Accession ID: MIRT000426 [miRNA, hsa-miR-145-5p :: MUC1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-145LinkOut: [miRBase ]
Synonyms MIRN145, miR-145, miRNA145, MIR145
Description Homo sapiens miR-145 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-145-5p
Mature Sequence 16| GUCCAGUUUUCCCAGGAAUCCCU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-145-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MUC1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD227, EMA, H23AG, KL-6, MAM6, MUC-1, MUC-1/SEC, MUC-1/X, MUC1/ZD, PEM, PEMT, PUM
Description mucin 1, cell surface associated
Transcript NM_001044391    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MUC1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MUC1
(miRNA target sites are highlighted)
>MUC1|NM_001044391|3'UTR
   1 GGGCACGTCGCCCGCTGAGCTGAGTGGCCAGCCAGTGCCATTCCACTCCACTCAGGTTCTTCAGGGCCAGAGCCCCTGCA
  81 CCCTGTTTGGGCTGGTGAGCTGGGAGTTCAGGTGGGCTGCTCACAGCCTCCTTCAGAGGCCCCACCAATTTCTCGGACAC
 161 TTCTCAGTGTGTGGAAGCTCATGTGGGCCCCTGAGGGCTCATGCCTGGGAAGTGTTGTGGTGGGGGCTCCCAGGAGGACT
 241 GGCCCAGAGAGCCCTGAGATAGCGGGGATCCTGAACTGGACTGAATAAAACGTGGTCTCCCACTGCGCCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucCCUAAGGACCCUUUUGACCUg 5'
            ||: |||||    ||||||| 
Target 5' cgGGGATCCTG----AACTGGAc 3'
263 - 281 159.00 -24.20
2
miRNA  3' ucCCUAAGGACCCUUUUGACCug 5'
            ||: |||  |||::|||||  
Target 5' ggGGGCTCCCAGGAGGACTGGcc 3'
222 - 244 137.00 -27.30
3
miRNA  3' ucccuaagGACCCUUUUGACCUg 5'
                  || || :|:||||: 
Target 5' tgtttgggCT-GGTGAGCTGGGa 3'
84 - 105 118.00 -17.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145-5p :: MUC1    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , qRT-PCR , Western blot , Other , Reporter assay
Conditions LM2-4142 , BT-549 , MDA-MB-231
Disease Breast Cancer;
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... miR-145 directly targets MUC1 ...

- Sachdeva, M. Mo, Y. Y., 2010, Cancer Res.

Article - Sachdeva, M. Mo, Y. Y.
- Cancer Res, 2010
MicroRNAs are important gene regulators that could play a profound role in tumorigenesis. Our previous studies indicate that miR-145 is a tumor suppressor capable of inhibiting tumor cell growth both in vitro and in vivo. In this study, we show that miR-145 exerts its function in a cell-specific manner. Although miR-145 inhibits cell growth in MCF-7 and HCT-116 cells, it has no significant effect on cell growth in metastatic breast cancer cell lines. However, miR-145 significantly suppresses cell invasion in these cells; in contrast, the antisense oligo against miR-145 increases cell invasion. miR-145 is also able to suppress lung metastasis in an experimental metastasis animal model. This miR-145-mediated suppression of cell invasion is in part due to the silencing of the metastasis gene mucin 1 (MUC1). Using luciferase reporters carrying the 3'-untranslated region of MUC1 combined with Western blot and immunofluorescence staining, we identify MUC1 as a direct target of miR-145. Moreover, ectopic expression of MUC1 enhances cell invasion, which can be blocked by miR-145. Of interest, suppression of MUC1 by miR-145 causes a reduction of beta-catenin as well as the oncogenic cadherin 11. Finally, suppression of MUC1 by RNAi mimics the miR-145 action in suppression of invasion, which is associated with downregulation of beta-catenin and cadherin 11. Taken together, these results suggest that as a tumor suppressor, miR-145 inhibits not only tumor growth but also cell invasion and metastasis.
LinkOut: [PMID: 19996288]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145-5p :: MUC1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Location of target site 3'UTR
Original Description (Extracted from the article) ... This miR-145-mediated suppression of cell invasion is in part due to the silencing of the metastasis gene mucin 1 (MUC1). This finding was supported by luciferase reporters carrying the 3′-UTR of MUC1, Western blot and immunofluorescence staining. ...

- Sachdeva, M. Mo, Y. Y., 2010, Am J Transl Res.

Article - Sachdeva, M. Mo, Y. Y.
- Am J Transl Res, 2010
MicroRNAs are a large group of negative gene regulators that work through a posttranscriptional repression mechanism. Evidence indicates that microRNAs play a fundamental role in a wide range of biological functions such as cellular proliferation, differentiation and apoptosis. In cancer, microRNAs may function as tumor suppressors and oncogenes, and therefore, they are referred to as 'oncomiRs'. In support of this notion, we have shown that miR-145 is underexpressed in tumor tissues and is capable of inhibiting tumor cell growth and invasion by targeting several genes such as c-Myc and mucin 1. This unique feature of miR-145-mediaed gene silencing may suggest that miR-145 is a potential cancer biomarker and serves as a novel target for cancer therapy.
LinkOut: [PMID: 20407606]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
222 hsa-miR-145-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000305 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 5 2
MIRT000306 KLF5 Kruppel-like factor 5 (intestinal) 4 3
MIRT000307 SOX2 SRY (sex determining region Y)-box 2 4 3
MIRT000308 KLF4 Kruppel-like factor 4 (gut) 4 4
MIRT000426 MUC1 mucin 1, cell surface associated 4 3
MIRT000457 MYO6 myosin VI 4 1
MIRT000575 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT000626 STAT1 signal transducer and activator of transcription 1, 91kDa 5 1
MIRT000627 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 5 3
MIRT000676 CBFB core-binding factor, beta subunit 4 2
MIRT000677 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 4 1
MIRT000678 CLINT1 clathrin interactor 1 4 1
MIRT000731 IRS1 insulin receptor substrate 1 4 8
MIRT000732 PARP8 poly (ADP-ribose) polymerase family, member 8 2 2
MIRT001811 TMOD3 tropomodulin 3 (ubiquitous) 5 3
MIRT001917 HOXA9 homeobox A9 4 1
MIRT003325 EGFR epidermal growth factor receptor 3 2
MIRT003519 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 2
MIRT003543 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 5 8
MIRT004290 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 3
MIRT004496 FLI1 Friend leukemia virus integration 1 4 3
MIRT004580 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 4 1
MIRT004616 IFNB1 interferon, beta 1, fibroblast 3 1
MIRT004748 TIRAP toll-interleukin 1 receptor (TIR) domain containing adaptor protein 2 1
MIRT004904 POU5F1 POU class 5 homeobox 1 3 8
MIRT004931 IGF1R insulin-like growth factor 1 receptor 4 4
MIRT004938 KRT7 keratin 7 2 1
MIRT005683 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT005688 MYRF chromosome 11 open reading frame 9 1 1
MIRT005689 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT005690 FZD7 frizzled family receptor 7 1 1
MIRT005809 ROBO2 roundabout, axon guidance receptor, homolog 2 (Drosophila) 3 1
MIRT005810 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 4 2
MIRT005878 EIF4E eukaryotic translation initiation factor 4E 3 1
MIRT005879 CDK4 cyclin-dependent kinase 4 3 1
MIRT006215 VEGFA vascular endothelial growth factor A 3 3
MIRT006317 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 3 2
MIRT006332 IRS2 insulin receptor substrate 2 1 1
MIRT006494 ITGB8 integrin, beta 8 4 1
MIRT006747 SWAP70 SWAP switching B-cell complex 70kDa subunit 4 2
MIRT006774 ESR1 estrogen receptor 1 1 1
MIRT006788 NUDT1 nudix (nucleoside diphosphate linked moiety X)-type motif 1 3 1
MIRT006847 JAG1 jagged 1 4 1
MIRT006889 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 3 3
MIRT006899 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 3 1
MIRT006903 DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 3 1
MIRT007094 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 1 1
MIRT007107 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 3 2
MIRT007180 ILK integrin-linked kinase 3 1
MIRT007247 CTGF connective tissue growth factor 1 1
MIRT007248 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT007257 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT007275 ADAM17 ADAM metallopeptidase domain 17 4 4
MIRT007288 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 3 2
MIRT007307 HDAC2 histone deacetylase 2 1 1
MIRT021492 FBXO28 F-box protein 28 1 1
MIRT021493 USP46 ubiquitin specific peptidase 46 1 1
MIRT021494 ACBD3 acyl-CoA binding domain containing 3 1 1
MIRT021495 ELK1 ELK1, member of ETS oncogene family 1 1
MIRT021496 CCNA2 cyclin A2 1 1
MIRT021497 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT021498 CCDC25 coiled-coil domain containing 25 1 1
MIRT021499 RTKN rhotekin 4 1
MIRT021500 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT021501 F11R F11 receptor 3 3
MIRT021502 ARL6IP5 ADP-ribosylation-like factor 6 interacting protein 5 2 1
MIRT021503 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 2 1
MIRT021504 C11orf65 chromosome 11 open reading frame 65 2 1
MIRT021505 HLTF helicase-like transcription factor 2 1
MIRT021506 GMFB glia maturation factor, beta 2 1
MIRT021507 SERINC5 serine incorporator 5 2 1
MIRT021508 MEST mesoderm specific transcript homolog (mouse) 2 1
MIRT021509 ALPPL2 alkaline phosphatase, placental-like 2 2 1
MIRT021510 NDRG2 NDRG family member 2 2 1
MIRT021511 DTD1 D-tyrosyl-tRNA deacylase 1 2 1
MIRT021512 TPM3 tropomyosin 3 3 2
MIRT021513 MAP2K6 mitogen-activated protein kinase kinase 6 2 1
MIRT021514 CEP19 centrosomal protein 19kDa 2 1
MIRT021515 TPRG1 tumor protein p63 regulated 1 2 1
MIRT021516 GOLM1 golgi membrane protein 1 2 1
MIRT021517 CCDC43 coiled-coil domain containing 43 2 1
MIRT021518 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 2 1
MIRT021519 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 1
MIRT021520 TMEM9B TMEM9 domain family, member B 2 1
MIRT021521 MMP12 matrix metallopeptidase 12 (macrophage elastase) 2 1
MIRT021522 MTMR14 myotubularin related protein 14 2 1
MIRT021523 ALDH3A1 aldehyde dehydrogenase 3 family, member A1 2 1
MIRT021524 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 2 1
MIRT021525 FAM3C family with sequence similarity 3, member C 2 1
MIRT021526 LYPLA2 lysophospholipase II 2 1
MIRT021527 FAM45A family with sequence similarity 45, member A 2 1
MIRT021528 PIGF phosphatidylinositol glycan anchor biosynthesis, class F 2 1
MIRT021529 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 2 1
MIRT021530 PHF17 PHD finger protein 17 2 1
MIRT021531 NIPSNAP1 nipsnap homolog 1 (C. elegans) 2 1
MIRT021532 KREMEN1 kringle containing transmembrane protein 1 2 1
MIRT021533 MMP14 matrix metallopeptidase 14 (membrane-inserted) 2 1
MIRT021534 ABRACL ABRA C-terminal like 2 1
MIRT021535 MIXL1 Mix paired-like homeobox 2 1
MIRT021536 TSPAN6 tetraspanin 6 3 2
MIRT021537 PODXL podocalyxin-like 4 3
MIRT021538 APH1A anterior pharynx defective 1 homolog A (C. elegans) 2 1
MIRT021539 ABHD17C family with sequence similarity 108, member C1 2 1
MIRT035522 NANOG Nanog homeobox 1 1
MIRT035535 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT053030 EPAS1 endothelial PAS domain protein 1 3 1
MIRT053038 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT053081 RREB1 ras responsive element binding protein 1 3 1
MIRT053211 COL5A1 collagen, type V, alpha 1 3 1
MIRT053216 CD44 CD44 molecule (Indian blood group) 3 1
MIRT053219 BRAF v-raf murine sarcoma viral oncogene homolog B1 3 1
MIRT053374 ACTB actin, beta 3 2
MIRT053648 SOX9 SRY (sex determining region Y)-box 9 4 3
MIRT053649 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT053650 SMAD3 SMAD family member 3 4 3
MIRT053651 SMAD5 SMAD family member 5 1 1
MIRT053652 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 4 2
MIRT053653 SMAD4 SMAD family member 4 1 1
MIRT053655 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT053656 PDGFD platelet derived growth factor D 1 1
MIRT053657 CTNND1 catenin (cadherin-associated protein), delta 1 4 2
MIRT053658 P4HA1 prolyl 4-hydroxylase, alpha polypeptide I 1 1
MIRT053659 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT053660 MAP3K11 mitogen-activated protein kinase kinase kinase 11 1 1
MIRT053661 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 1 1
MIRT053757 SP1 Sp1 transcription factor 3 2
MIRT054274 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 3 1
MIRT054379 CDK6 cyclin-dependent kinase 6 4 3
MIRT114903 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT145303 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT241310 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 3 1
MIRT257500 HIST1H2AH histone cluster 1, H2ah 1 1
MIRT278608 ARF6 ADP-ribosylation factor 6 1 1
MIRT295694 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT390100 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT437436 ADD3 adducin 3 (gamma) 3 1
MIRT437609 PADI1 peptidyl arginine deiminase, type I 2 1
MIRT437610 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437611 SNX24 sorting nexin 24 2 1
MIRT437612 KIF21A kinesin family member 21A 2 1
MIRT437613 SAMD5 sterile alpha motif domain containing 5 2 1
MIRT437614 AIM1 absent in melanoma 1 2 1
MIRT437833 HMGA2 high mobility group AT-hook 2 4 1
MIRT437834 DDC dopa decarboxylase (aromatic L-amino acid decarboxylase) 2 1
MIRT438013 ANGPT2 angiopoietin 2 2 1
MIRT438282 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 2 1
MIRT438350 E2F3 E2F transcription factor 3 4 1
MIRT438496 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT438542 CD28 CD28 molecule 1 1
MIRT438543 NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 1 1
MIRT438643 SP7 Sp7 transcription factor 3 1
MIRT438718 HDAC11 histone deacetylase 11 3 1
MIRT438886 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 2 1
MIRT443564 CSRNP3 cysteine-serine-rich nuclear protein 3 1 1
MIRT455375 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT461715 ZNF426 zinc finger protein 426 1 1
MIRT462852 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT467425 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 2
MIRT468517 SESN2 sestrin 2 1 1
MIRT469434 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT470208 PSAT1 phosphoserine aminotransferase 1 1 3
MIRT476652 FZD6 frizzled family receptor 6 1 1
MIRT484958 VGLL4 vestigial like 4 (Drosophila) 1 2
MIRT485463 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT496252 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT497439 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 1 1
MIRT498098 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT504464 EID2B EP300 interacting inhibitor of differentiation 2B 1 1
MIRT507568 DEK DEK oncogene 1 1
MIRT513536 PRDM2 PR domain containing 2, with ZNF domain 1 2
MIRT519040 AGPS alkylglycerone phosphate synthase 1 2
MIRT519631 ZNF772 zinc finger protein 772 1 2
MIRT528533 CYP2C19 cytochrome P450, family 2, subfamily C, polypeptide 19 1 2
MIRT529090 ZNF100 zinc finger protein 100 1 1
MIRT529539 ZNF678 zinc finger protein 678 1 1
MIRT538679 CCDC80 coiled-coil domain containing 80 1 1
MIRT538868 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT539273 ANKRD28 ankyrin repeat domain 28 1 1
MIRT545236 ZFAND3 zinc finger, AN1-type domain 3 1 1
MIRT553102 UBXN2A UBX domain protein 2A 1 1
MIRT555930 NUP43 nucleoporin 43kDa 1 1
MIRT556471 LMNB2 lamin B2 1 2
MIRT560967 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT562124 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT575666 Map1b microtubule-associated protein 1B 1 1
MIRT613136 DUSP6 dual specificity phosphatase 6 1 1
MIRT615908 C1orf27 chromosome 1 open reading frame 27 1 1
MIRT617494 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT618782 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT621724 TNR tenascin R 1 1
MIRT622075 SRPX2 sushi-repeat containing protein, X-linked 2 1 1
MIRT622251 SLC22A9 solute carrier family 22 (organic anion transporter), member 9 1 1
MIRT622395 RRAGC Ras-related GTP binding C 1 1
MIRT627284 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT627762 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT630752 ZNF445 zinc finger protein 445 1 1
MIRT630950 PANK1 pantothenate kinase 1 1 1
MIRT636720 AQR aquarius homolog (mouse) 1 1
MIRT639227 IMMP2L IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) 1 1
MIRT642266 SMIM17 uncharacterized LOC147670 1 1
MIRT646073 NDUFS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) 1 1
MIRT646748 MUC4 mucin 4, cell surface associated 1 1
MIRT647566 ZNF660 zinc finger protein 660 1 1
MIRT651855 UNC5D unc-5 homolog D (C. elegans) 1 1
MIRT652693 THSD7A thrombospondin, type I, domain containing 7A 1 1
MIRT653677 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT655612 ORC4 origin recognition complex, subunit 4 1 1
MIRT657494 HBEGF heparin-binding EGF-like growth factor 1 1
MIRT659227 CXorf23 chromosome X open reading frame 23 1 1
MIRT659275 CTNNBIP1 catenin, beta interacting protein 1 1 1
MIRT668977 CLSTN2 calsyntenin 2 1 1
MIRT686200 ZNF451 zinc finger protein 451 1 1
MIRT689099 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT692019 CCDC85C coiled-coil domain containing 85C 1 1
MIRT702161 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 1 1
MIRT706010 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT715372 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT716616 RBM18 RNA binding motif protein 18 1 1
MIRT720444 SLC16A5 solute carrier family 16, member 5 (monocarboxylic acid transporter 6) 1 1
MIRT720880 MUC19 mucin 19, oligomeric 1 1
MIRT721000 PNMA3 paraneoplastic Ma antigen 3 1 1
MIRT724702 CRAMP1L Crm, cramped-like (Drosophila) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*