Accession ID: MIRT000390 [miRNA, hsa-miR-1 :: CEBPA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1-2LinkOut: [miRBase ]
Synonyms MIRN1-2, hsa-mir-1-2, miRNA1-2, MIR1-2
Description Homo sapiens miR-1-2 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1
Mature Sequence 53| UGGAAUGUAAAGAAGUAUGUAU |74
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-1 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CEBPA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C/EBP-alpha, CEBP
Description CCAAT/enhancer binding protein (C/EBP), alpha
Transcript NM_0043    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CEBPA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CEBPA
(miRNA target sites are highlighted)
>CEBPA|NM_0043|3'UTR
   1 TGAGGCGCGCGGCTGTGGGACCGCCCTGGGCCAGCCTCCGGCGGGGACCCAGGGAGTGGTTTGGGGTCGCCGGATCTCGA
  81 GGCTTGCCCGAGCCGTGCGAGCCAGGACTAGGAGATTCCGGTGCCTCCTGAAAGCCTGGCCTGCTCCGCGTGTCCCCTCC
 161 CTTCCTCTGCGCCGGACTTGGTGCGTCTAAGATGAGGGGGCCAGGCGGTGGCTTCTCCCTGCGAGGAGGGGAGAATTCTT
 241 GGGGCTGAGCTGGGAGCCCGGCAACTCTAGTATTTAGGATAACCTTGTGCCTTGGAAATGCAAACTCACCGCTCCAATGC
 321 CTACTGAGTAGGGGGAGCAAATCGTGCCTTGTCATTTTATTTGGAGGTTTCCTGCCTCCTTCCCGAGGCTACAGCAGACC
 401 CCCATGAGAGAAGGAGGGGAGCAGGCCCGTGGCAGGAGGAGGGCTCAGGGAGCTGAGATCCCGACAAGCCCGCCAGCCCC
 481 AGCCGCTCCTCCACGCCTGTCCTTAGAAAGGGGTGGAAACATAGGGACTTGGGGCTTGGAACCTAAGGTTGTTCCCCTAG
 561 TTCTACATGAAGGTGGAGGGTCTCTAGTTCCACGCCTCTCCCACCTCCCTCCGCACACACCCCACCCCAGCCTGCTATAG
 641 GCTGGGCTTCCCCTTGGGGCGGAACTCACTGCGATGGGGGTCACCAGGTGACCAGTGGGAGCCCCCACCCCGAGTCACAC
 721 CAGAAAGCTAGGTCGTGGGTCAGCTCTGAGGATGTATACCCCTGGTGGGAGAGGGAGACCTAGAGATCTGGCTGTGGGGC
 801 GGGCATGGGGGGTGAAGGGCCACTGGGACCCTCAGCCTTGTTTGTACTGTATGCCTTCAGCATTGCCTAGGAACACGAAG
 881 CACGATCAGTCCATCCCAGAGGGACCGGAGTTATGACAAGCTTTCCAAATATTTTGCTTTATCAGCCGATATCAACACTT
 961 GTATCTGGCCTCTGTGCCCCAGCAGTGCCTTGTGCAATGTGAATGTGCGCGTCTCTGCTAAACCACCATTTTATTTGGTT
1041 TTTGTTTTGTTTTGGTTTTGCTCGGATACTTGCCAAAATGAGACTCTCCGTCGGCAGCTGGGGGAAGGGTCTGAGACTCC
1121 CTTTCCTTTTGGTTTTGGGATTACTTTTGATCCTGGGGGACCAATGAGGTGAGGGGGGTTCTCCTTTGCCCTCAGCTTTC
1201 CCCAGCCCCTCCGGCCTGGGCTGCCCACAAGGCTTGTCCCCCAGAGGCCCTGGCTCCTGGTCGGGAAGGGAGGTGGCCTC
1281 CCGCCAACGCATCACTGGGGCTGGGAGCAGGGAAGGACGGCTTGGTTCTCTTCTTTTGGGGAGAACGTAGAGTCTCACTC
1361 TAGATGTTTTATGTATTATATCTATAATATAAACATATCAAAGTCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uauguaugaagaaaUGUAAGGu 5'
                        | ||||| 
Target 5' gagccaggactaggAGATTCCg 3'
99 - 120 108.00 -6.90
2
miRNA  3' uaUG-UAUGAAGAA-AUGUAAGGu 5'
            || :||:  |||  :|||| | 
Target 5' gtACTGTATGCCTTCAGCATTGCc 3'
844 - 867 104.00 -8.60
3
miRNA  3' uaugUAUGAAGAAA-------UGUAAGGu 5'
              :| || ||||       :| |||| 
Target 5' ggggGTTCTCCTTTGCCCTCAGCTTTCCc 3'
1174 - 1202 102.00 -9.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1 :: CEBPA    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Nasser, M. W. Datta, J. Nuovo, G. Kutay, H. et al.
- J Biol Chem, 2008
Micro-RNAs are approximately 21-25-nucleotide-long noncoding RNAs that regulate gene expression primarily at the post-transcriptional level in animals. Here, we report that micro-RNA-1 (miR-1), abundant in the cardiac and smooth muscles, is expressed in the lung and is down-regulated in human primary lung cancer tissues and cell lines. In situ hybridization demonstrated localization of miR-1 in bronchial epithelial cells. The tumor suppressor C/EBPalpha, frequently suppressed in lung cancer, reactivated miR-1 expression in the lung cancer cells. Repressed miR-1 was also activated in lung cancer cells upon treatment with a histone deacetylase inhibitor. These observations led us to examine the antitumorigenic potential of miR-1 in lung cancer cells. Expression of miR-1 in nonexpressing A549 and H1299 cells reversed their tumorigenic properties, such as growth, replication potential, motility/migration, clonogenic survival, and tumor formation in nude mice. Exogenous miR-1 significantly reduced expression of oncogenic targets, such as MET, a receptor tyrosine kinase, and Pim-1, a Ser/Thr kinase, frequently up-regulated in lung cancer. Similarly, the levels of two additional targets, FoxP1, a transcription factor with oncogeneic property, and HDAC4 that represses differentiation-promoting genes, were reduced in miR-1-expressing cells. Conversely, depletion of miR-1 facilitated N417 cell growth with concomitant elevation of these targets. Further, ectopic miR-1 induced apoptosis in A549 cells in response to the potent anticancer drug doxorubicin. Enhanced activation of caspases 3 and 7, cleavage of their substrate PARP-1, and depletion of anti-apoptotic Mcl-1 contributed to the sensitivity of miR-1-expressing cells to doxorubicin. Thus, miR-1 has potential therapeutic application against lung cancers.
LinkOut: [PMID: 18818206]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
846 hsa-miR-1 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000384 CHRNA4 cholinergic receptor, nicotinic, alpha 4 1 1
MIRT000385 MYEF2 myelin expression factor 2 1 1
MIRT000386 RHEB Ras homolog enriched in brain 1 1
MIRT000387 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT000389 CDK9 cyclin-dependent kinase 9 1 2
MIRT000390 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT000391 MEF2A myocyte enhancer factor 2A 3 4
MIRT000392 BCL2 B-cell CLL/lymphoma 2 1 2
MIRT000393 GATA4 GATA binding protein 4 2 2
MIRT000933 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 5 2
MIRT001053 HDAC4 histone deacetylase 4 3 4
MIRT001054 FOXP1 forkhead box P1 4 2
MIRT001205 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 4 2
MIRT001321 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 2 1
MIRT001322 WDFY1 WD repeat and FYVE domain containing 1 3 2
MIRT001323 UNC93B1 unc-93 homolog B1 (C. elegans) 2 1
MIRT001324 UHRF1 ubiquitin-like with PHD and ring finger domains 1 2 1
MIRT001325 TPM3 tropomyosin 3 3 2
MIRT001326 TPM2 tropomyosin 2 (beta) 3 2
MIRT001327 TPM1 tropomyosin 1 (alpha) 3 2
MIRT001328 THBS1 thrombospondin 1 2 1
MIRT001329 SYNE1 spectrin repeat containing, nuclear envelope 1 2 1
MIRT001330 SSNA1 Sjogren syndrome nuclear autoantigen 1 2 1
MIRT001331 SNX6 sorting nexin 6 2 1
MIRT001332 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 2 1
MIRT001333 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 3 2
MIRT001334 SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3 2 1
MIRT001335 SFXN1 sideroflexin 1 3 2
MIRT001336 SEC23IP SEC23 interacting protein 2 1
MIRT001337 SAC3D1 SAC3 domain containing 1 2 1
MIRT001338 RFT1 RFT1 homolog (S. cerevisiae) 2 1
MIRT001339 PWP1 PWP1 homolog (S. cerevisiae) 2 1
MIRT001340 PTPRF protein tyrosine phosphatase, receptor type, F 2 1
MIRT001341 PTPLB protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b 2 1
MIRT001342 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 2 1
MIRT001343 PTMA prothymosin, alpha 6 3
MIRT001344 PTBP2 polypyrimidine tract binding protein 2 2 1
MIRT001345 PTBP1 polypyrimidine tract binding protein 1 2 1
MIRT001346 PRSS21 protease, serine, 21 (testisin) 2 1
MIRT001347 PPIB peptidylprolyl isomerase B (cyclophilin B) 2 1
MIRT001348 POLA2 polymerase (DNA directed), alpha 2 (70kD subunit) 2 1
MIRT001350 PICALM phosphatidylinositol binding clathrin assembly protein 3 2
MIRT001351 PDLIM7 PDZ and LIM domain 7 (enigma) 3 2
MIRT001352 NRP1 neuropilin 1 2 1
MIRT001353 NOTCH2 Notch homolog 2 (Drosophila) 3 2
MIRT001354 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 1
MIRT001355 MRC2 mannose receptor, C type 2 2 1
MIRT001356 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 3 2
MIRT001357 MET met proto-oncogene (hepatocyte growth factor receptor) 6 6
MIRT001358 LRRC8A leucine rich repeat containing 8 family, member A 3 3
MIRT001359 LRP1 low density lipoprotein receptor-related protein 1 2 1
MIRT001360 F2 coagulation factor II (thrombin) 1 1
MIRT001362 ITGB4 integrin, beta 4 2 1
MIRT001363 IQGAP3 IQ motif containing GTPase activating protein 3 2 1
MIRT001364 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 3 2
MIRT001365 GOLGA7 golgin A7 2 1
MIRT001366 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 1
MIRT001367 GAK cyclin G associated kinase 2 1
MIRT001368 EHMT2 euchromatic histone-lysine N-methyltransferase 2 2 1
MIRT001369 EHMT1 euchromatic histone-lysine N-methyltransferase 1 2 1
MIRT001370 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 2 1
MIRT001371 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 2 1
MIRT001372 CTSC cathepsin C 2 1
MIRT001373 CSRP1 cysteine and glycine-rich protein 1 3 2
MIRT001374 CPOX coproporphyrinogen oxidase 2 1
MIRT001375 CORO1C coronin, actin binding protein, 1C 2 1
MIRT001376 COIL coilin 2 1
MIRT001377 CDCP1 CUB domain containing protein 1 3 2
MIRT001378 CAND1 cullin-associated and neddylation-dissociated 1 4 3
MIRT001380 BRI3BP BRI3 binding protein 3 2
MIRT001381 BCKDHB branched chain keto acid dehydrogenase E1, beta polypeptide 2 1
MIRT001382 ATP6V0A1 ATPase, H+ transporting, lysosomal V0 subunit a1 2 1
MIRT001383 ASH2L ash2 (absent, small, or homeotic)-like (Drosophila) 2 1
MIRT001384 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 2 1
MIRT001385 ARID1A AT rich interactive domain 1A (SWI-like) 2 1
MIRT001386 AP3D1 adaptor-related protein complex 3, delta 1 subunit 2 1
MIRT001387 AP3B1 adaptor-related protein complex 3, beta 1 subunit 2 1
MIRT001388 ANXA2 annexin A2 3 2
MIRT001389 ANPEP alanyl (membrane) aminopeptidase 2 1
MIRT001390 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 2 1
MIRT001391 AGRN agrin 2 1
MIRT001392 AGMAT agmatine ureohydrolase (agmatinase) 2 1
MIRT001393 ADPGK ADP-dependent glucokinase 2 1
MIRT001394 ABHD11 abhydrolase domain containing 11 2 1
MIRT001843 HAND2 heart and neural crest derivatives expressed 2 3 2
MIRT001844 IGF1 insulin-like growth factor 1 (somatomedin C) 1 1
MIRT001845 TMSB4X thymosin beta 4, X-linked 2 1
MIRT001847 SH3PXD2B SH3 and PX domains 2B 1 2
MIRT001983 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 3 3
MIRT001984 GJA1 gap junction protein, alpha 1, 43kDa 2 4
MIRT002733 ZNF264 zinc finger protein 264 2 2
MIRT002735 GCFC2 chromosome 2 open reading frame 3 2 1
MIRT002736 OAT ornithine aminotransferase 3 2
MIRT002737 CLCN3 chloride channel 3 2 1
MIRT002738 POLR2K polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa 2 1
MIRT002739 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT002740 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 3 2
MIRT002741 LZTFL1 leucine zipper transcription factor-like 1 2 1
MIRT002742 ARF3 ADP-ribosylation factor 3 2 1
MIRT002743 OSBPL7 oxysterol binding protein-like 7 2 1
MIRT002746 HIST1H3B histone cluster 1, H3b 2 1
MIRT002747 SH2D4A SH2 domain containing 4A 2 1
MIRT002748 TRIM2 tripartite motif-containing 2 2 1
MIRT002749 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT002750 RABL2B RAB, member of RAS oncogene family-like 2B 2 1
MIRT002751 XPO6 exportin 6 5 3
MIRT002752 ARCN1 archain 1 3 3
MIRT002753 FBLN2 fibulin 2 2 1
MIRT002754 CERS2 LAG1 homolog, ceramide synthase 2 2 2
MIRT002755 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 2 2
MIRT002756 POM121 POM121 membrane glycoprotein (rat) 3 2
MIRT002758 AXL AXL receptor tyrosine kinase 3 2
MIRT002759 POGK pogo transposable element with KRAB domain 3 1
MIRT002760 BLCAP bladder cancer associated protein 2 2
MIRT002761 MXD4 MAX dimerization protein 4 2 1
MIRT002762 KIAA1598 KIAA1598 2 1
MIRT002765 EML4 echinoderm microtubule associated protein like 4 2 1
MIRT002766 PGM2 phosphoglucomutase 2 3 1
MIRT002767 TRAPPC3 trafficking protein particle complex 3 2 1
MIRT002768 CHSY1 chondroitin sulfate synthase 1 2 1
MIRT002769 MGC27345 hypothetical protein MGC27345 1 1
MIRT002771 HIST1H3I histone cluster 1, H3i 1 1
MIRT002772 GCH1 GTP cyclohydrolase 1 2 1
MIRT002776 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 2 2
MIRT002777 SLC25A30 solute carrier family 25, member 30 2 2
MIRT002779 ANKRD29 ankyrin repeat domain 29 2 1
MIRT002780 TDP1 tyrosyl-DNA phosphodiesterase 1 2 1
MIRT002782 TPM4 tropomyosin 4 3 3
MIRT002783 PREX1 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 2 1
MIRT002785 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 2
MIRT002787 RNF138 ring finger protein 138 2 2
MIRT002788 TAGLN2 transgelin 2 6 7
MIRT002789 CHST11 carbohydrate (chondroitin 4) sulfotransferase 11 2 1
MIRT002792 RABL2A RAB, member of RAS oncogene family-like 2A 2 1
MIRT002793 LIN7C lin-7 homolog C (C. elegans) 2 2
MIRT002794 H3F3B H3 histone, family 3B (H3.3B) 2 2
MIRT002795 SDC4 syndecan 4 2 2
MIRT002797 RABGAP1L RAB GTPase activating protein 1-like 2 1
MIRT002798 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 3 2
MIRT002799 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 3 2
MIRT002800 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 2 2
MIRT002801 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 2 2
MIRT002802 INPP5F inositol polyphosphate-5-phosphatase F 2 2
MIRT002804 TH1L TH1-like (Drosophila) 3 3
MIRT002805 ANKIB1 ankyrin repeat and IBR domain containing 1 2 2
MIRT002806 SERP1 stress-associated endoplasmic reticulum protein 1 3 2
MIRT002807 TIMP3 TIMP metallopeptidase inhibitor 3 2 2
MIRT002808 LASP1 LIM and SH3 protein 1 5 3
MIRT002809 HPS4 Hermansky-Pudlak syndrome 4 2 2
MIRT002811 UST uronyl-2-sulfotransferase 2 2
MIRT002812 RAB11FIP2 RAB11 family interacting protein 2 (class I) 2 1
MIRT002813 PTMAP7 prothymosin, alpha pseudogene 7 1 1
MIRT002814 MMD monocyte to macrophage differentiation-associated 2 2
MIRT002815 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 3 2
MIRT002816 GNPDA2 glucosamine-6-phosphate deaminase 2 2 2
MIRT002817 ACPL2 acid phosphatase-like 2 2 2
MIRT002819 MTX1 metaxin 1 3 2
MIRT002820 ADAR adenosine deaminase, RNA-specific 4 3
MIRT002823 ARF4 ADP-ribosylation factor 4 3 2
MIRT002824 UHMK1 U2AF homology motif (UHM) kinase 1 2 2
MIRT002924 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 4 2
MIRT002955 BDNF brain-derived neurotrophic factor 2 1
MIRT002956 G6PD glucose-6-phosphate dehydrogenase 4 3
MIRT003203 SOX6 SRY (sex determining region Y)-box 6 2 1
MIRT003524 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 3 3
MIRT003525 LARP4 La ribonucleoprotein domain family, member 4 2 1
MIRT003526 CNN3 calponin 3, acidic 3 2
MIRT003762 ARHGAP29 Rho GTPase activating protein 29 2 1
MIRT003763 CDK14 cyclin-dependent kinase 14 2 1
MIRT003764 MTMR12 myotubularin related protein 12 2 2
MIRT003765 PNP purine nucleoside phosphorylase 5 5
MIRT003766 CCSAP chromosome 1 open reading frame 96 2 1
MIRT003767 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 2 1
MIRT003768 FAM57A family with sequence similarity 57, member A 2 2
MIRT003769 TNS4 tensin 4 2 1
MIRT003770 SLC44A1 solute carrier family 44, member 1 2 3
MIRT003771 IFT52 intraflagellar transport 52 homolog (Chlamydomonas) 2 1
MIRT003772 SRXN1 sulfiredoxin 1 homolog (S. cerevisiae) 3 2
MIRT003847 RBM47 RNA binding motif protein 47 2 2
MIRT003848 C1orf56 chromosome 1 open reading frame 56 2 1
MIRT003849 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT003850 IP6K2 inositol hexakisphosphate kinase 2 2 2
MIRT003851 CNOT6 CCR4-NOT transcription complex, subunit 6 2 1
MIRT003852 KLHDC5 kelch domain containing 5 2 2
MIRT003853 KIF2A kinesin heavy chain member 2A 4 3
MIRT003976 HSPD1 heat shock 60kDa protein 1 (chaperonin) 2 5
MIRT003977 HSPA4 heat shock 70kDa protein 4 2 3
MIRT004322 PIM1 pim-1 oncogene 4 2
MIRT004467 CALM3 calmodulin 3 (phosphorylase kinase, delta) 2 2
MIRT004602 PPP2R5A protein phosphatase 2, regulatory subunit B', alpha 3 1
MIRT004670 PAX3 paired box 3 6 2
MIRT004983 TSPAN4 tetraspanin 4 2 1
MIRT005072 SRSF9 splicing factor, arginine/serine-rich 9 4 4
MIRT005089 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 6 3
MIRT005273 ZNF384 zinc finger protein 384 2 1
MIRT005274 SNAPIN SNAP-associated protein 2 1
MIRT005275 NSUN4 NOP2/Sun domain family, member 4 2 1
MIRT005277 WDR11 WD repeat domain 11 2 1
MIRT005278 MON2 MON2 homolog (S. cerevisiae) 2 1
MIRT005279 TMX1 thioredoxin-related transmembrane protein 1 2 1
MIRT005280 RNF213 ring finger protein 213 2 1
MIRT005281 FERMT2 fermitin family homolog 2 (Drosophila) 2 1
MIRT005282 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 2 1
MIRT005283 ARMC10 armadillo repeat containing 10 2 1
MIRT005284 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 2 1
MIRT005285 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 2 1
MIRT005439 IRF2BPL chromosome 14 open reading frame 4 2 1
MIRT005539 TWF2 twinfilin, actin-binding protein, homolog 2 (Drosophila) 4 1
MIRT005904 CALM2 calmodulin 2 (phosphorylase kinase, delta) 2 2
MIRT005905 GATA6 GATA binding protein 6 1 1
MIRT006132 FN1 fibronectin 1 4 2
MIRT006550 NOTCH3 Notch homolog 3 (Drosophila) 4 1
MIRT006819 SLC8A1 solute carrier family 8 (sodium/calcium exchanger), member 1 2 1
MIRT006855 EDN1 endothelin 1 2 2
MIRT007205 PRKCE protein kinase C, epsilon 1 1
MIRT007213 FABP3 fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) 3 1
MIRT007214 SNAI2 snail homolog 2 (Drosophila) 2 1
MIRT007222 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT023484 CDC42BPB CDC42 binding protein kinase beta (DMPK-like) 1 1
MIRT023485 SRRM1 serine/arginine repetitive matrix 1 1 1
MIRT023486 CD44 CD44 molecule (Indian blood group) 1 1
MIRT023487 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT023488 MECR mitochondrial trans-2-enoyl-CoA reductase 1 1
MIRT023489 CUL4B cullin 4B 1 1
MIRT023490 RAB34 RAB34, member RAS oncogene family 1 1
MIRT023491 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT023492 YTHDC1 YTH domain containing 1 1 1
MIRT023493 DGKH diacylglycerol kinase, eta 1 1
MIRT023494 FGFR2 fibroblast growth factor receptor 2 1 1
MIRT023495 OCIAD2 OCIA domain containing 2 1 1
MIRT023496 SYMPK symplekin 1 1
MIRT023497 LIPC lipase, hepatic 1 1
MIRT023498 CBR4 carbonyl reductase 4 1 1
MIRT023499 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT023500 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 1 1
MIRT023501 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT023502 RCC2 regulator of chromosome condensation 2 1 1
MIRT023503 WLS wntless homolog (Drosophila) 1 1
MIRT023504 CRELD2 cysteine-rich with EGF-like domains 2 1 1
MIRT023505 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT023506 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT023507 HEATR2 HEAT repeat containing 2 1 1
MIRT023508 UGT8 UDP glycosyltransferase 8 1 1
MIRT023509 ABCB5 ATP-binding cassette, sub-family B (MDR/TAP), member 5 1 1
MIRT023510 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT023511 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT023512 HIST2H3A histone cluster 2, H3a 1 1
MIRT023513 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT023514 SAMD15 chromosome 14 open reading frame 174 1 1
MIRT023515 DRAP1 DR1-associated protein 1 (negative cofactor 2 alpha) 1 1
MIRT023516 MDC1 mediator of DNA-damage checkpoint 1 1 1
MIRT023517 CD63 CD63 molecule 1 1
MIRT023518 KNCN kinocilin 1 1
MIRT023519 FANCI Fanconi anemia, complementation group I 1 1
MIRT023520 GJB3 gap junction protein, beta 3, 31kDa 1 1
MIRT023521 STK24 serine/threonine kinase 24 (STE20 homolog, yeast) 1 1
MIRT023522 MCM3 minichromosome maintenance complex component 3 1 1
MIRT023523 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT023524 SIN3A SIN3 homolog A, transcription regulator (yeast) 1 1
MIRT023525 ZNF561 zinc finger protein 561 1 1
MIRT023526 C1orf173 chromosome 1 open reading frame 173 1 1
MIRT023527 BMP7 bone morphogenetic protein 7 1 1
MIRT023528 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT023529 MOBP myelin-associated oligodendrocyte basic protein 1 1
MIRT023530 H1FX H1 histone family, member X 1 1
MIRT023531 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 1 1
MIRT023532 ATL3 atlastin GTPase 3 1 1
MIRT023533 BAG5 BCL2-associated athanogene 5 1 1
MIRT023534 CPSF3 cleavage and polyadenylation specific factor 3, 73kDa 1 1
MIRT023535 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT023536 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT023537 USP33 ubiquitin specific peptidase 33 1 1
MIRT023538 RIMS2 regulating synaptic membrane exocytosis 2 1 1
MIRT023539 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT023540 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT023541 GOLPH3 golgi phosphoprotein 3 (coat-protein) 1 1
MIRT023542 PGD phosphogluconate dehydrogenase 1 1
MIRT023543 UTRN utrophin 1 1
MIRT023544 GPR137C G protein-coupled receptor 137C 1 1
MIRT023545 FBXO33 F-box protein 33 1 1
MIRT023546 ITGA6 integrin, alpha 6 2 2
MIRT023547 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT023548 MRPL19 mitochondrial ribosomal protein L19 2 1
MIRT023549 JUP junction plakoglobin 2 1
MIRT023550 KIF5B kinesin family member 5B 2 1
MIRT023551 SLC27A4 solute carrier family 27 (fatty acid transporter), member 4 2 1
MIRT023552 GNAI1 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 2 1
MIRT023553 PLS3 plastin 3 2 1
MIRT023554 MYO1A myosin IA 2 1
MIRT023555 AP1B1 adaptor-related protein complex 1, beta 1 subunit 2 2
MIRT023556 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT023557 FLOT2 flotillin 2 2 2
MIRT023558 PSIP1 PC4 and SFRS1 interacting protein 1 2 2
MIRT023559 MYO1B myosin IB 2 2
MIRT023560 CAPN1 calpain 1, (mu/I) large subunit 1 1
MIRT023561 TAT tyrosine aminotransferase 1 1
MIRT023562 PCDH7 protocadherin 7 1 1
MIRT023563 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT023564 PYGB phosphorylase, glycogen; brain 1 1
MIRT023565 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023566 RBM42 RNA binding motif protein 42 1 1
MIRT023567 ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 1 1
MIRT023568 UNC13D unc-13 homolog D (C. elegans) 1 1
MIRT023569 DTX1 deltex homolog 1 (Drosophila) 1 1
MIRT023570 LGALS1 lectin, galactoside-binding, soluble, 1 1 1
MIRT023571 LEPREL2 leprecan-like 2 1 1
MIRT023572 KLHDC4 kelch domain containing 4 1 1
MIRT023573 SLBP stem-loop binding protein 1 1
MIRT023574 PI16 peptidase inhibitor 16 1 1
MIRT023575 RBM12B RNA binding motif protein 12B 1 1
MIRT023576 CALR calreticulin 1 1
MIRT023577 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT023578 SLC25A19 solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 1 1
MIRT023579 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT023580 ABHD12 abhydrolase domain containing 12 1 1
MIRT023581 MCAM melanoma cell adhesion molecule 1 1
MIRT023582 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT023583 COQ6 coenzyme Q6 homolog, monooxygenase (S. cerevisiae) 1 1
MIRT023584 RFC5 replication factor C (activator 1) 5, 36.5kDa 1 1
MIRT023585 ZNF579 zinc finger protein 579 1 1
MIRT023586 TRIM26 tripartite motif-containing 26 1 1
MIRT023587 SPC24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT023588 SEC11C SEC11 homolog C (S. cerevisiae) 1 1
MIRT023589 SEMG2 semenogelin II 1 1
MIRT023590 RASSF1 Ras association (RalGDS/AF-6) domain family member 1 1 1
MIRT023591 C11orf31 chromosome 11 open reading frame 31 1 1
MIRT023592 MACROD1 MACRO domain containing 1 1 1
MIRT023593 HIST1H1B histone cluster 1, H1b 1 1
MIRT023594 PLXDC2 plexin domain containing 2 1 1
MIRT023595 NXPH2 neurexophilin 2 1 1
MIRT023596 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT023597 TRPM6 transient receptor potential cation channel, subfamily M, member 6 1 1
MIRT023598 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT023599 SH3TC2 SH3 domain and tetratricopeptide repeats 2 1 1
MIRT023600 VASP vasodilator-stimulated phosphoprotein 1 1
MIRT023601 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT023602 AKAP12 A kinase (PRKA) anchor protein 12 1 1
MIRT023603 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT023604 CLDN12 claudin 12 1 1
MIRT023605 CHAMP1 zinc finger protein 828 1 1
MIRT023606 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT023607 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT023608 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT023609 IPO8 importin 8 1 1
MIRT023610 AKAP4 A kinase (PRKA) anchor protein 4 1 1
MIRT023611 VMP1 transmembrane protein 49 1 1
MIRT023612 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT023613 DKK1 dickkopf homolog 1 (Xenopus laevis) 1 1
MIRT023614 ZNF326 zinc finger protein 326 1 1
MIRT023615 FAM102A family with sequence similarity 102, member A 1 1
MIRT023616 PLXNA4 plexin A4 1 1
MIRT023617 RABEPK Rab9 effector protein with kelch motifs 1 1
MIRT023618 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT023619 MATR3 matrin 3 1 1
MIRT023620 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 2 1
MIRT023621 CCDC124 coiled-coil domain containing 124 2 1
MIRT023622 RALB v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) 2 1
MIRT023623 GTF3C6 general transcription factor IIIC, polypeptide 6, alpha 35kDa 2 1
MIRT023624 EMD emerin 2 1
MIRT023625 ECHS1 enoyl CoA hydratase, short chain, 1, mitochondrial 2 1
MIRT023626 SEPT6 septin 6 2 1
MIRT023627 CACNA2D1 calcium channel, voltage-dependent, alpha 2/delta subunit 1 2 1
MIRT023628 PXDN peroxidasin homolog (Drosophila) 2 2
MIRT023629 AMDHD1 amidohydrolase domain containing 1 1 1
MIRT023630 THAP2 THAP domain containing, apoptosis associated protein 2 1 1
MIRT023631 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT023632 NAT14 N-acetyltransferase 14 (GCN5-related, putative) 1 1
MIRT023633 DDTL D-dopachrome tautomerase-like 1 1
MIRT023634 PLCXD2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1 1
MIRT023635 BTC betacellulin 1 1
MIRT023636 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT023637 RRM1 ribonucleotide reductase M1 1 1
MIRT023638 GPR83 G protein-coupled receptor 83 1 1
MIRT023639 PPA2 pyrophosphatase (inorganic) 2 1 1
MIRT023640 DYNC1LI1 dynein, cytoplasmic 1, light intermediate chain 1 1 1
MIRT023641 NPTN neuroplastin 1 1
MIRT023642 MAGEB3 melanoma antigen family B, 3 1 1
MIRT023643 PSG6 pregnancy specific beta-1-glycoprotein 6 1 1
MIRT023644 ORC3 origin recognition complex, subunit 3-like (yeast) 1 1
MIRT023645 SFI1 Sfi1 homolog, spindle assembly associated (yeast) 1 1
MIRT023646 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT023647 HSPA1A heat shock 70kDa protein 1A 1 1
MIRT023648 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT023649 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT023650 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT023651 PRIMA1 proline rich membrane anchor 1 1 1
MIRT023652 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT023653 IL11 interleukin 11 1 1
MIRT023654 EXOC2 exocyst complex component 2 1 1
MIRT023655 C12orf57 chromosome 12 open reading frame 57 1 1
MIRT023656 CDH4 cadherin 4, type 1, R-cadherin (retinal) 1 1
MIRT023657 KLHL3 kelch-like 3 (Drosophila) 1 1
MIRT023658 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT023659 SPERT spermatid associated 1 1
MIRT023660 TRPM4 transient receptor potential cation channel, subfamily M, member 4 1 1
MIRT023661 CAST calpastatin 1 1
MIRT023662 SCAF11 splicing factor, arginine/serine-rich 2, interacting protein 1 1
MIRT023663 KCND1 potassium voltage-gated channel, Shal-related subfamily, member 1 1 1
MIRT023664 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 1
MIRT023665 SYTL2 synaptotagmin-like 2 1 1
MIRT023666 UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 1 1
MIRT023667 SRSF4 splicing factor, arginine/serine-rich 4 1 1
MIRT023668 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT023669 TMEM106C transmembrane protein 106C 1 1
MIRT023670 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT023671 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT023672 KLK12 kallikrein-related peptidase 12 1 1
MIRT023673 INTS6 integrator complex subunit 6 1 1
MIRT023674 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT023675 NUP50 nucleoporin 50kDa 1 1
MIRT023676 SHE Src homology 2 domain containing E 1 1
MIRT023677 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT023678 PPARG peroxisome proliferator-activated receptor gamma 1 1
MIRT023679 MAD2L1 MAD2 mitotic arrest deficient-like 1 (yeast) 2 1
MIRT023680 MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein 2 1
MIRT023681 ACTN4 actinin, alpha 4 2 1
MIRT023682 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 2 1
MIRT023683 PIGT phosphatidylinositol glycan anchor biosynthesis, class T 2 1
MIRT023684 PGRMC2 progesterone receptor membrane component 2 2 1
MIRT023685 COMMD2 COMM domain containing 2 2 1
MIRT023686 CD109 CD109 molecule 2 2
MIRT023687 COPG1 coatomer protein complex, subunit gamma 2 2
MIRT023688 DSG2 desmoglein 2 2 2
MIRT023689 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 2 2
MIRT023690 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT023691 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 1 1
MIRT023692 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT023693 DHRS1 dehydrogenase/reductase (SDR family) member 1 1 1
MIRT023694 CCL14 chemokine (C-C motif) ligand 14 1 1
MIRT023695 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT023696 ETV7 ets variant 7 1 1
MIRT023697 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT023698 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT023699 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT023700 SYNPO2L synaptopodin 2-like 1 1
MIRT023701 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT023702 NCAPD3 non-SMC condensin II complex, subunit D3 1 1
MIRT023703 PAFAH1B3 platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) 1 1
MIRT023704 ADAMTSL4 ADAMTS-like 4 1 1
MIRT023705 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT023706 SREK1 splicing factor, arginine/serine-rich 12 1 1
MIRT023707 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT023708 EMP3 epithelial membrane protein 3 1 1
MIRT023709 FAM81A family with sequence similarity 81, member A 2 2
MIRT023710 SPINK1 serine peptidase inhibitor, Kazal type 1 1 1
MIRT023711 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT023712 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT023713 OXTR oxytocin receptor 1 1
MIRT023714 DPP7 dipeptidyl-peptidase 7 1 1
MIRT023715 FAM208A chromosome 3 open reading frame 63 1 1
MIRT023716 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT023717 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT023718 FHDC1 FH2 domain containing 1 1 1
MIRT023719 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT023720 NR5A2 nuclear receptor subfamily 5, group A, member 2 1 1
MIRT023721 NXN nucleoredoxin 1 1
MIRT023722 RBBP5 retinoblastoma binding protein 5 1 1
MIRT023723 H3F3C H3 histone, family 3C 1 1
MIRT023724 HDAC2 histone deacetylase 2 1 1
MIRT023725 LHX4 LIM homeobox 4 1 1
MIRT023726 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT023727 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT023728 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT023729 AP1S3 adaptor-related protein complex 1, sigma 3 subunit 1 1
MIRT023730 BCAP29 B-cell receptor-associated protein 29 1 1
MIRT023731 TSHR thyroid stimulating hormone receptor 1 1
MIRT023732 PDE12 phosphodiesterase 12 1 1
MIRT023733 ADAM12 ADAM metallopeptidase domain 12 1 1
MIRT023734 ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 1 1
MIRT023735 HOOK1 hook homolog 1 (Drosophila) 1 1
MIRT023736 PFDN1 prefoldin subunit 1 1 1
MIRT023737 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT023738 SUSD1 sushi domain containing 1 1 1
MIRT023739 SEC62 SEC62 homolog (S. cerevisiae) 1 1
MIRT023740 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT023741 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT023742 NXT2 nuclear transport factor 2-like export factor 2 1 1
MIRT023743 ACTN1 actinin, alpha 1 2 1
MIRT023744 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 2 1
MIRT023745 COPZ1 coatomer protein complex, subunit zeta 1 2 1
MIRT023746 MOB4 MOB1, Mps One Binder kinase activator-like 3 (yeast) 2 1
MIRT023747 RSRC2 arginine/serine-rich coiled-coil 2 2 1
MIRT023748 MYO3B myosin IIIB 2 1
MIRT023749 PDIA3 protein disulfide isomerase family A, member 3 2 1
MIRT023750 FLNB filamin B, beta 2 1
MIRT023751 CHRAC1 chromatin accessibility complex 1 2 1
MIRT023752 PLS1 plastin 1 2 1
MIRT023753 POM121C POM121 membrane glycoprotein C 2 2
MIRT023754 LRRC8C leucine rich repeat containing 8 family, member C 2 2
MIRT023755 OXCT1 3-oxoacid CoA transferase 1 2 1
MIRT023756 WASF2 WAS protein family, member 2 2 1
MIRT023757 FLNA filamin A, alpha 2 2
MIRT023758 IGFBP7 insulin-like growth factor binding protein 7 1 1
MIRT023759 FBN1 fibrillin 1 1 1
MIRT023760 PNN pinin, desmosome associated protein 1 1
MIRT023761 NCS1 neuronal calcium sensor 1 1 1
MIRT023762 WDR33 WD repeat domain 33 1 1
MIRT023763 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT023764 RAB27B RAB27B, member RAS oncogene family 1 1
MIRT023765 MAN1B1 mannosidase, alpha, class 1B, member 1 1 1
MIRT023766 OASL 2'-5'-oligoadenylate synthetase-like 1 1
MIRT023767 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT023768 TMEM87A transmembrane protein 87A 1 1
MIRT023769 TUBB2B tubulin, beta 2B 1 1
MIRT023770 SNRNP35 small nuclear ribonucleoprotein 35kDa (U11/U12) 1 1
MIRT023771 ZNF799 zinc finger protein 799 1 1
MIRT023772 C6orf118 chromosome 6 open reading frame 118 1 1
MIRT023773 HERC2 hect domain and RLD 2 1 1
MIRT023774 HINT2 histidine triad nucleotide binding protein 2 1 1
MIRT023775 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 1
MIRT023776 DPY30 dpy-30 homolog (C. elegans) 1 1
MIRT023777 RGN regucalcin (senescence marker protein-30) 1 1
MIRT023778 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT023779 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit 1 1
MIRT023780 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT023781 SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 1 1
MIRT023782 PLK2 polo-like kinase 2 (Drosophila) 1 1
MIRT023783 IQCD IQ motif containing D 1 1
MIRT023784 CCDC134 coiled-coil domain containing 134 1 1
MIRT023785 ORMDL2 ORM1-like 2 (S. cerevisiae) 1 1
MIRT023786 TRIM9 tripartite motif-containing 9 1 1
MIRT023787 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT023788 AIM2 absent in melanoma 2 1 1
MIRT023789 PHLDB2 pleckstrin homology-like domain, family B, member 2 1 1
MIRT023790 TPD52L2 tumor protein D52-like 2 1 1
MIRT023791 LNPEP leucyl/cystinyl aminopeptidase 1 1
MIRT023792 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT023793 KIF4A kinesin family member 4A 1 1
MIRT023794 MIA2 melanoma inhibitory activity 2 1 1
MIRT023795 PARVA parvin, alpha 1 1
MIRT023796 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT023797 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT023798 FMNL3 formin-like 3 1 1
MIRT023799 EFR3A EFR3 homolog A (S. cerevisiae) 1 1
MIRT023800 CCND1 cyclin D1 1 1
MIRT023801 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT023802 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT023803 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 1 1
MIRT023804 SRSF6 splicing factor, arginine/serine-rich 6 1 1
MIRT023805 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT023806 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT023807 SRI sorcin 1 1
MIRT023808 E2F5 E2F transcription factor 5, p130-binding 1 1
MIRT023809 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT023810 SIGMAR1 sigma non-opioid intracellular receptor 1 2 1
MIRT023811 GPC1 glypican 1 2 1
MIRT023812 LEPREL4 synaptonemal complex protein SC65 2 1
MIRT023813 CCDC22 coiled-coil domain containing 22 2 1
MIRT023814 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT023815 PDCD10 programmed cell death 10 2 2
MIRT023816 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT023817 BRDT bromodomain, testis-specific 1 1
MIRT023818 PROCR protein C receptor, endothelial 1 1
MIRT023819 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT023820 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT023821 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT023822 BCL6B B-cell CLL/lymphoma 6, member B 1 1
MIRT023823 HSD17B8 hydroxysteroid (17-beta) dehydrogenase 8 1 1
MIRT023824 CXCL3 chemokine (C-X-C motif) ligand 3 1 1
MIRT023825 AMZ1 archaelysin family metallopeptidase 1 1 1
MIRT023826 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT023827 CLEC1A C-type lectin domain family 1, member A 1 1
MIRT023828 ANGPTL4 angiopoietin-like 4 1 1
MIRT023829 FRG1 FSHD region gene 1 1 1
MIRT023830 IL27RA interleukin 27 receptor, alpha 1 1
MIRT023831 CA3 carbonic anhydrase III, muscle specific 1 1
MIRT023832 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT023833 MME membrane metallo-endopeptidase 1 1
MIRT023834 ETNK1 ethanolamine kinase 1 1 1
MIRT023835 IFIT2 interferon-induced protein with tetratricopeptide repeats 2 1 1
MIRT023836 CRYGS crystallin, gamma S 1 1
MIRT023837 MCM2 minichromosome maintenance complex component 2 1 1
MIRT023838 GIMAP4 GTPase, IMAP family member 4 1 1
MIRT023839 ACTC1 actin, alpha, cardiac muscle 1 1 1
MIRT023840 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT023841 SMC4 structural maintenance of chromosomes 4 1 1
MIRT023842 YTHDF2 YTH domain family, member 2 1 1
MIRT023843 ERMN ermin, ERM-like protein 1 1
MIRT023844 RBM39 RNA binding motif protein 39 1 1
MIRT023845 IFI44 interferon-induced protein 44 1 1
MIRT023846 TPSD1 tryptase delta 1 1 1
MIRT023847 DROSHA ribonuclease type III, nuclear 1 1
MIRT023848 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT023849 NUAK1 NUAK family, SNF1-like kinase, 1 1 1
MIRT023850 ZNF207 zinc finger protein 207 1 1
MIRT023851 GNRHR gonadotropin-releasing hormone receptor 1 1
MIRT023852 LEMD3 LEM domain containing 3 1 1
MIRT023853 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT023854 RHOC ras homolog gene family, member C 1 1
MIRT023855 RAB30 RAB30, member RAS oncogene family 1 1
MIRT023856 SCN3A sodium channel, voltage-gated, type III, alpha subunit 1 1
MIRT023857 PRKG2 protein kinase, cGMP-dependent, type II 1 1
MIRT023858 PLCB3 phospholipase C, beta 3 (phosphatidylinositol-specific) 1 1
MIRT023859 PIR pirin (iron-binding nuclear protein) 1 1
MIRT023860 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT023861 FUBP3 far upstream element (FUSE) binding protein 3 1 1
MIRT023862 HSD17B11 hydroxysteroid (17-beta) dehydrogenase 11 1 1
MIRT023863 FMNL2 formin-like 2 1 1
MIRT023864 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT023865 MRFAP1 Mof4 family associated protein 1 2 1
MIRT023866 CETN3 centrin, EF-hand protein, 3 (CDC31 homolog, yeast) 2 1
MIRT023867 SDPR serum deprivation response 1 1
MIRT023868 LIMS1 LIM and senescent cell antigen-like domains 1 2 1
MIRT023869 SUGP1 splicing factor 4 2 1
MIRT023870 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 2 1
MIRT023871 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 2 1
MIRT023872 CTTN cortactin 2 2
MIRT023873 ZNF48 zinc finger protein 48 1 1
MIRT023874 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 1 1
MIRT023875 POLR2I polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa 1 1
MIRT023876 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT023877 MFN2 mitofusin 2 1 1
MIRT023878 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT023879 MTHFS 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) 1 1
MIRT023880 RPP40 ribonuclease P/MRP 40kDa subunit 1 1
MIRT023881 MINPP1 multiple inositol-polyphosphate phosphatase 1 1 1
MIRT023882 RRP36 chromosome 6 open reading frame 153 1 1
MIRT023883 ITGA1 integrin, alpha 1 1 1
MIRT023884 LCA5L Leber congenital amaurosis 5-like 1 1
MIRT023885 UBE2I ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 1 1
MIRT023886 DEFB125 defensin, beta 125 1 1
MIRT023887 TSPAN19 tetraspanin 19 1 1
MIRT023888 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT023889 S100A11 S100 calcium binding protein A11 1 1
MIRT023890 MCM7 minichromosome maintenance complex component 7 1 1
MIRT023891 AP1M1 adaptor-related protein complex 1, mu 1 subunit 1 1
MIRT023892 GSTO1 glutathione S-transferase omega 1 1 1
MIRT023893 CXCL2 chemokine (C-X-C motif) ligand 2 1 1
MIRT023894 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT023895 LRWD1 leucine-rich repeats and WD repeat domain containing 1 1 1
MIRT023896 STXBP3 syntaxin binding protein 3 1 1
MIRT023897 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT023898 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 1 1
MIRT023899 TAGLN transgelin 1 1
MIRT023900 EXOC3 exocyst complex component 3 1 1
MIRT023901 DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 1 1
MIRT023902 FADS1 fatty acid desaturase 1 1 1
MIRT023903 SLC26A7 solute carrier family 26, member 7 1 1
MIRT023904 TRPA1 transient receptor potential cation channel, subfamily A, member 1 1 1
MIRT023905 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT023906 CAPG capping protein (actin filament), gelsolin-like 1 1
MIRT023907 TLR4 toll-like receptor 4 1 1
MIRT023908 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 1
MIRT023909 TMEM68 transmembrane protein 68 1 1
MIRT023910 SLC35A5 solute carrier family 35, member A5 1 1
MIRT023911 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT023912 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT023913 PLEKHH2 pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 1 1
MIRT023914 DOK6 docking protein 6 1 1
MIRT023915 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT023916 SRSF7 splicing factor, arginine/serine-rich 7, 35kDa 1 1
MIRT023917 ZNF280C zinc finger protein 280C 1 1
MIRT023918 CAPRIN1 cell cycle associated protein 1 1 1
MIRT023919 CLTC clathrin, heavy chain (Hc) 1 1
MIRT023920 SMIM14 chromosome 4 open reading frame 34 1 1
MIRT023921 CHMP2A chromatin modifying protein 2A 2 1
MIRT023922 NUP160 nucleoporin 160kDa 2 1
MIRT023923 CTDNEP1 dullard homolog (Xenopus laevis) 2 1
MIRT023924 CNIH4 cornichon homolog 4 (Drosophila) 2 1
MIRT023925 EDF1 endothelial differentiation-related factor 1 2 1
MIRT023926 GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 2 1
MIRT023927 MYOCD myocardin 1 1
MIRT023928 ZNF622 zinc finger protein 622 2 1
MIRT023929 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 2 1
MIRT023930 CD2AP CD2-associated protein 2 1
MIRT023931 COPB1 coatomer protein complex, subunit beta 1 2 2
MIRT023932 HADH hydroxyacyl-CoA dehydrogenase 2 2
MIRT023933 GPAA1 glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) 1 1
MIRT023934 S100G S100 calcium binding protein G 1 1
MIRT023935 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT023936 NDUFS4 NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) 1 1
MIRT023937 HYI hydroxypyruvate isomerase homolog (E. coli) 1 1
MIRT023938 ELMOD2 ELMO/CED-12 domain containing 2 1 1
MIRT023939 NUP210 nucleoporin 210kDa 1 1
MIRT023940 GLI2 GLI family zinc finger 2 1 1
MIRT023941 HIF3A hypoxia inducible factor 3, alpha subunit 1 1
MIRT023942 RCOR2 REST corepressor 2 1 1
MIRT023943 SYPL1 synaptophysin-like 1 1 1
MIRT023944 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT023945 GPX1P1 glutathione peroxidase 1 pseudogene 1 1
MIRT023946 MCM4 minichromosome maintenance complex component 4 1 1
MIRT023947 HIST2H3D histone cluster 2, H3d 1 1
MIRT023948 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT023949 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT023950 PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 1 1
MIRT023951 FTSJ1 FtsJ homolog 1 (E. coli) 1 1
MIRT023952 REM2 RAS (RAD and GEM)-like GTP binding 2 1 1
MIRT023953 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 1
MIRT023954 ISG15 ISG15 ubiquitin-like modifier 1 1
MIRT023955 NT5E 5'-nucleotidase, ecto (CD73) 1 1
MIRT023956 PLGRKT chromosome 9 open reading frame 46 1 1
MIRT023957 PKD1L1 polycystic kidney disease 1 like 1 1 1
MIRT023958 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT023959 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT023960 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT023961 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT023962 MCM5 minichromosome maintenance complex component 5 1 1
MIRT023963 HIST2H3C histone cluster 2, H3c 1 1
MIRT023964 EFCAB1 EF-hand calcium binding domain 1 1 1
MIRT023965 LMNB1 lamin B1 1 1
MIRT023966 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT023967 FBXO45 F-box protein 45 1 1
MIRT023968 MYO18A myosin XVIIIA 1 1
MIRT023969 SMEK1 SMEK homolog 1, suppressor of mek1 (Dictyostelium) 1 1
MIRT023970 HERC5 hect domain and RLD 5 1 1
MIRT023971 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT023972 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT023973 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT023974 DDX42 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 1 1
MIRT023975 TTC17 tetratricopeptide repeat domain 17 1 1
MIRT023976 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT023977 AFAP1 actin filament associated protein 1 1 1
MIRT023978 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT023979 EML3 echinoderm microtubule associated protein like 3 1 1
MIRT023980 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023981 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT023982 XPOT exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT023983 ALG2 asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT023984 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT023985 OSTF1 osteoclast stimulating factor 1 1 1
MIRT023986 IST1 KIAA0174 2 1
MIRT023987 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT023988 PQBP1 polyglutamine binding protein 1 2 1
MIRT023989 BAX BCL2-associated X protein 2 1
MIRT023990 GNA13 guanine nucleotide binding protein (G protein), alpha 13 2 1
MIRT023991 FOLR1 folate receptor 1 (adult) 2 1
MIRT023992 PRDX2 peroxiredoxin 2 2 1
MIRT023993 AHNAK2 AHNAK nucleoprotein 2 2 1
MIRT023994 GNAT2 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 2 1
MIRT023995 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 1
MIRT023996 KRT75 keratin 75 2 1
MIRT023997 CTBP2 C-terminal binding protein 2 2 1
MIRT023998 DOLPP1 dolichyl pyrophosphate phosphatase 1 2 2
MIRT023999 CXCL1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) 1 1
MIRT024000 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT024001 FILIP1 filamin A interacting protein 1 1 1
MIRT024002 PPP1R16A protein phosphatase 1, regulatory (inhibitor) subunit 16A 1 1
MIRT024003 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT024004 ISG20 interferon stimulated exonuclease gene 20kDa 1 1
MIRT024005 PPAP2C phosphatidic acid phosphatase type 2C 1 1
MIRT024006 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT024007 RAB39B RAB39B, member RAS oncogene family 1 1
MIRT024008 HSD3B7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 1 1
MIRT024009 HIST3H3 histone cluster 3, H3 1 1
MIRT024010 MMS22L chromosome 6 open reading frame 167 1 1
MIRT024011 COTL1 coactosin-like 1 (Dictyostelium) 1 1
MIRT024012 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT024013 C12orf40 chromosome 12 open reading frame 40 1 1
MIRT024014 BRPF3 bromodomain and PHD finger containing, 3 1 1
MIRT024015 TRIM24 tripartite motif-containing 24 1 1
MIRT024016 GATA3 GATA binding protein 3 1 1
MIRT024017 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT024018 POLRMT polymerase (RNA) mitochondrial (DNA directed) 1 1
MIRT024019 TIGD4 tigger transposable element derived 4 1 1
MIRT024020 SRSF5 splicing factor, arginine/serine-rich 5 1 1
MIRT024021 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT024022 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 1 1
MIRT024023 RBM28 RNA binding motif protein 28 1 1
MIRT024024 CCDC102A coiled-coil domain containing 102A 1 1
MIRT024025 KIF2C kinesin family member 2C 1 1
MIRT024026 CTBP1 C-terminal binding protein 1 1 1
MIRT024027 MCM6 minichromosome maintenance complex component 6 1 1
MIRT024028 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT024029 FRMD7 FERM domain containing 7 1 1
MIRT024030 CBX2 chromobox homolog 2 (Pc class homolog, Drosophila) 1 1
MIRT024031 TKT transketolase 1 1
MIRT024032 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT024034 RSF1 remodeling and spacing factor 1 1 1
MIRT024035 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT024036 IPO9 importin 9 1 1
MIRT024037 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT024038 KIAA1522 KIAA1522 1 1
MIRT024039 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT024040 KDM2B lysine (K)-specific demethylase 2B 1 1
MIRT024041 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT024042 CDC42SE1 CDC42 small effector 1 1 1
MIRT024043 UNC119B unc-119 homolog B (C. elegans) 1 1
MIRT024044 CEBPZ CCAAT/enhancer binding protein (C/EBP), zeta 1 1
MIRT024045 CCDC170 chromosome 6 open reading frame 97 1 1
MIRT024046 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT024047 UBAC2 UBA domain containing 2 2 1
MIRT024048 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 2 1
MIRT024049 DCAKD dephospho-CoA kinase domain containing 2 1
MIRT024050 COL12A1 collagen, type XII, alpha 1 2 1
MIRT024051 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 2 1
MIRT024052 CAMK2G calcium/calmodulin-dependent protein kinase II gamma 2 1
MIRT024053 DBN1 drebrin 1 2 2
MIRT024054 CALM1 calmodulin 1 (phosphorylase kinase, delta) 2 2
MIRT024055 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT024056 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT024057 RGS17 regulator of G-protein signaling 17 1 1
MIRT024058 CCL2 chemokine (C-C motif) ligand 2 1 1
MIRT024059 SLC39A3 solute carrier family 39 (zinc transporter), member 3 1 1
MIRT024060 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT024061 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT024062 ISY1 ISY1 splicing factor homolog (S. cerevisiae) 1 1
MIRT024063 TBCD tubulin folding cofactor D 1 1
MIRT024064 NBL1 neuroblastoma, suppression of tumorigenicity 1 1 1
MIRT024065 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT024066 ATP13A1 ATPase type 13A1 1 1
MIRT024067 PLXNB2 plexin B2 1 1
MIRT024068 ZNF638 zinc finger protein 638 1 1
MIRT024069 ZNF568 zinc finger protein 568 1 1
MIRT024070 CDH13 cadherin 13, H-cadherin (heart) 1 1
MIRT024071 FAM167A family with sequence similarity 167, member A 1 1
MIRT024072 F11R F11 receptor 1 1
MIRT024073 KIAA1731 KIAA1731 1 1
MIRT024074 S100A16 S100 calcium binding protein A16 1 1
MIRT024075 TROVE2 TROVE domain family, member 2 1 1
MIRT024076 SDR39U1 short chain dehydrogenase/reductase family 39U, member 1 1 1
MIRT024077 VAMP7 vesicle-associated membrane protein 7 1 1
MIRT024078 RIN1 Ras and Rab interactor 1 1 1
MIRT024079 ARG1 arginase, liver 1 1
MIRT024080 DDT D-dopachrome tautomerase 1 1
MIRT024081 FOXN4 forkhead box N4 1 1
MIRT024082 SFN stratifin 1 1
MIRT024083 AKR1D1 aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase) 1 1
MIRT024084 RIPK2 receptor-interacting serine-threonine kinase 2 1 1
MIRT024085 L1CAM L1 cell adhesion molecule 1 1
MIRT024086 IL8 interleukin 8 1 1
MIRT024087 FIG4 FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) 1 1
MIRT024088 OARD1 chromosome 6 open reading frame 130 1 1
MIRT024089 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 1 1
MIRT024090 C2orf48 chromosome 2 open reading frame 48 1 1
MIRT024091 ARGLU1 arginine and glutamate rich 1 1 1
MIRT024092 C10orf137 chromosome 10 open reading frame 137 1 1
MIRT024093 DFNA5 deafness, autosomal dominant 5 1 1
MIRT024094 RXFP1 relaxin/insulin-like family peptide receptor 1 1 1
MIRT024095 SSR1 signal sequence receptor, alpha 1 1
MIRT024096 MIER1 mesoderm induction early response 1 homolog (Xenopus laevis) 1 1
MIRT024097 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT024098 ACTB actin, beta 1 1
MIRT024099 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT024100 CSNK2A2 casein kinase 2, alpha prime polypeptide 1 1
MIRT024101 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT024102 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT024103 THY1 Thy-1 cell surface antigen 2 1
MIRT024104 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 2 1
MIRT024105 C1orf27 chromosome 1 open reading frame 27 2 1
MIRT024106 FLNC filamin C, gamma 2 1
MIRT024107 CDK4 cyclin-dependent kinase 4 2 1
MIRT024108 CRIP2 cysteine-rich protein 2 2 2
MIRT024109 EPB41L2 erythrocyte membrane protein band 4.1-like 2 2 2
MIRT035536 SP1 Sp1 transcription factor 1 1
MIRT046543 FBXO22 F-box protein 22 1 1
MIRT046544 SOS2 son of sevenless homolog 2 (Drosophila) 1 1