Accession ID: MIRT000426 [miRNA, hsa-miR-145-5p :: MUC1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-145LinkOut: [miRBase ]
Synonyms MIRN145, miR-145, miRNA145, MIR145
Description Homo sapiens miR-145 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-145-5p
Mature Sequence 16| GUCCAGUUUUCCCAGGAAUCCCU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-145-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MUC1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD227, EMA, H23AG, KL-6, MAM6, PEM, PEMT, PUM
Description mucin 1, cell surface associated
Transcript NM_0010443    LinkOut: [ RefSeq ]
Other Transcripts NM_0010180 , NM_0010180 , NM_0010443 , NM_0010443 , NM_0010443 , NM_0024   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MUC1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MUC1
(miRNA target sites are highlighted)
>MUC1|NM_0010443|3'UTR
   1 TAGCAGTACCGATCGTAGCCCCTATGAGAAGGTTTCTGCAGGTAATGGTGGCAGCAGCCTCTCTTACACAAACCCAGCAG
  81 TGGCAGCCACTTCTGCCAACTTGTAGGGGCACGTCGCCCGCTGAGCTGAGTGGCCAGCCAGTGCCATTCCACTCCACTCA
 161 GGTTCTTCAGGGCCAGAGCCCCTGCACCCTGTTTGGGCTGGTGAGCTGGGAGTTCAGGTGGGCTGCTCACAGCCTCCTTC
 241 AGAGGCCCCACCAATTTCTCGGACACTTCTCAGTGTGTGGAAGCTCATGTGGGCCCCTGAGGGCTCATGCCTGGGAAGTG
 321 TTGTGGTGGGGGCTCCCAGGAGGACTGGCCCAGAGAGCCCTGAGATAGCGGGGATCCTGAACTGGACTGAATAAAACGTG
 401 GTCTCCCACTGCGCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145-5p :: MUC1    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , qRT-PCR , Western blot , Other , Reporter assay
Conditions LM2-4142 , BT-549 , MDA-MB-231
Disease Breast Cancer;
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... miR-145 directly targets MUC1 ...

- Sachdeva, M. Mo, Y. Y., 2010, Cancer Res.

Article - Sachdeva, M. Mo, Y. Y.
- Cancer Res, 2010
MicroRNAs are important gene regulators that could play a profound role in tumorigenesis. Our previous studies indicate that miR-145 is a tumor suppressor capable of inhibiting tumor cell growth both in vitro and in vivo. In this study, we show that miR-145 exerts its function in a cell-specific manner. Although miR-145 inhibits cell growth in MCF-7 and HCT-116 cells, it has no significant effect on cell growth in metastatic breast cancer cell lines. However, miR-145 significantly suppresses cell invasion in these cells; in contrast, the antisense oligo against miR-145 increases cell invasion. miR-145 is also able to suppress lung metastasis in an experimental metastasis animal model. This miR-145-mediated suppression of cell invasion is in part due to the silencing of the metastasis gene mucin 1 (MUC1). Using luciferase reporters carrying the 3'-untranslated region of MUC1 combined with Western blot and immunofluorescence staining, we identify MUC1 as a direct target of miR-145. Moreover, ectopic expression of MUC1 enhances cell invasion, which can be blocked by miR-145. Of interest, suppression of MUC1 by miR-145 causes a reduction of beta-catenin as well as the oncogenic cadherin 11. Finally, suppression of MUC1 by RNAi mimics the miR-145 action in suppression of invasion, which is associated with downregulation of beta-catenin and cadherin 11. Taken together, these results suggest that as a tumor suppressor, miR-145 inhibits not only tumor growth but also cell invasion and metastasis.
LinkOut: [PMID: 19996288]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145-5p :: MUC1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Location of target site 3'UTR
Original Description (Extracted from the article) ... This miR-145-mediated suppression of cell invasion is in part due to the silencing of the metastasis gene mucin 1 (MUC1). This finding was supported by luciferase reporters carrying the 3′-UTR of MUC1, Western blot and immunofluorescence staining. ...

- Sachdeva, M. Mo, Y. Y., 2010, Am J Transl Res.

Article - Sachdeva, M. Mo, Y. Y.
- Am J Transl Res, 2010
MicroRNAs are a large group of negative gene regulators that work through a posttranscriptional repression mechanism. Evidence indicates that microRNAs play a fundamental role in a wide range of biological functions such as cellular proliferation, differentiation and apoptosis. In cancer, microRNAs may function as tumor suppressors and oncogenes, and therefore, they are referred to as 'oncomiRs'. In support of this notion, we have shown that miR-145 is underexpressed in tumor tissues and is capable of inhibiting tumor cell growth and invasion by targeting several genes such as c-Myc and mucin 1. This unique feature of miR-145-mediaed gene silencing may suggest that miR-145 is a potential cancer biomarker and serves as a novel target for cancer therapy.
LinkOut: [PMID: 20407606]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
104 hsa-miR-145-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000305 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 4 1
MIRT000306 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT000307 SOX2 SRY (sex determining region Y)-box 2 4 2
MIRT000308 KLF4 Kruppel-like factor 4 (gut) 4 2
MIRT000426 MUC1 mucin 1, cell surface associated 4 2
MIRT000457 MYO6 myosin VI 4 1
MIRT000575 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT000626 STAT1 signal transducer and activator of transcription 1, 91kDa 5 1
MIRT000627 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 5 3
MIRT000676 CBFB core-binding factor, beta subunit 4 2
MIRT000677 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 4 1
MIRT000678 CLINT1 clathrin interactor 1 4 1
MIRT000731 IRS1 insulin receptor substrate 1 4 5
MIRT000732 PARP8 poly (ADP-ribose) polymerase family, member 8 2 2
MIRT001811 TMOD3 tropomodulin 3 (ubiquitous) 2 1
MIRT001917 HOXA9 homeobox A9 4 1
MIRT003325 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 3 2
MIRT003543 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 5 5
MIRT004290 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 2
MIRT004496 FLI1 Friend leukemia virus integration 1 4 3
MIRT004580 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 4 1
MIRT004616 IFNB1 interferon, beta 1, fibroblast 3 1
MIRT004748 TIRAP toll-interleukin 1 receptor (TIR) domain containing adaptor protein 2 1
MIRT004904 POU5F1 POU class 5 homeobox 1 3 4
MIRT004931 IGF1R insulin-like growth factor 1 receptor 3 2
MIRT004938 KRT7 keratin 7 2 1
MIRT005683 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT005688 C11orf9 chromosome 11 open reading frame 9 1 1
MIRT005689 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT005690 FZD7 frizzled homolog 7 (Drosophila) 1 1
MIRT005809 ROBO2 roundabout, axon guidance receptor, homolog 2 (Drosophila) 3 1
MIRT005810 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 3 1
MIRT005878 EIF4E eukaryotic translation initiation factor 4E 3 1
MIRT005879 CDK4 cyclin-dependent kinase 4 3 1
MIRT006215 VEGFA vascular endothelial growth factor A 3 1
MIRT006317 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 3 1
MIRT006332 IRS2 insulin receptor substrate 2 1 1
MIRT006494 ITGB8 integrin, beta 8 4 1
MIRT006747 SWAP70 SWAP switching B-cell complex 70kDa subunit 4 2
MIRT006774 ESR1 estrogen receptor 1 1 1
MIRT006788 NUDT1 nudix (nucleoside diphosphate linked moiety X)-type motif 1 3 1
MIRT006847 JAG1 jagged 1 (Alagille syndrome) 4 1
MIRT006889 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 3 2
MIRT006899 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 3 1
MIRT006903 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 3 1
MIRT007094 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 1 1
MIRT007107 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 2 1
MIRT007180 ILK integrin-linked kinase 3 1
MIRT007247 CTGF connective tissue growth factor 1 1
MIRT007248 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT007257 MDM2 Mdm2 p53 binding protein homolog (mouse) 1 1
MIRT007275 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT007288 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 2 1
MIRT007307 HDAC2 histone deacetylase 2 1 1
MIRT021492 FBXO28 F-box protein 28 1 1
MIRT021493 USP46 ubiquitin specific peptidase 46 1 1
MIRT021494 ACBD3 acyl-CoA binding domain containing 3 1 1
MIRT021495 ELK1 ELK1, member of ETS oncogene family 1 1
MIRT021496 CCNA2 cyclin A2 1 1
MIRT021497 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT021498 CCDC25 coiled-coil domain containing 25 1 1
MIRT021499 RTKN rhotekin 4 1
MIRT021500 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT021501 F11R F11 receptor 2 2
MIRT021502 ARL6IP5 ADP-ribosylation-like factor 6 interacting protein 5 2 1
MIRT021503 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 2 1
MIRT021504 C11orf65 chromosome 11 open reading frame 65 2 1
MIRT021505 HLTF helicase-like transcription factor 2 1
MIRT021506 GMFB glia maturation factor, beta 2 1
MIRT021507 SERINC5 serine incorporator 5 2 1
MIRT021508 MEST mesoderm specific transcript homolog (mouse) 2 1
MIRT021509 ALPPL2 alkaline phosphatase, placental-like 2 2 1
MIRT021510 NDRG2 NDRG family member 2 2 1
MIRT021511 DTD1 D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) 2 1
MIRT021512 TPM3 tropomyosin 3 2 1
MIRT021513 MAP2K6 mitogen-activated protein kinase kinase 6 2 1
MIRT021514 CEP19 chromosome 3 open reading frame 34 2 1
MIRT021515 TPRG1 tumor protein p63 regulated 1 2 1
MIRT021516 GOLM1 golgi membrane protein 1 2 1
MIRT021517 CCDC43 coiled-coil domain containing 43 2 1
MIRT021518 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 2 1
MIRT021519 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 1
MIRT021520 TMEM9B TMEM9 domain family, member B 2 1
MIRT021521 MMP12 matrix metallopeptidase 12 (macrophage elastase) 2 1
MIRT021522 MTMR14 myotubularin related protein 14 2 1
MIRT021523 ALDH3A1 aldehyde dehydrogenase 3 family, member A1 2 1
MIRT021524 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 2 1
MIRT021525 FAM3C family with sequence similarity 3, member C 2 1
MIRT021526 LYPLA2 lysophospholipase II 2 1
MIRT021527 FAM45A family with sequence similarity 45, member A 2 1
MIRT021528 PIGF phosphatidylinositol glycan anchor biosynthesis, class F 2 1
MIRT021529 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 2 1
MIRT021530 PHF17 PHD finger protein 17 2 1
MIRT021531 NIPSNAP1 nipsnap homolog 1 (C. elegans) 2 1
MIRT021532 KREMEN1 kringle containing transmembrane protein 1 2 1
MIRT021533 MMP14 matrix metallopeptidase 14 (membrane-inserted) 2 1
MIRT021534 ABRACL chromosome 6 open reading frame 115 2 1
MIRT021535 MIXL1 Mix1 homeobox-like 1 (Xenopus laevis) 2 1
MIRT021536 TSPAN6 tetraspanin 6 2 1
MIRT021537 PODXL podocalyxin-like 2 1
MIRT021538 APH1A anterior pharynx defective 1 homolog A (C. elegans) 2 1
MIRT021539 ABHD17C family with sequence similarity 108, member C1 2 1
MIRT035522 NANOG Nanog homeobox 1 1
MIRT035535 MYO5A myosin VA (heavy chain 12, myoxin) 1 1