Accession ID: MIRT000343 [miRNA, hsa-miR-126-3p :: SPRED1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-126LinkOut: [miRBase ]
Description Homo sapiens miR-126 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-126-3p
Mature Sequence 52| UCGUACCGUGAGUAAUAAUGCG |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-126-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SPRED1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ33903, NFLS
Description sprouty-related, EVH1 domain containing 1
Transcript NM_1525    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SPRED1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SPRED1
(miRNA target sites are highlighted)
>SPRED1|NM_1525|3'UTR
   1 CCACCATGCCCAGCTAAGTTTTGGTATTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTCTTGAACTCCTGA
  81 CCTTAGGTGATCCACCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCTACTGCGCCCAGCCGTGTGTATGT
 161 TTCTGAAATGATGATGGGGTGGGGTTAAAATCTAAAGGGAAAAACTTGAAACTACCTATTTTCATTGGTTATTCAGCAGT
 241 GCCTAAAATGAGCTTTTGAAGTAATGTAAATGCACTTTCAATTCATGTGTATAGTGCCATCTGATATCTTGGGTAAGTCT
 321 TGCTTTTTCTTTTCTTTTTCCTCTCCCCTGCCCCCTTAATTAAATGGCACGGAAATGTTTCTTAATATGCACGTGAGTCT
 401 CCAGAGTACAGGAAATGTGCTTTCCTCTAAATGGTCAATGTAAAGAATCTTAAGGATATTTCTTGTGTTGAAATTTACAT
 481 TCGATTTTGTGATTACACTTGGAAGTATGTGTTAAATTGGGTTTTTAATTGTAGCCCAAAGGTGCATTAAGCAAGTGTAA
 561 CATTTTTTCCACATAAAACTTAGAAAACTTTAGTTACCTGAAAAGCAAGGATTCTTTACTAATTATTATGCTCATTCTTG
 641 ATTTGACTTCCATGTTCACACTTCAAAGTGTAAGAGGAAGCACTAGAAACTGGCATTATTGTTGCACTAAAAAAGTCTAT
 721 AAATCATAATAGCACCATGAGGTGTTTTGCAATGAGACAAACATGAAGAATGAATTTCTTTAAGAGAGAAACACAACCGG
 801 AGGTGATTTATATAAACCAAAAGAAAAAAAAAGGCTTTAAGGTATTAGGTACTGTTTGCCTAGCAGCCAGGTGGTTATAA
 881 AAGATTCATATGCTTTGGTACACTGATAAATGTTAGCCATTATTCCTGAAAGCTTCTTAAATTGCATCAGTTGTTTTGAA
 961 ATTTTTTCAAGAATAAACTAGTTGAAAAGTCTTTGTATTAAAAATACACATAGATTTTTGTGAACATTTCCAGTGTGTAG
1041 TGTCGTTTGCTTTCTATTTCTGACCTCAAAAGTGCCTCACTTGTATATTATTTCCATTAAAAGCTTGACTGCATTCTTTC
1121 TAATGAACAATGAAAAACTGTTTAACTCATGTCATAATGTGTCTCCTCAGATATAGTTAACTAGCTTGATAGTTTTGAGT
1201 ATATAATGTAAATAATACATTATAAGTTTGTAACCATTTCTGTTACTTCATACCCGTGTAATTGGACATAGCAGATGATT
1281 ATCATAAGAATTTGTTTTAATGGTTTTTTTCCCTCCTGGAATTACCTGATTAAACCTGTCATGAATTATAAAAGGACTTT
1361 TTCTTATTCTCCTAGAGCTTATCAAATTATCACATAAGAGATAATTACTGGAGGAGAAAGTAAAAATGGAAGCTTTTGAT
1441 AATTAGCTCTGTTCTTTAAAAGTATACTTTTAAACTGAAAGTTCACATATAGTTCATCTTAATAACATATTTATTCATCC
1521 TTAATTGTATTCAGATTTTTTTTTAAGTCTCTAAGCTAATAATGTTATATTTATTGGTTTGGTAACATGTTGCAGCTAAG
1601 CTAATGACCTTAAGTGGCAATTGTTTAACCCAGGACTACTGATTTTTTTATATTCAAGTCAGTTTCATCGTTTTACTTAA
1681 CTCGCCATATAACCAAAAATAACGAATAATCTAAAGGAAAGGTTATTAGGACAGTAATAAAAAATTATAGTGTATCTCAA
1761 CACTAGAATAAGTTGGATTACTATATTATAGTTTATTTGAAAAATCAAGGAGTAACTGTATCTTTACCATTAATTATGAA
1841 ATGTAGTCTCATGTGCTTATTTACAGGTTTTTCAGAATTTGCTTTACATTCTTCACATCAAGTTAATACCCACAAGTAAG
1921 TAGAATAGCTTTTATAACAAGGAAATTGAAACTAGGGTTCTAGCTTGGCTATCAATATAAGTGTCATGCACATAGTGCTC
2001 CTTAAAGAAAAAGACATCGACATCAATGGTATGAAAGCTGTAGTCACTCTTTAAATTGAACTGCTCTAAGATTTGCAGTT
2081 TTAGTGAGATCTGAAATGATGGTTCAAAAAATACATTCATAATAAAAGTCTTAACAAAATCACA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcgUAA-UA-AUGAGUGCCAUGcu 5'
             ||| || |:||: :|||||  
Target 5' aagATTCATATGCTT-TGGTACac 3'
881 - 903 122.00 -9.00
2
miRNA  3' gcGUAAUAAUGAGUGCCAUGCu 5'
            ||| :  |:  |:||||:| 
Target 5' gaCATCGACATCAATGGTATGa 3'
2013 - 2034 120.00 -13.80
3
miRNA  3' gcGUAA-UAAUGAGU-GCCAUGcu 5'
            |||| :|||:||| | ||:|  
Target 5' ttCATTGGTTATTCAGCAGTGCct 3'
221 - 244 108.00 -10.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-126-3p :: SPRED1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Original Description (Extracted from the article) ... Relative luciferase activity of constructs containing the 3' UTR of potential miR-126 targets introduced into HeLa cells in the presence of miR-1 or miR-126. ...

- Fish, J. E. Santoro, M. M. Morton, S. U. et al., 2008, Dev Cell.

Article - Fish, J. E. Santoro, M. M. Morton, S. U. et al.
- Dev Cell, 2008
Precise regulation of the formation, maintenance, and remodeling of the vasculature is required for normal development, tissue response to injury, and tumor progression. How specific microRNAs intersect with and modulate angiogenic signaling cascades is unknown. Here, we identified microRNAs that were enriched in endothelial cells derived from mouse embryonic stem (ES) cells and in developing mouse embryos. We found that miR-126 regulated the response of endothelial cells to VEGF. Additionally, knockdown of miR-126 in zebrafish resulted in loss of vascular integrity and hemorrhage during embryonic development. miR-126 functioned in part by directly repressing negative regulators of the VEGF pathway, including the Sprouty-related protein SPRED1 and phosphoinositol-3 kinase regulatory subunit 2 (PIK3R2/p85-beta). Increased expression of Spred1 or inhibition of VEGF signaling in zebrafish resulted in defects similar to miR-126 knockdown. These findings illustrate that a single miRNA can regulate vascular integrity and angiogenesis, providing a new target for modulating vascular formation and function.
LinkOut: [PMID: 18694566]
Experimental Support 2 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-126-3p :: SPRED1    [ Non-Functional MTI ]
Validation Method Luciferase reporter assay
Conditions 293T
Location of target site 3'UTR
Tools used in this research MAMI , miRanda , PicTar , TargetScanS
Original Description (Extracted from the article) ... PLK2, but not SPRED1, is a direct target of miR-126.//A significantly negative effect (P < 0.01; paired t test) on luciferase activity was observed in the presence of miR-126 on the 3'UTR of PLK2 but not on that of SPRED1; such repression disappeared when the predicted target site in the 3'UTR of PLK2 was mutated (Fig. S7 a and b). ...

- Li, Z. Lu, J. Sun, M. Mi, S. Zhang, H. Luo, et al., 2008, Proc Natl Acad Sci U S A.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gcguaauaaugagugCCAUGCu 5'
                         |||||| 
Target 5' uuuaacuaaauguaaGGUACGa 3'
1 - 22
Article - Li, Z. Lu, J. Sun, M. Mi, S. Zhang, H. Luo, et al.
- Proc Natl Acad Sci U S A, 2008
MicroRNAs (miRNAs) are postulated to be important regulators in cancers. Here, we report a genome-wide miRNA expression analysis in 52 acute myeloid leukemia (AML) samples with common translocations, including t(8;21)/AML1(RUNX1)-ETO(RUNX1T1), inv(16)/CBFB-MYH11, t(15;17)/PML-RARA, and MLL rearrangements. Distinct miRNA expression patterns were observed for t(15;17), MLL rearrangements, and core-binding factor (CBF) AMLs including both t(8;21) and inv(16) samples. Expression signatures of a minimum of two (i.e., miR-126/126*), three (i.e., miR-224, miR-368, and miR-382), and seven (miR-17-5p and miR-20a, plus the aforementioned five) miRNAs could accurately discriminate CBF, t(15;17), and MLL-rearrangement AMLs, respectively, from each other. We further showed that the elevated expression of miR-126/126* in CBF AMLs was associated with promoter demethylation but not with amplification or mutation of the genomic locus. Our gain- and loss-of-function experiments showed that miR-126/126* inhibited apoptosis and increased the viability of AML cells and enhanced the colony-forming ability of mouse normal bone marrow progenitor cells alone and particularly, in cooperation with AML1-ETO, likely through targeting Polo-like kinase 2 (PLK2), a tumor suppressor. Our results demonstrate that specific alterations in miRNA expression distinguish AMLs with common translocations and imply that the deregulation of specific miRNAs may play a role in the development of leukemia with these associated genetic rearrangements.
LinkOut: [PMID: 18832181]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-126-3p :: SPRED1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Conditions HUVEC , 293T
Location of target site 3'UTR
Original Description (Extracted from the article) ... Regulation of Spred1 expression by miR-126.//miR-126 deletion inhibited VEGF-dependent Akt and Erk signaling by derepression of the p85β subunit of PI3 kinase and of Spred1, respectively.//Spred1 is a direct target of miR-126as shown by miR-126 repression of luciferase activity of a Renilla reporter construct containing the 3′UTR of Spred1. ...

- Kuhnert, F. Mancuso, M. R. Hampton, J. et al., 2008, Development.

Article - Kuhnert, F. Mancuso, M. R. Hampton, J. et al.
- Development, 2008
Intronic microRNAs have been proposed to complicate the design and interpretation of mouse knockout studies. The endothelial-expressed Egfl7/miR-126 locus contains miR-126 within Egfl7 intron 7, and angiogenesis deficits have been previously ascribed to Egfl7 gene-trap and lacZ knock-in mice. Surprisingly, selectively floxed Egfl7(Delta) and miR-126(Delta) alleles revealed that Egfl7(Delta/Delta) mice were phenotypically normal, whereas miR-126(Delta/Delta) mice bearing a 289-nt microdeletion recapitulated previously described Egfl7 embryonic and postnatal retinal vascular phenotypes. Regulation of angiogenesis by miR-126 was confirmed by endothelial-specific deletion and in the adult cornea micropocket assay. Furthermore, miR-126 deletion inhibited VEGF-dependent Akt and Erk signaling by derepression of the p85beta subunit of PI3 kinase and of Spred1, respectively. These studies demonstrate the regulation of angiogenesis by an endothelial miRNA, attribute previously described Egfl7 vascular phenotypes to miR-126, and document inadvertent miRNA dysregulation as a complication of mouse knockout strategies.
LinkOut: [PMID: 18987025]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-126-3p :: SPRED1    [ Functional MTI ]
Validation Method Flow , Luciferase reporter assay , qRT-PCR , Western blot
Conditions EPC
Original Description (Extracted from the article) ... The target of miR-126 in EPCs was Spred-1. The of miR-126 effecting on EPCs is through Ras/ERK/VEGF and PI3K/Akt/eNOS signal pathway. ...

- Meng, S. Cao, J. T. Zhang, B. Zhou, Q. et al., 2012, J Mol Cell Cardiol.

Article - Meng, S. Cao, J. T. Zhang, B. Zhou, Q. et al.
- J Mol Cell Cardiol, 2012
Diabetes mellitus (DM) adversely affects the number and function of circulating endothelial progenitor cells (EPCs). Consequently, there is also a reduction in the repair mechanism of these cells, which is a critical and initiating factor in the development of diabetic vascular disease. The aim of the present study was to analyze miR expression profiles in EPCs from patients with DM and choose the most significantly regulated miR to study its possible role on EPC dysfunction and elucidate its mechanism of action. EPCs were collected from subjects with Type II DM and non-diabetic control subjects. Total RNA was harvested from EPCs, and a total of 5 candidate miRNAs were identified by microarray screening and were quantified by TaqMan real-time PCR. Lentiviral vectors expressing miR-126 and miR-126 inhibitor (anti-miR-126) were transfected into EPCs, and the EPC colony-forming capacity, proliferation activity, migratory activity, differentiation capacity, and apoptotic susceptibility were determined and Western Blotting and mRNA real-time PCR analyses were performed. To study the mechanisms, lentiviral vectors expressing Spred-1 and a short interfering RNA (siRNA) targeting Spred-1 were prepared. Five miRs were aberrantly downregulated in EPCs from DM patients. These miRs included miR-126, miR-21, miR-27a, miR-27b and miR-130a. Anti-miR-126 inhibited EPC proliferation, migration, and enhanced apoptosis. Restored miR-126 expression in EPCs from DM promoted EPC proliferation, migration, and inhibited EPC apoptosis ability. Despite this, miR-126 had no effect on EPC differentiation. miR-126 overexpression significantly downregulated Spred-1 in EPCs. The knockdown of Spred-1 expression in EPCs from DM promoted proliferation, migration, and inhibited apoptosis of the cells. The signal pathway of miR-126 effecting on EPCs is partially mediated through Ras/ERK/VEGF and PI3K/Akt/eNOS regulation. This study provides the first evidence that miR-126 is downregulated in EPCs from diabetic patients, and impairs EPCs-mediated function via its target, Spred-1, and through Ras/ERK/VEGF and PI3K/Akt/eNOS signal pathway.
LinkOut: [PMID: 22525256]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
32 hsa-miR-126-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000343 SPRED1 sprouty-related, EVH1 domain containing 1 4 5
MIRT000344 PLK2 polo-like kinase 2 (Drosophila) 3 2
MIRT000798 SLC45A3 solute carrier family 45, member 3 3 1
MIRT000965 CCNE2 cyclin E2 2 1
MIRT000966 RGS3 regulator of G-protein signaling 3 2 2
MIRT000967 TOM1 target of myb1 (chicken) 4 2
MIRT001918 HOXA9 homeobox A9 4 1
MIRT002993 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 5 6
MIRT003428 VEGFA vascular endothelial growth factor A 4 4
MIRT003894 PIK3R2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) 4 4
MIRT004081 VCAM1 vascular cell adhesion molecule 1 3 1
MIRT004355 IRS1 insulin receptor substrate 1 4 3
MIRT005020 E2F1 E2F transcription factor 1 2 1
MIRT005370 SOX2 SRY (sex determining region Y)-box 2 5 1
MIRT005538 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 5 1
MIRT005540 TWF2 twinfilin, actin-binding protein, homolog 2 (Drosophila) 4 1
MIRT005727 PTPN7 protein tyrosine phosphatase, non-receptor type 7 3 1
MIRT005729 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 2
MIRT006450 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 4 1
MIRT006543 IGFBP2 insulin-like growth factor binding protein 2, 36kDa 4 1
MIRT006544 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 4 1
MIRT006545 MERTK c-mer proto-oncogene tyrosine kinase 4 1
MIRT006558 EGFL7 EGF-like-domain, multiple 7 4 2
MIRT006679 SLC7A5 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 3 1
MIRT006831 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 3 1
MIRT006883 TEK TEK tyrosine kinase, endothelial 3 1
MIRT007266 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 1 1
MIRT007269 MMP7 matrix metallopeptidase 7 (matrilysin, uterine) 1 1
MIRT007381 CXCL12 chemokine (C-X-C motif) ligand 12 1 1
MIRT021281 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT021282 PGR progesterone receptor 2 1
MIRT045695 RBMX RNA binding motif protein, X-linked 1 1