Accession ID: MIRT000329 [miRNA, hsa-miR-133a-3p :: HCN4, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-133a-1LinkOut: [miRBase ]
Synonyms MIRN133A1, MIR133A1
Description Homo sapiens miR-133a-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-133a-3p
Mature Sequence 53| UUUGGUCCCCUUCAACCAGCUG |74
Evidence Experimental
Experiments Cloned
Putative hsa-miR-133a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HCN4 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms SSS2
Description hyperpolarization activated cyclic nucleotide-gated potassium channel 4
Transcript NM_0054    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HCN4 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HCN4
(miRNA target sites are highlighted)
>HCN4|NM_0054|3'UTR
   1 TGAGCTGGGCCCTTCCTTCCCTCTTCTTTCTTCTTTTCTCTCCCTTCCTTCTTCCTTCAGGTTTAACTGTGATTAGGAGA
  81 TATACCAATAACAGTAATAATTATTTAAAAAACCACACACACCAGAAAAACAAAAGACAGCAGAAAATAACCAGGTATTC
 161 TTAGAGCTATAGATTTTTGGTCACTTGCTTTTATAGACTATTTTAATACTCAGCACTAGAGGGAGGGAGGGGGAGGGAGG
 241 AGGGAGCAGGCAGGTCCCAAATGCAAAAGCCAGAGAAAGGCAGATGGGGTCTCCGGGGCTGGGCAGGGGTGGGAGTGGCC
 321 AGTGTTGGCGGTTCTTAGAGCAGATGTGTCATTGTGTTCATTTAGAGAAACAGCTGCCATCAGCCCGTTAGCTGTAACTT
 401 GGAGCTCCACTCTGCCCCCAGAAAGGGGCTGCCCTGGGGTGTGCCCTGGGGAGCCTCAGAAGCCTGCGACCTTGGGAGAA
 481 AAGGGCCAGGGCCCTGAGGGCCTAGCATTTTTTCTACTGTAAACGTAGCAAGATCTGTATATGAATATGTATATGTATAT
 561 GTATGTAAGATGTGTATATGTATAGCTATGTAGCGCTCTGTAGAGCCATGTAGATAGCCACTCACATGTGCGCACACGTG
 641 TGCGGTCTAGTTTAATCCCATGTTGACAGGATGCCCAGGTCACCTTACACCCAGCAACCCGCCTTGGCCCACAGGCTGTG
 721 CACTGCATGGTCTAGGGACGTTCTCTCTCCAGTCCTCAGGGAAGAGGACCCCAGGACTTCGCAGCAGGCCCCCTCTCTCC
 801 CCATCTCTGGTCTCAAAGCCAGTCCCAGCCTGACCTCTCACCACACGGAAGTGGAAGACTCCCCTTTCCTAGGGCCTCAA
 881 GCACACACCGCCACCTCTGGGGCCGTCAGTTTGCCCATCTGTACAGTGGGAGGTGAGCGGAACTTCTGTTTATTGAGTCT
 961 GCTCTGTGCCAAGCACTGGTTTCGCACTTTACACACATTAACTCCTTCAGTTTCACAAAGACCATGGGGTGGGTACTTTG
1041 ATTCTCCCCATTTAGCAGAGGAAGAAACAGTTTTGGGTAATTTTTCCAGAATCATGTAACTAGGAGTGGCAGAGTGGGGA
1121 CTGATTTGAGGTTCGAGTCCACGCCTCCTTGAGGCCCAAGTCTGTGTTCCTTCCATCAGAAAACTGTGTTGAGGGGGGCT
1201 GAGGTAGATGGTCCCCAAGCATGGTACAGAAGGAAGACACCAGATTTTGGCAGCAGTCAGGCCTGGGTTTGAATCCCAGC
1281 CCTGCCACTTCTTAGCTGTATGATCTTGGGCAAGTTATCTGACCTTTCTGTCACCTCATTTGTAAAATGGGAATAATTAT
1361 GGTACTGCCTCACAAGGACCTATGAGGACCAGATGAGAAAAATCTATATGTGAAATGCCCAGCCCAGCGCCTGGCACATA
1441 CCATGGTAGGTGCTCAATAAAAAATCACATTTCTTCTGCCCCTCATATGCCCAGCCTATTGCTCCAGCAAACTATGTGAG
1521 AGCCCAGGGAGCTTTGGCTGAGGGCTCCAAGACTTAAAATCTCAGGACTCAGGAGGTGGCTGGGCCTCCCTAAGGGCCCA
1601 AGGAAGGTGTGTGGCCAGAGGTGGGTGGGAGCCAGGCCTTGAGAAGTGGGAAGACTTCAACAGGGAGAGAGGGAGGGAAT
1681 GGTGGGTGGGATGGAGTGTATGGTGGGGAGATTCCTGAGGTGGATGTGGAGTGGTGGATCAGGGCTTTGGGAGGGGATCC
1761 CCAGGCTGAGGGGTCAGAGGGACGGCCTTGGGTGATAGGGTAAGGGATTGTCTGGGCTTAGTCCTGGCAACTAGGAGCCA
1841 TAAGCAGGTTCCAGATTGCGGGAACGAGAAAGCAGCTCAGATGCCTTTGGAGGCACCATCCTCCCTCCTCCCAGATGGGA
1921 TCTTGCCAGAGCCAAGGTCAGGGGTCTGCCCCTGCCTATAGGGCCAGAGCAGGTATGGCTGCAATCCCCAAGTAATGAGA
2001 AGGGCTGGTCCCACATTATCCATCCAGAACCTTCCATGCTCCAAGCCAGAATGTTGGCAAGATCGGGTTTTGCCTTGAGC
2081 TATCCTGGGATGTGAGACAAACCGATTTCTCCATAGATGGGCTGCAGGGAGTGGGAGGCAGTACTCCAGGAGAGAAGTGG
2161 GTGAAGGTTCCTGGGATCTTAGGTAAAGACTAGACGCCGCCTAGTACTGGTCTCTACTGTGCTGGCTCAGGAGTTCTGAG
2241 AACTGGAAGGACTTAGCCTCAACCTGAGTTCTGCACACACCCCTTCCCCTTAAGGAAGGCAGCTCTGAGAGGCAGCAGGA
2321 CTTGATCCAAACCCACAGTCTTGTCCTGGAGGCAGCAGGGGTGAAGGTGGAGGGTCCAGGGCCATGAGGAGCCCCCTTGC
2401 CATCAGAGCCTGGCCTAACCACCCTCTTCTCTACTTACACACACATGCATTTTATAATAGCTCTGACCCAACCTGGCCAC
2481 TCTGCAGAGACTGGGACAGACAGGTGCAGGCAATGGGCCCTCCCACACCCAGTCACCTACAAGGAATTTTCAAATCCACT
2561 TTTAAAACAGAAACCGGTAAATGCGCCGTATTGTATATTTTATTTAAATAAAAAAAATTCCAGCAAAAAAAAAAAAAAAA
2641 AA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gucGAC-CAACUUCCCCUGGUUu 5'
             ||| |||||:||||:|::| 
Target 5' aaaCTGTGTTGAGGGGGGCTGAg 3'
1181 - 1203 135.00 -27.40
2
miRNA  3' gucgACCAACUU-CCCCUGGUUu 5'
              |||  ||: ||||||::| 
Target 5' ggagTGGCAGAGTGGGGACTGAt 3'
1103 - 1125 130.00 -17.80
3
miRNA  3' gucgaccaacUUCCCCUGGUUu 5'
                    | | ||||||: 
Target 5' acaaggacctATGAGGACCAGa 3'
1372 - 1393 128.00 -11.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-133a-3p :: HCN4    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Luo, X. Lin, H. Pan, Z. Xiao, J. Zhang, Y. et al.
- J Biol Chem, 2008
Cardiac hypertrophy is characterized by electrical remolding with increased risk of arrhythmogenesis. Enhanced abnormal automaticity of ventricular cells contributes critically to hypertrophic arrhythmias. The pacemaker current I(f), carried by the hyperpolarization-activated channels encoded mainly by the HCN2 and HCN4 genes in the heart, plays an important role in determining cardiac automaticity. Their expressions reportedly increase in hypertrophic and failing hearts, contributing to arrhythmogenesis under these conditions. We performed a study on post-transcriptional regulation of expression of HCN2 and HCN4 genes by microRNAs. We experimentally established HCN2 as a target for repression by the muscle-specific microRNAs miR-1 and miR-133 and established HCN4 as a target for miR-1 only. We unraveled robust increases in HCN2 and HCN4 protein levels in a rat model of left ventricular hypertrophy and in angiotensin II-induced neonatal ventricular hypertrophy. The up-regulation of HCN2/HCN4 was accompanied by pronounced reduction of miR-1/miR-133 levels. Forced expression of miR-1/miR-133 by transfection prevented overexpression of HCN2/HCN4 in hypertrophic cardiomyocytes. The serum-responsive factor protein level was found significantly decreased in hypertrophic hearts, and silencing of this protein by RNA interference resulted in increased levels of miR-1/miR-133 and concomitant increases in HCN2 and HCN4 protein levels. We conclude that down-regulation of miR-1 and miR-133 expression contributes to re-expression of HCN2/HCN4 and thereby the electrical remodeling process in hypertrophic hearts. Our study also sheds new light on the cellular function and pathological role of miR-1/miR-133 in the heart.
LinkOut: [PMID: 18458081]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
48 hsa-miR-133a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000325 RHOA ras homolog gene family, member A 1 2
MIRT000327 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT000328 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 1 1
MIRT000329 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 2 1
MIRT000330 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 1 1
MIRT000331 KRT7 keratin 7 2 2
MIRT001203 CACNA1C calcium channel, voltage-dependent, L type, alpha 1C subunit 3 1
MIRT001204 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 4 2
MIRT001816 PKM pyruvate kinase, muscle 1 1
MIRT001986 CASP9 caspase 9, apoptosis-related cysteine peptidase 2 2
MIRT002925 KCNQ1 potassium voltage-gated channel, KQT-like subfamily, member 1 4 1
MIRT003542 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 5 4
MIRT004831 KCNH2 potassium voltage-gated channel, subfamily H (eag-related), member 2 4 1
MIRT005604 TAGLN2 transgelin 2 5 4
MIRT005813 LASP1 LIM and SH3 protein 1 3 1
MIRT006571 PNP purine nucleoside phosphorylase 4 2
MIRT006680 MSN moesin 2 1
MIRT007032 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT007088 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT007383 PRDM16 PR domain containing 16 1 1
MIRT021693 TPM1 tropomyosin 1 (alpha) 1 1
MIRT021694 LOC100128295 similar to hCG1639947 1 1
MIRT021695 FBN1 fibrillin 1 1 1
MIRT021696 FAM120C family with sequence similarity 120C 1 1
MIRT021697 BCAN brevican 1 1
MIRT021698 TCTEX1D2 Tctex1 domain containing 2 1 1
MIRT021699 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT021700 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT021701 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT021702 SMIM14 chromosome 4 open reading frame 34 1 1
MIRT021703 PRELID1 PRELI domain containing 1 1 1
MIRT021704 CNN2 calponin 2 1 1
MIRT021705 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT021706 FTL ferritin, light polypeptide 1 1
MIRT021707 CERS2 LAG1 homolog, ceramide synthase 2 1 1
MIRT021708 SEC61B Sec61 beta subunit 1 1
MIRT021709 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT021710 EGFL7 EGF-like-domain, multiple 7 1 1
MIRT021711 VEGFA vascular endothelial growth factor A 1 1
MIRT021712 PIK3R2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) 1 1
MIRT021713 RGS3 regulator of G-protein signaling 3 1 1
MIRT021714 COL1A1 collagen, type I, alpha 1 1 1
MIRT021715 GSTP1 glutathione S-transferase pi 1 2 1
MIRT035537 SP1 Sp1 transcription factor 1 1
MIRT035579 KLF15 Kruppel-like factor 15 1 1
MIRT045837 NR4A2 nuclear receptor subfamily 4, group A, member 2 1 1
MIRT052647 BCL2L1 BCL2-like 1 2 1
MIRT052648 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1