Accession ID: MIRT000399 [miRNA, hsa-let-7g-5p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7gLinkOut: [miRBase ]
Synonyms LET7G, MIRNLET7G, hsa-let-7g, MIRLET7G
Description Homo sapiens let-7g stem-loop
Comment let-7g-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7g-5p
Mature Sequence 5| UGAGGUAGUAGUUUGUACAGUU |26
Evidence Experimental
Experiments Cloned
Putative hsa-let-7g-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_033360    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_033360|3'UTR
   1 TCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAA
  81 AGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTACAA
 161 GTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAGACT
 241 GTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGAGTT
 321 TTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATGCAG
 401 TTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTATTC
 481 TGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACATTGA
 561 GGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAATGTA
 641 AAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATTTTT
 721 TCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGATAA
 801 ATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATTTTG
 881 GGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAATTAA
 961 ATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATAGTT
1041 TTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAAGGC
1121 CAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTGTCA
1201 TGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGGTCC
1281 TGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAACTCA
1361 AAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAATCT
1441 CTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAATAAT
1521 GCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATGGCA
1601 TGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTTTGA
1681 GGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATGTAA
1761 TTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACACCAT
1841 CTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCTTCT
1921 TCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCCCTA
2001 ACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTTATT
2081 TCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGATGCT
2161 TTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTATCCA
2241 GTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACAGTA
2321 ATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTTTTT
2401 GGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCCAGG
2481 TTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTGTAT
2561 TTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTGGCC
2641 TCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAAGGC
2721 ACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTACTA
2801 AGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCAGCT
2881 CTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAGGAA
2961 TAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTATGT
3041 CAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAATAG
3121 TTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGATTTC
3201 TGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTCTAC
3281 ACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGTAGA
3361 TGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAGAGA
3441 TTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTTTTT
3521 TTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATTTGA
3601 GTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTATAG
3681 GTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTACAG
3761 TTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAACTT
3841 TTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATAATT
3921 GTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGGATA
4001 GCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAGTTC
4081 TTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAGGTA
4161 ATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAGAGC
4241 TAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCATTTT
4321 TCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTTGTA
4401 TAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTTTCC
4481 ATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAACTTT
4561 TAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAATTA
4641 TTGTAATGTAATAAAAATAGTTACAGTGAC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGA-CA-UGUUUGAUGA-UGGAGu 5'
            || ||  |:|||| || ||||| 
Target 5' ggCTGGTCTCGAACTCCTGACCTCa 3'
2595 - 2619 132.00 -19.30
2
miRNA  3' uuGACAUGUUUGAUGAUGGAGu 5'
            || ||| |: |||||::|| 
Target 5' ttCT-TACTAG-TACTATTTCt 3'
4337 - 4356 130.00 -9.00
3
miRNA  3' uuGACAUGUUUGAUGAUGGAGu 5'
            ||||   |:|| :|||||: 
Target 5' gaCTGT--TAGCTTTTACCTTa 3'
237 - 256 128.00 -17.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7g-5p :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Kumar, M. S. Erkeland, S. J. Pester, R. E. et al.
- Proc Natl Acad Sci U S A, 2008
Many microRNAs (miRNAs) target mRNAs involved in processes aberrant in tumorigenesis, such as proliferation, survival, and differentiation. In particular, the let-7 miRNA family has been proposed to function in tumor suppression, because reduced expression of let-7 family members is common in non-small cell lung cancer (NSCLC). Here, we show that let-7 functionally inhibits non-small cell tumor development. Ectopic expression of let-7g in K-Ras(G12D)-expressing murine lung cancer cells induced both cell cycle arrest and cell death. In tumor xenografts, we observed significant growth reduction of both murine and human non-small cell lung tumors when overexpression of let-7g was induced from lentiviral vectors. In let-7g expressing tumors, reductions in Ras family and HMGA2 protein levels were detected. Importantly, let-7g-mediated tumor suppression was more potent in lung cancer cell lines harboring oncogenic K-Ras mutations than in lines with other mutations. Ectopic expression of K-Ras(G12D) largely rescued let-7g mediated tumor suppression, whereas ectopic expression of HMGA2 was less effective. Finally, in an autochthonous model of NSCLC in the mouse, let-7g expression substantially reduced lung tumor burden.
LinkOut: [PMID: 18308936]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7g-5p :: KRAS    [ Functional MTI ]
Validation Method Other
Article - Chin, L. J. Ratner, E. Leng, S. Zhai, R. et al.
- Cancer Res, 2008
Lung cancer is the leading cause of cancer deaths worldwide, yet few genetic markers of lung cancer risk useful for screening exist. The let-7 family-of-microRNAs (miRNA) are global genetic regulators important in controlling lung cancer oncogene expression by binding to the 3' untranslated regions of their target mRNAs. The purpose of this study was to identify single nucleotide polymorphisms (SNP) that could modify let-7 binding and to assess the effect of such SNPs on target gene regulation and risk for non-small cell lung cancer (NSCLC). let-7 complementary sites (LCS) were sequenced in the KRAS 3' untranslated region from 74 NSCLC cases to identify mutations and SNPs that correlated with NSCLC. The allele frequency of a previously unidentified SNP at LCS6 was characterized in 2,433 people (representing 46 human populations). The frequency of the variant allele is 18.1% to 20.3% in NSCLC patients and 5.8% in world populations. The association between the SNP and the risk for NSCLC was defined in two independent case-control studies. A case-control study of lung cancer from New Mexico showed a 2.3-fold increased risk (confidence interval, 1.1-4.6; P = 0.02) for NSCLC cancer in patients who smoked <40 pack-years. This association was validated in a second independent case-control study. Functionally, the variant allele results in KRAS overexpression in vitro. The LCS6 variant allele in a KRAS miRANA complementary site is significantly associated with increased risk for NSCLC among moderate smokers and represents a new paradigm for let-7 miRNAs in lung cancer susceptibility.
LinkOut: [PMID: 18922928]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
308 hsa-let-7g-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000396 CDK6 cyclin-dependent kinase 6 1 1
MIRT000397 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000399 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT000472 COL1A2 collagen, type I, alpha 2 4 1
MIRT000475 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 3
MIRT002097 HMGA2 high mobility group AT-hook 2 5 6
MIRT003831 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 5 3
MIRT004489 CDKN2A cyclin-dependent kinase inhibitor 2A 4 1
MIRT004490 BCL2L1 BCL2-like 1 4 1
MIRT006161 GAB2 GRB2-associated binding protein 2 3 1
MIRT006162 FN1 fibronectin 1 3 1
MIRT006399 IL13 interleukin 13 2 1
MIRT024117 DAD1 defender against cell death 1 1 1
MIRT024118 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 2 3
MIRT024119 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 2 1
MIRT024120 BMI1 BMI1 polycomb ring finger oncogene 2 1
MIRT046555 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT046556 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046557 UBE3C ubiquitin protein ligase E3C 1 1
MIRT046558 RPL12 ribosomal protein L12 1 1
MIRT046559 SFT2D1 SFT2 domain containing 1 1 1
MIRT046560 MAP3K1 mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase 1 1
MIRT046561 BRD1 bromodomain containing 1 1 1
MIRT046562 AGO1 eukaryotic translation initiation factor 2C, 1 4 2
MIRT046563 RAB21 RAB21, member RAS oncogene family 1 1
MIRT046564 HMGB1 high mobility group box 1 1 1
MIRT046565 RRM2 ribonucleotide reductase M2 1 2
MIRT046566 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT046567 RANBP2 RAN binding protein 2 1 1
MIRT046568 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1
MIRT054642 CASP3 caspase 3, apoptosis-related cysteine peptidase 2 1
MIRT054662 THBS1 thrombospondin 1 4 2
MIRT054663 TGFBR1 transforming growth factor, beta receptor 1 3 1
MIRT054664 SMAD2 SMAD family member 2 3 1
MIRT063199 ADIPOR2 adiponectin receptor 2 1 1
MIRT065691 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 2
MIRT067403 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT068157 TXLNA taxilin alpha 1 1
MIRT068532 NHLRC3 NHL repeat containing 3 1 3
MIRT068792 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073008 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT073672 IGF1R insulin-like growth factor 1 receptor 1 4
MIRT076227 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT080402 ONECUT2 one cut homeobox 2 1 1
MIRT083304 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084979 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT094164 PCGF3 polycomb group ring finger 3 1 3
MIRT094464 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT095770 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT100096 ABT1 activator of basal transcription 1 1 4
MIRT112245 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118589 STK4 serine/threonine kinase 4 1 1
MIRT120924 PDE12 phosphodiesterase 12 1 4
MIRT123321 CALU calumenin 1 1
MIRT123980 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152281 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153856 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168587 HMGA1 high mobility group AT-hook 1 1 2
MIRT180606 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187721 SUOX sulfite oxidase 1 1
MIRT191407 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193104 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215724 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT218816 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT240333 UBXN2B UBX domain protein 2B 1 1
MIRT243476 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT244074 EDN1 endothelin 1 1 1
MIRT252334 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255318 CDV3 CDV3 homolog (mouse) 1 1
MIRT259280 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259483 TXLNG taxilin gamma 1 1
MIRT260711 CLDN12 claudin 12 1 3
MIRT264695 C11ORF57 chromosome 11 open reading frame 57 1 2
MIRT266216 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266629 CHTOP chromatin target of PRMT1 1 1
MIRT268842 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284531 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT294449 ZNF264 zinc finger protein 264 1 1
MIRT297445 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT300041 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300896 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303323 MXD1 MAX dimerization protein 1 1 1
MIRT309849 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322431 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324735 ACER2 alkaline ceramidase 2 1 1
MIRT402061 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437976 AKT2 v-akt murine thymoma viral oncogene homolog 2 3 1
MIRT438631 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT442018 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445656 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447134 KIF27 kinesin family member 27 1 1
MIRT448256 ZNF774 zinc finger protein 774 1 1
MIRT449009 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449951 FMNL3 formin-like 3 1 1
MIRT451153 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451622 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451691 C1RL complement component 1, r subcomponent-like 1 1
MIRT452090 NUCB2 nucleobindin 2 1 1
MIRT452429 QDPR quinoid dihydropteridine reductase 1 1
MIRT452941 DISC1 disrupted in schizophrenia 1 1 1
MIRT453399 RHD Rh blood group, D antigen 1 3
MIRT454162 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454278 FXN frataxin 1 1
MIRT454537 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454852 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455674 GLO1 glyoxalase I 1 1
MIRT457246 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457675 ZNF587 zinc finger protein 587 1 1
MIRT457885 THEM6 thioesterase superfamily member 6 1 2
MIRT458014 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458277 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT459734 RRM1 ribonucleotide reductase M1 1 1
MIRT460451 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460498 FAM105A family with sequence similarity 105, member A 1 3
MIRT460936 NOA1 nitric oxide associated 1 1 2
MIRT461090 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461167 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461362 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462380 YAE1D1 Yae1 domain containing 1 1 1
MIRT462778 ZNF8 zinc finger protein 8 1 1
MIRT463416 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463660 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464263 VCL vinculin 1 1
MIRT465128 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466187 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466723 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469100 RNF144B ring finger protein 144B 1 1
MIRT469716 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470420 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470681 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470863 PLXND1 plexin D1 1 1
MIRT471273 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471964 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472674 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT472734 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473130 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473238 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473826 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473938 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474026 LRRC20 leucine rich repeat containing 20 1 1
MIRT474503 KLHDC8B kelch domain containing 8B 1 1
MIRT474764 KIAA0930 KIAA0930 1 1
MIRT474909 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475329 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475377 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475731 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476546 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476979 FAM83G family with sequence similarity 83, member G 1 2
MIRT477680 EFHD2 EF-hand domain family, member D2 1 1
MIRT479748 CCND1 cyclin D1 1 1
MIRT481191 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481234 ATXN7L3 ataxin 7-like 3 1 1
MIRT481361 ATG9A autophagy related 9A 1 1
MIRT481386 ATG12 autophagy related 12 1 1
MIRT481650 AREL1 KIAA0317 1 1
MIRT481850 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482182 AHR aryl hydrocarbon receptor 1 1
MIRT482218 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485294 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486657 ZNF28 zinc finger protein 28 1 1
MIRT489411 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491858 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492212 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492627 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493327 LIMD2 LIM domain containing 2 1 1
MIRT493899 FAM43A family with sequence similarity 43, member A 1 2
MIRT494261 CEP120 centrosomal protein 120kDa 1 1
MIRT494683 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT495966 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496109 SNX17 sorting nexin 17 1 1
MIRT497873 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498120 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499403 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499491 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499651 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499940 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499995 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500905 STRN striatin, calmodulin binding protein 1 2
MIRT501114 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501177 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT501208 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501244 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501330 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501353 RNF44 ring finger protein 44 1 2
MIRT501391 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501436 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501756 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501947 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502105 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT502131 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502786 CEP135 centrosomal protein 135kDa 1 1
MIRT502844 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT504787 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT505021 ZNF644 zinc finger protein 644 1 1
MIRT505578 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506363 NUP155 nucleoporin 155kDa 1 3
MIRT506934 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507249 FIGN fidgetin 1 4
MIRT507695 COIL coilin 1 3
MIRT508399 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508663 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508930 AK4 adenylate kinase 4 1 2
MIRT510398 ZNF566 zinc finger protein 566 1 3
MIRT510517 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511384 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512743 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515952 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516081 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521388 RDX radixin 1 2
MIRT522347 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523624 FZD9 frizzled family receptor 9 1 2
MIRT523731 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523988 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524114 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525725 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527761 RRAD Ras-related associated with diabetes 1 1
MIRT529725 OPRL1 opiate receptor-like 1 1 1
MIRT533186 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536376 LEFTY1 left-right determination factor 1 1 1
MIRT543783 RBM12B RNA binding motif protein 12B 1 2
MIRT543866 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545385 PM20D2 peptidase M20 domain containing 2 1 1
MIRT545889 ZNF200 zinc finger protein 200 1 2
MIRT546331 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547376 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547574 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT547835 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT548263 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548349 EPHA4 EPH receptor A4 1 1
MIRT548530 DUSP1 dual specificity phosphatase 1 1 1
MIRT548558 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548778 COLEC12 collectin sub-family member 12 1 1
MIRT548973 CCNT2 cyclin T2 1 1
MIRT549023 CBX5 chromobox homolog 5 1 1
MIRT549210 BEND4 BEN domain containing 4 1 2
MIRT549761 ZNF611 zinc finger protein 611 1 3
MIRT549797 KIAA0391 KIAA0391 1 1
MIRT549845 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550725 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550896 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551281 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551316 GSG2 germ cell associated 2 (haspin) 1 3
MIRT551930 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT552001 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552408 ZNF460 zinc finger protein 460 1 2
MIRT553015 USP38 ubiquitin specific peptidase 38 1 1
MIRT555548 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555713 PDZD8 PDZ domain containing 8 1 1
MIRT557379 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT557963 FAM222B family with sequence similarity 222, member B 1 1
MIRT559083 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559495 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561780 PEG10 paternally expressed 10 1 1
MIRT564400 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565447 SURF4 surfeit 4 1 1
MIRT566516 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567433 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567713 E2F6 E2F transcription factor 6 1 1
MIRT568659 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569496 THYN1 thymocyte nuclear protein 1 1 1
MIRT573818 TGOLN2 trans-golgi network protein 2 1 1
MIRT574361 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574745 GOLGA4 golgin A4 1 1
MIRT574784 FAM104A family with sequence similarity 104, member A 1 1
MIRT576084 Poteg POTE ankyrin domain family, member G 1 1
MIRT576809 Thbs1 thrombospondin 1 1 1
MIRT616368 RWDD1 RWD domain containing 1 1 1
MIRT617849 FMO4 flavin containing monooxygenase 4 1 1
MIRT642392 ZNF556 zinc finger protein 556 1 1
MIRT680517 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680545 ZNF584 zinc finger protein 584 1 1
MIRT680798 ZNF578 zinc finger protein 578 1 1
MIRT680836 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681139 INTS7 integrator complex subunit 7 1 1
MIRT681269 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681321 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681357 BRI3BP BRI3 binding protein 1 1
MIRT681504 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681534 ZNF738 zinc finger protein 738 1 1
MIRT681656 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681736 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681759 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681795 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681867 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681939 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682100 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682179 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682236 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682382 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682442 MTX3 metaxin 3 1 1
MIRT682602 CPA4 carboxypeptidase A4 1 1
MIRT682638 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689325 FPR1 formyl peptide receptor 1 1 1
MIRT689728 ATXN2 ataxin 2 1 1
MIRT691034 ZNF799 zinc finger protein 799 1 1
MIRT691933 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694882 ZNF417 zinc finger protein 417 1 1
MIRT695253 ZNF443 zinc finger protein 443 1 1
MIRT695411 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700591 PRSS22 protease, serine, 22 1 1
MIRT701432 NHLRC2 NHL repeat containing 2 1 1
MIRT702482 KIAA1328 KIAA1328 1 1
MIRT702708 IPO9 importin 9 1 1
MIRT704033 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704421 CTPS1 CTP synthase 1 1 1
MIRT705748 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712368 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713518 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*