Accession ID: MIRT000320 [miRNA, hsa-miR-141-3p :: DLX5, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-141LinkOut: [miRBase ]
Description Homo sapiens miR-141 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-141-3p
Mature Sequence 59| UAACACUGUCUGGUAAAGAUGG |80
Evidence Experimental
Experiments Cloned
Putative hsa-miR-141-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DLX5 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description distal-less homeobox 5
Transcript NM_0052    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DLX5 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DLX5
(miRNA target sites are highlighted)
>DLX5|NM_0052|3'UTR
   1 TAGATGGGCTGCTCTCTCTTACTCTCTTTTTTGGGACTACTGTGTTTTGCTGTTCTAGAAAATCATAAAGAAAGGAATTC
  81 ATATGGGGAAGTTCGGAAAACTGAAAAAGATTCATGTGTAAAGCTTTTTTTTGCATGTAAGTTATTGCATTTCAAAAGAC
 161 CCCCCCTTTTTTTACAGAGGACTTTTTTTGCGCAACTGTGGACACTTTCAATGGTGCCTTGAAATCTATGACCTCAACTT
 241 TTCAAAAGACTTTTTTCAATGTTATTTTAGCCATGTAAATAAGTGTAGATAGAGGAATTAAACTGTATATTCTGGATAAA
 321 TAAAATTATTTCGACCATGAAAAGCGGAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-141-3p :: DLX5    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Itoh, T. Nozawa, Y. Akao, Y.
- J Biol Chem, 2009
MicroRNAs (miRs) are endogenously expressed 18-25-nucleotide RNAs that regulate gene expression through translational repression by binding to a target mRNA. Recently, it was indicated that miRs act as key regulators in cell differentiation, cell growth, and cell death. In osteogenesis, several miRs (for example miR-26a, -125b, -133, and -135) regulate osteoblast cell growth or differentiation in human adipose tissue-derived stem cells, mouse mesenchymal ST2 stem cells, and mouse premyogenic C2C12 cells. Additionally, Smad proteins control Drosha-mediated miR maturation. Therefore, miRs are closely related to osteogenesis. Here we investigated miR expression profile by an miR array and identified the candidate miRs, miR-141 and -200a, as pre-osteoblast differentiation-related miRs. The effects of miR-141 and -200a on pre-osteoblast differentiation were examined by using transfection of murine pre-osteoblastic MC3T3-E1 cells with mature miR-141 or -200a and antisense inhibitor for miR-141 or -200a. It was shown that miR-141 and -200a remarkably modulated the BMP-2-induced pre-osteoblast differentiation through the translational repression of Dlx5, which is a bone-generating transcription factor expressed in pre-osteoblast differentiation. Furthermore, it was indicated that Dlx5 is a common target of miR-141 and -200a by using a luciferase reporter assay. Thus, we have observed for the first time that miR-141 and -200a are involved in pre-osteoblast differentiation in part by regulating the expression of Dlx5.
LinkOut: [PMID: 19454767]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
43 hsa-miR-141-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000316 ZEB2 zinc finger E-box binding homeobox 2 4 5
MIRT000317 ZEB1 zinc finger E-box binding homeobox 1 3 5
MIRT000318 SIP1 survival of motor neuron protein interacting protein 1 1 1
MIRT000320 DLX5 distal-less homeobox 5 2 1
MIRT000727 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT001812 KLF5 Kruppel-like factor 5 (intestinal) 2 1
MIRT001813 STK3 serine/threonine kinase 3 (STE20 homolog, yeast) 2 1
MIRT002285 TGFB2 transforming growth factor, beta 2 3 1
MIRT002308 HMGB1 high-mobility group box 1 1 1
MIRT002309 SFPQ splicing factor proline/glutamine-rich 3 1
MIRT002311 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT002951 CLOCK clock homolog (mouse) 4 2
MIRT003279 BRD3 bromodomain containing 3 3 1
MIRT003280 UBAP1 ubiquitin associated protein 1 3 1
MIRT003281 PTEN phosphatase and tensin homolog 3 1
MIRT004621 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004868 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005479 EIF4E eukaryotic translation initiation factor 4E 4 1
MIRT006173 CTBP2 C-terminal binding protein 2 2 1
MIRT006174 CDYL chromodomain protein, Y-like 2 1
MIRT006342 ACVR2B activin A receptor, type IIB 2 1
MIRT006424 MAPK14 mitogen-activated protein kinase 14 3 1
MIRT006709 PPARA peroxisome proliferator-activated receptor alpha 3 1
MIRT006718 NR0B2 nuclear receptor subfamily 0, group B, member 2 1 1
MIRT006730 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 3 1
MIRT021646 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) 1 1
MIRT021647 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT021648 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT021649 E2F3 E2F transcription factor 3 1 1
MIRT021650 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT021651 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT021652 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT021653 ELMO2 engulfment and cell motility 2 2 1
MIRT021654 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT021655 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT021656 RIN2 Ras and Rab interactor 2 1 1
MIRT021657 SEPT7 septin 7 1 1
MIRT021658 HOXB5 homeobox B5 1 1
MIRT021659 ERBB2IP erbb2 interacting protein 2 1
MIRT021660 KLF11 Kruppel-like factor 11 1 1
MIRT021661 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT021662 WDR37 WD repeat domain 37 2 1
MIRT035576 MAP2K4 mitogen-activated protein kinase kinase 4 1 1