protein 292 1 1
MIRT682960 RPL12 ribosomal protein L12 1 1
MIRT683088 A1BG alpha-1-B glycoprotein 1 1
MIRT692252 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT696503 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT696749 RBM28 RNA binding motif protein 28 1 1
MIRT702208 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT708615 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT709037 TROVE2 TROVE domain family, member 2 1 1
MIRT710919 GLTSCR1L KIAA0240 1 1
MIRT713192 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT714498 HSPA4 heat shock 70kDa protein 4 1 1
MIRT718597 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT723111 CLDND1 claudin domain containing 1 1 1
MIRT723915 PEX11A peroxisomal biogenesis factor 11 alpha 1 1
MIRT725580 CELF1 CUGBP, Elav-like family member 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*