Accession ID: MIRT000399 [miRNA, hsa-let-7g-5p :: KRAS, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7gLinkOut: [miRBase ]
Synonyms LET7G, MIRNLET7G, hsa-let-7g, MIRLET7G
Description Homo sapiens let-7g stem-loop
Comment let-7g-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7g-5p
Mature Sequence 5| UGAGGUAGUAGUUUGUACAGUU |26
Evidence Experimental
Experiments Cloned
Putative hsa-let-7g-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KRAS LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RASK2
Description v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Transcript NM_0333    LinkOut: [ RefSeq ]
Other Transcripts NM_0049   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KRAS LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KRAS
(miRNA target sites are highlighted)
>KRAS|NM_0333|3'UTR
   1 TAATCTGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTA
  81 AAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAAATACAATTTGTACTTTTTTCTTAAGGCATACTAGTA
 161 CAAGTGGTAATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAGCATTACCTAATTTTTTTCCTGCTCCATGCAG
 241 ACTGTTAGCTTTTACCTTAAATGCTTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCCCAGA
 321 GTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATACCTAAGATTTCTGTCTTGGGGTTTTTGGTGCATG
 401 CAGTTGATTACTTCTTATTTTTCTTACCAATTGTGAATGTTGGTGTGAAACAAATTAATGAAGCTTTTGAATCATCCCTA
 481 TTCTGTGTTTTATCTAGTCACATAAATGGATTAATTACTAATTTCAGTTGAGACCTTCTAATTGGTTTTTACTGAAACAT
 561 TGAGGGAACACAAATTTATGGGCTTCCTGATGATGATTCTTCTAGGCATCATGTCCTATAGTTTGTCATCCCTGATGAAT
 641 GTAAAGTTACACTGTTCACAAAGGTTTTGTCTCCTTTCCACTGCTATTAGTCATGGTCACTCTCCCCAAAATATTATATT
 721 TTTTCTATAAAAAGAAAAAAATGGAAAAAAATTACAAGGCAATGGAAACTATTATAAGGCCATTTCCTTTTCACATTAGA
 801 TAAATTACTATAAAGACTCCTAATAGCTTTTCCTGTTAAGGCAGACCCAGTATGAAATGGGGATTATTATAGCAACCATT
 881 TTGGGGCTATATTTACATGCTACTAAATTTTTATAATAATTGAAAAGATTTTAACAAGTATAAAAAATTCTCATAGGAAT
 961 TAAATGTAGTCTCCCTGTGTCAGACTGCTCTTTCATAGTATAACTTTAAATCTTTTCTTCAACTTGAGTCTTTGAAGATA
1041 GTTTTAATTCTGCTTGTGACATTAAAAGATTATTTGGGCCAGTTATAGCTTATTAGGTGTTGAAGAGACCAAGGTTGCAA
1121 GGCCAGGCCCTGTGTGAACCTTTGAGCTTTCATAGAGAGTTTCACAGCATGGACTGTGTCCCCACGGTCATCCAGTGTTG
1201 TCATGCATTGGTTAGTCAAAATGGGGAGGGACTAGGGCAGTTTGGATAGCTCAACAAGATACAATCTCACTCTGTGGTGG
1281 TCCTGCTGACAAATCAAGAGCATTGCTTTTGTTTCTTAAGAAAACAAACTCTTTTTTAAAAATTACTTTTAAATATTAAC
1361 TCAAAAGTTGAGATTTTGGGGTGGTGGTGTGCCAAGACATTAATTTTTTTTTTAAACAATGAAGTGAAAAAGTTTTACAA
1441 TCTCTAGGTTTGGCTAGTTCTCTTAACACTGGTTAAATTAACATTGCATAAACACTTTTCAAGTCTGATCCATATTTAAT
1521 AATGCTTTAAAATAAAAATAAAAACAATCCTTTTGATAAATTTAAAATGTTACTTATTTTAAAATAAATGAAGTGAGATG
1601 GCATGGTGAGGTGAAAGTATCACTGGACTAGGAAGAAGGTGACTTAGGTTCTAGATAGGTGTCTTTTAGGACTCTGATTT
1681 TGAGGACATCACTTACTATCCATTTCTTCATGTTAAAAGAAGTCATCTCAAACTCTTAGTTTTTTTTTTTTACAACTATG
1761 TAATTTATATTCCATTTACATAAGGATACACTTATTTGTCAAGCTCAGCACAATCTGTAAATTTTTAACCTATGTTACAC
1841 CATCTTCAGTGCCAGTCTTGGGCAAAATTGTGCAAGAGGTGAAGTTTATATTTGAATATCCATTCTCGTTTTAGGACTCT
1921 TCTTCCATATTAGTGTCATCTTGCCTCCCTACCTTCCACATGCCCCATGACTTGATGCAGTTTTAATACTTGTAATTCCC
2001 CTAACCATAAGATTTACTGCTGCTGTGGATATCTCCATGAAGTTTTCCCACTGAGTCACATCAGAAATGCCCTACATCTT
2081 ATTTCCTCAGGGCTCAAGAGAATCTGACAGATACCATAAAGGGATTTGACCTAATCACTAATTTTCAGGTGGTGGCTGAT
2161 GCTTTGAACATCTCTTTGCTGCCCAATCCATTAGCGACAGTAGGATTTTTCAAACCTGGTATGAATAGACAGAACCCTAT
2241 CCAGTGGAAGGAGAATTTAATAAAGATAGTGCTGAAAGAATTCCTTAGGTAATCTATAACTAGGACTACTCCTGGTAACA
2321 GTAATACATTCCATTGTTTTAGTAACCAGAAATCTTCATGCAATGAAAAATACTTTAATTCATGAAGCTTACTTTTTTTT
2401 TTTGGTGTCAGAGTCTCGCTCTTGTCACCCAGGCTGGAATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCC
2481 AGGTTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTG
2561 TATTTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATTCACCCACCTTG
2641 GCCTCATAAACCTGTTTTGCAGAACTCATTTATTCAGCAAATATTTATTGAGTGCCTACCAGATGCCAGTCACCGCACAA
2721 GGCACTGGGTATATGGTATCCCCAAACAAGAGACATAATCCCGGTCCTTAGGTAGTGCTAGTGTGGTCTGTAATATCTTA
2801 CTAAGGCCTTTGGTATACGACCCAGAGATAACACGATGCGTATTTTAGTTTTGCAAAGAAGGGGTTTGGTCTCTGTGCCA
2881 GCTCTATAATTGTTTTGCTACGATTCCACTGAAACTCTTCGATCAAGCTACTTTATGTAAATCACTTCATTGTTTTAAAG
2961 GAATAAACTTGATTATATTGTTTTTTTATTTGGCATAACTGTGATTCTTTTAGGACAATTACTGTACACATTAAGGTGTA
3041 TGTCAGATATTCATATTGACCCAAATGTGTAATATTCCAGTTTTCTCTGCATAAGTAATTAAAATATACTTAAAAATTAA
3121 TAGTTTTATCTGGGTACAAATAAACAGGTGCCTGAACTAGTTCACAGACAAGGAAACTTCTATGTAAAAATCACTATGAT
3201 TTCTGAATTGCTATGTGAAACTACAGATCTTTGGAACACTGTTTAGGTAGGGTGTTAAGACTTACACAGTACCTCGTTTC
3281 TACACAGAGAAAGAAATGGCCATACTTCAGGAACTGCAGTGCTTATGAGGGGATATTTAGGCCTCTTGAATTTTTGATGT
3361 AGATGGGCATTTTTTTAAGGTAGTGGTTAATTACCTTTATGTGAACTTTGAATGGTTTAACAAAAGATTTGTTTTTGTAG
3441 AGATTTTAAAGGGGGAGAATTCTAGAAATAAATGTTACCTAATTATTACAGCCTTAAAGACAAAAATCCTTGTTGAAGTT
3521 TTTTTAAAAAAAGCTAAATTACATAGACTTAGGCATTAACATGTTTGTGGAAGAATATAGCAGACGTATATTGTATCATT
3601 TGAGTGAATGTTCCCAAGTAGGCATTCTAGGCTCTATTTAACTGAGTCACACTGCATAGGAATTTAGAACCTAACTTTTA
3681 TAGGTTATCAAAACTGTTGTCACCATTGCACAATTTTGTCCTAATATATACATAGAAACTTTGTGGGGCATGTTAAGTTA
3761 CAGTTTGCACAAGTTCATCTCATTTGTATTCCATTGATTTTTTTTTTCTTCTAAACATTTTTTCTTCAAACAGTATATAA
3841 CTTTTTTTAGGGGATTTTTTTTTAGACAGCAAAAACTATCTGAAGATTTCCATTTGTCAAAAAGTAATGATTTCTTGATA
3921 ATTGTGTAGTAATGTTTTTTAGAACCCAGCAGTTACCTTAAAGCTGAATTTATATTTAGTAACTTCTGTGTTAATACTGG
4001 ATAGCATGAATTCTGCATTGAGAAACTGAATAGCTGTCATAAAATGAAACTTTCTTTCTAAAGAAAGATACTCACATGAG
4081 TTCTTGAAGAATAGTCATAACTAGATTAAGATCTGTGTTTTAGTTTAATAGTTTGAAGTGCCTGTTTGGGATAATGATAG
4161 GTAATTTAGATGAATTTAGGGGAAAAAAAAGTTATCTGCAGATATGTTGAGGGCCCATCTCTCCCCCCACACCCCCACAG
4241 AGCTAACTGGGTTACAGTGTTTTATCCGAAAGTTTCCAATTCCACTGTCTTGTGTTTTCATGTTGAAAATACTTTTGCAT
4321 TTTTCCTTTGAGTGCCAATTTCTTACTAGTACTATTTCTTAATGTAACATGTTTACCTGGAATGTATTTTAACTATTTTT
4401 GTATAGTGTAAACTGAAACATGCACATTTTGTACATTGTGCTTTCTTTTGTGGGACATATGCAGTGTGATCCAGTTGTTT
4481 TCCATCATTTGGTTGCGCTGACCTAGGAATGTTGGTCATATCAAACATTAAAAATGACCACTCTTTTAATTGAAATTAAC
4561 TTTTAAATGTTTATAGGAGTATGTGCTGTGAAGTGATCTAAAATTTGTAATATTTTTGTCATGAACTGTACTACTCCTAA
4641 TTATTGTAATGTAATAAAAATAGTTACAGTGACAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGA-CA-UGUUUGAUGA-UGGAGu 5'
            || ||  |:|||| || ||||| 
Target 5' ggCTGGTCTCGAACTCCTGACCTCa 3'
2598 - 2622 132.00 -19.30
2
miRNA  3' uuGACAUGUUUGAUGAUGGAGu 5'
            || ||| |: |||||::|| 
Target 5' ttCT-TACTAG-TACTATTTCt 3'
4340 - 4359 130.00 -9.00
3
miRNA  3' uuGACAUGUUUGAUGAUGGAGu 5'
            ||||   |:|| :|||||: 
Target 5' gaCTGT--TAGCTTTTACCTTa 3'
240 - 259 128.00 -17.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7g-5p :: KRAS    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Kumar, M. S. Erkeland, S. J. Pester, R. E. et al.
- Proc Natl Acad Sci U S A, 2008
Many microRNAs (miRNAs) target mRNAs involved in processes aberrant in tumorigenesis, such as proliferation, survival, and differentiation. In particular, the let-7 miRNA family has been proposed to function in tumor suppression, because reduced expression of let-7 family members is common in non-small cell lung cancer (NSCLC). Here, we show that let-7 functionally inhibits non-small cell tumor development. Ectopic expression of let-7g in K-Ras(G12D)-expressing murine lung cancer cells induced both cell cycle arrest and cell death. In tumor xenografts, we observed significant growth reduction of both murine and human non-small cell lung tumors when overexpression of let-7g was induced from lentiviral vectors. In let-7g expressing tumors, reductions in Ras family and HMGA2 protein levels were detected. Importantly, let-7g-mediated tumor suppression was more potent in lung cancer cell lines harboring oncogenic K-Ras mutations than in lines with other mutations. Ectopic expression of K-Ras(G12D) largely rescued let-7g mediated tumor suppression, whereas ectopic expression of HMGA2 was less effective. Finally, in an autochthonous model of NSCLC in the mouse, let-7g expression substantially reduced lung tumor burden.
LinkOut: [PMID: 18308936]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7g-5p :: KRAS    [ Functional MTI ]
Validation Method Other
Article - Chin, L. J. Ratner, E. Leng, S. Zhai, R. et al.
- Cancer Res, 2008
Lung cancer is the leading cause of cancer deaths worldwide, yet few genetic markers of lung cancer risk useful for screening exist. The let-7 family-of-microRNAs (miRNA) are global genetic regulators important in controlling lung cancer oncogene expression by binding to the 3' untranslated regions of their target mRNAs. The purpose of this study was to identify single nucleotide polymorphisms (SNP) that could modify let-7 binding and to assess the effect of such SNPs on target gene regulation and risk for non-small cell lung cancer (NSCLC). let-7 complementary sites (LCS) were sequenced in the KRAS 3' untranslated region from 74 NSCLC cases to identify mutations and SNPs that correlated with NSCLC. The allele frequency of a previously unidentified SNP at LCS6 was characterized in 2,433 people (representing 46 human populations). The frequency of the variant allele is 18.1% to 20.3% in NSCLC patients and 5.8% in world populations. The association between the SNP and the risk for NSCLC was defined in two independent case-control studies. A case-control study of lung cancer from New Mexico showed a 2.3-fold increased risk (confidence interval, 1.1-4.6; P = 0.02) for NSCLC cancer in patients who smoked <40 pack-years. This association was validated in a second independent case-control study. Functionally, the variant allele results in KRAS overexpression in vitro. The LCS6 variant allele in a KRAS miRANA complementary site is significantly associated with increased risk for NSCLC among moderate smokers and represents a new paradigm for let-7 miRNAs in lung cancer susceptibility.
LinkOut: [PMID: 18922928]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
30 hsa-let-7g-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000396 CDK6 cyclin-dependent kinase 6 1 1
MIRT000397 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000399 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT000472 COL1A2 collagen, type I, alpha 2 4 1
MIRT000475 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 2
MIRT002097 HMGA2 high mobility group AT-hook 2 4 3
MIRT003831 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 4 2
MIRT004489 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 4 1
MIRT004490 BCL2L1 BCL2-like 1 4 1
MIRT006161 GAB2 GRB2-associated binding protein 2 3 1
MIRT006162 FN1 fibronectin 1 3 1
MIRT006399 IL13 interleukin 13 2 1
MIRT024117 DAD1 defender against cell death 1 1 1
MIRT024118 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT024119 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 2 1
MIRT024120 BMI1 BMI1 polycomb ring finger oncogene 2 1
MIRT046555 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT046556 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046557 UBE3C ubiquitin protein ligase E3C 1 1
MIRT046558 RPL12 ribosomal protein L12 1 1
MIRT046559 SFT2D1 SFT2 domain containing 1 1 1
MIRT046560 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT046561 BRD1 bromodomain containing 1 1 1
MIRT046562 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT046563 RAB21 RAB21, member RAS oncogene family 1 1
MIRT046564 HMGB1 high-mobility group box 1 1 1
MIRT046565 RRM2 ribonucleotide reductase M2 1 1
MIRT046566 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT046567 RANBP2 RAN binding protein 2 1 1
MIRT046568 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1