Accession ID: MIRT000329 [miRNA, hsa-miR-133a-3p :: HCN4, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-133a-1LinkOut: [miRBase ]
Synonyms MIRN133A1, MIR133A1
Description Homo sapiens miR-133a-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-133a-3p
Mature Sequence 53| UUUGGUCCCCUUCAACCAGCUG |74
Evidence Experimental
Experiments Cloned
Putative hsa-miR-133a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-133a-3p :: HCN4    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Luo, X. Lin, H. Pan, Z. Xiao, J. Zhang, Y. et al.
- J Biol Chem, 2008
Cardiac hypertrophy is characterized by electrical remolding with increased risk of arrhythmogenesis. Enhanced abnormal automaticity of ventricular cells contributes critically to hypertrophic arrhythmias. The pacemaker current I(f), carried by the hyperpolarization-activated channels encoded mainly by the HCN2 and HCN4 genes in the heart, plays an important role in determining cardiac automaticity. Their expressions reportedly increase in hypertrophic and failing hearts, contributing to arrhythmogenesis under these conditions. We performed a study on post-transcriptional regulation of expression of HCN2 and HCN4 genes by microRNAs. We experimentally established HCN2 as a target for repression by the muscle-specific microRNAs miR-1 and miR-133 and established HCN4 as a target for miR-1 only. We unraveled robust increases in HCN2 and HCN4 protein levels in a rat model of left ventricular hypertrophy and in angiotensin II-induced neonatal ventricular hypertrophy. The up-regulation of HCN2/HCN4 was accompanied by pronounced reduction of miR-1/miR-133 levels. Forced expression of miR-1/miR-133 by transfection prevented overexpression of HCN2/HCN4 in hypertrophic cardiomyocytes. The serum-responsive factor protein level was found significantly decreased in hypertrophic hearts, and silencing of this protein by RNA interference resulted in increased levels of miR-1/miR-133 and concomitant increases in HCN2 and HCN4 protein levels. We conclude that down-regulation of miR-1 and miR-133 expression contributes to re-expression of HCN2/HCN4 and thereby the electrical remodeling process in hypertrophic hearts. Our study also sheds new light on the cellular function and pathological role of miR-1/miR-133 in the heart.
LinkOut: [PMID: 18458081]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
112 hsa-miR-133a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000325 RHOA ras homolog family member A 1 2
MIRT000327 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 2
MIRT000328 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 1 1
MIRT000329 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 2 1
MIRT000330 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 2 2
MIRT000331 KRT7 keratin 7 2 2
MIRT001203 CACNA1C calcium channel, voltage-dependent, L type, alpha 1C subunit 3 1
MIRT001204 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 4 2
MIRT001816 PKM pyruvate kinase, muscle 1 1
MIRT001986 CASP9 caspase 9, apoptosis-related cysteine peptidase 2 2
MIRT002925 KCNQ1 potassium voltage-gated channel, KQT-like subfamily, member 1 4 1
MIRT003542 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 5 4
MIRT004831 KCNH2 potassium voltage-gated channel, subfamily H (eag-related), member 2 4 1
MIRT005604 TAGLN2 transgelin 2 5 4
MIRT005813 LASP1 LIM and SH3 protein 1 3 2
MIRT006571 PNP purine nucleoside phosphorylase 4 2
MIRT006680 MSN moesin 2 1
MIRT007032 EGFR epidermal growth factor receptor 3 4
MIRT007088 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT007383 PRDM16 PR domain containing 16 1 2
MIRT021693 TPM1 tropomyosin 1 (alpha) 1 1
MIRT021695 FBN1 fibrillin 1 1 1
MIRT021696 FAM120C family with sequence similarity 120C 1 1
MIRT021697 BCAN brevican 1 1
MIRT021698 TCTEX1D2 Tctex1 domain containing 2 1 1
MIRT021699 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT021700 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT021701 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT021702 SMIM14 chromosome 4 open reading frame 34 1 1
MIRT021703 PRELID1 PRELI domain containing 1 1 1
MIRT021704 CNN2 calponin 2 2 2
MIRT021705 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 4 2
MIRT021706 FTL ferritin, light polypeptide 2 2
MIRT021707 CERS2 ceramide synthase 2 1 1
MIRT021708 SEC61B Sec61 beta subunit 1 1
MIRT021709 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT021710 EGFL7 EGF-like-domain, multiple 7 1 1
MIRT021711 VEGFA vascular endothelial growth factor A 1 1
MIRT021712 PIK3R2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) 1 1
MIRT021713 RGS3 regulator of G-protein signaling 3 1 1
MIRT021714 COL1A1 collagen, type I, alpha 1 1 1
MIRT021715 GSTP1 glutathione S-transferase pi 1 2 1
MIRT035537 SP1 Sp1 transcription factor 2 2
MIRT035579 KLF15 Kruppel-like factor 15 1 1
MIRT045837 NR4A2 nuclear receptor subfamily 4, group A, member 2 1 1
MIRT052647 BCL2L1 BCL2-like 1 2 1
MIRT052648 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT053333 RFFL ring finger and FYVE-like domain containing E3 ubiquitin protein ligase 4 1
MIRT054310 IGF1R insulin-like growth factor 1 receptor 3 2
MIRT055599 FAM160B1 family with sequence similarity 160, member B1 1 1
MIRT081957 UBA2 ubiquitin-like modifier activating enzyme 2 4 1
MIRT437400 MMP14 matrix metallopeptidase 14 (membrane-inserted) 3 1
MIRT437953 ANXA2 annexin A2 4 1
MIRT437954 SNX30 sorting nexin family member 30 4 1
MIRT437955 SGMS2 sphingomyelin synthase 2 4 1
MIRT438514 DUX4L9 double homeobox 4 like 9 1 1
MIRT438719 PDLIM5 PDZ and LIM domain 5 3 1
MIRT452802 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT462823 BCL3 B-cell CLL/lymphoma 3 1 1
MIRT468494 SESN2 sestrin 2 1 1
MIRT477714 EFHD2 EF-hand domain family, member D2 1 1
MIRT483852 EMID1 EMI domain containing 1 1 1
MIRT490039 PRRT2 proline-rich transmembrane protein 2 1 1
MIRT491349 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 2
MIRT504443 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) 1 1
MIRT505701 SESN3 sestrin 3 1 1
MIRT513521 RHOQ ras homolog family member Q 1 2
MIRT517423 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT526599 DCAKD dephospho-CoA kinase domain containing 1 1
MIRT528904 THBS2 thrombospondin 2 1 1
MIRT533060 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT534126 SNX33 sorting nexin 33 1 1
MIRT534700 RNF103-CHMP3 RNF103-CHMP3 readthrough 1 2
MIRT535732 MYPN myopalladin 1 1
MIRT538529 CHMP3 charged multivesicular body protein 3 1 2
MIRT550878 IBA57 IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae) 1 1
MIRT551260 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 1 1
MIRT551981 UGT2B10 UDP glucuronosyltransferase 2 family, polypeptide B10 1 1
MIRT553866 SYAP1 synapse associated protein 1 1 1
MIRT558810 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 1
MIRT559367 ATP13A3 ATPase type 13A3 1 1
MIRT560941 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT565461 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT566234 PTMA prothymosin, alpha 1 1
MIRT568217 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT608912 NCDN neurochondrin 1 3
MIRT613229 CCDC39 coiled-coil domain containing 39 1 1
MIRT623563 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT637224 TMEM59 transmembrane protein 59 1 1
MIRT641669 CCNI cyclin I 1 1
MIRT644440 ALDOC aldolase C, fructose-bisphosphate 1 1
MIRT644755 TXNRD3NB thioredoxin reductase 3 neighbor 1 1
MIRT646711 PDE1A phosphodiesterase 1A, calmodulin-dependent 1 1
MIRT647577 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT647760 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT649267 C17orf64 chromosome 17 open reading frame 64 1 1
MIRT651238 ZMAT4 zinc finger, matrin-type 4 1 1
MIRT652146 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT657168 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT668302 FOSL2 FOS-like antigen 2 1 1
MIRT687546 MLEC malectin 1 1
MIRT690857 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT697060 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT699725 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT700858 PER2 period homolog 2 (Drosophila) 1 1
MIRT705068 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT709496 ANGPT4 angiopoietin 4 1 1
MIRT713925 PIGR polymeric immunoglobulin receptor 1 1
MIRT716058 SFTPB surfactant protein B 1 1
MIRT716724 APOL6 apolipoprotein L, 6 1 1
MIRT721677 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT723379 NFAM1 NFAT activating protein with ITAM motif 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*