Accession ID: MIRT000430 [miRNA, hsa-miR-101 :: APP, target gene]
miRNA Infomation
miRNA namehsa-miR-101
miRNA-target interaction network
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_000484   LinkOut: [ RefSeq ]
Other Transcripts NM_001136129, NM_001136130, NM_201413, NM_201414   
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa05010    Alzheimer's disease - Homo sapiens (human)
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_000484|3'UTR
   1 TAGACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATA
  81 ATGTGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCT
 161 GAACTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGT
 241 TTTGTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCT
 321 TAGCCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGAT
 401 GCTTCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAA
 481 CATTTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTA
 561 TATTTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGA
 641 CTTCAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTT
 721 ACGGGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGT
 801 ACAGAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGAC
 881 TTTTCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTT
 961 AACCAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCC
1041 TGGACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGA
1121 GCAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-101 :: APP    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research TargetScan, PicTar
Original Description (Extracted from the article) ... In addition, miR-101 contributed to the regulation of APP in response to the proinflammatory cytokine interleukin-1β (IL-lβ). Thus, miR-101 is a negative regulator of APP expression and affects the accumulation of Aβ, suggesting a possible role for miR-101 in neuropathological conditions//Among microRNAs potentially targeting the APP 3’UTR, miR-101 is a microRNA with two putative REs within the APP 3’UTR and is also expressed in adult hippocampal tissue. Expression of miR-101 and APP both in embryonic primary hippocampal cell cultures and in postnatal rat hippocampal tissues further support the hypothesis that miR-101 is a repressor of hippocampal APP expression.// These data suggest that modification of the site 1 RE of the APP 3’UTR is sufficient to block the inhibitory function of miR-101 (Fig. 4B). Thus, miR-101 functionally interacts with the APP 3’UTR. ...

- Vilardo, E. Barbato, C. Ciotti, M. Cogoni, et al., 2010, J Biol Chem.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' aagucaauagugucAUGACAu 5'
                        |||||| 
Target 5' ---------aaucuUACUGUa 3'
1 - 12
Article - Vilardo, E. Barbato, C. Ciotti, M. Cogoni, et al.
- J Biol Chem, 2010
The amyloid precursor protein (APP) and its proteolytic product amyloid beta (Abeta) are associated with both familial and sporadic forms of Alzheimer disease (AD). Aberrant expression and function of microRNAs has been observed in AD. Here, we show that in rat hippocampal neurons cultured in vitro, the down-regulation of Argonaute-2, a key component of the RNA-induced silencing complex, produced an increase in APP levels. Using site-directed mutagenesis, a microRNA responsive element (RE) for miR-101 was identified in the 3'-untranslated region (UTR) of APP. The inhibition of endogenous miR-101 increased APP levels, whereas lentiviral-mediated miR-101 overexpression significantly reduced APP and Abeta load in hippocampal neurons. In addition, miR-101 contributed to the regulation of APP in response to the proinflammatory cytokine interleukin-1beta (IL-lbeta). Thus, miR-101 is a negative regulator of APP expression and affects the accumulation of Abeta, suggesting a possible role for miR-101 in neuropathological conditions.
LinkOut: [PMID: 20395292]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-101 :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions HeLa, HEK293T, U373, SK-N-SH, PC12
Location of target site 3'UTR
Tools used in this research miRanda, PicTar, PITA, TargetScan
Original Description (Extracted from the article) ... Endogenous miR-101 regulates expression of APP in human cells via a specific site located within its 3'UTR ...

- Long, J. M. Lahiri, D. K., 2011, Biochemical and Biophysical Research Communications.

Article - Long, J. M. Lahiri, D. K.
- Biochemical and Biophysical Research Communications, 2011
The full repertoire of regulatory interactions utilized by human cells to control expression of amyloid-beta precursor protein (APP) is still undefined. We investigated here the contribution of microRNA (miRNA) to this regulatory network. Several bioinformatic algorithms predicted miR-101 target sites within the APP 3'-untranslated region (3'-UTR). Using reporter assays, we confirmed that, in human cell cultures, miR-101 significantly reduced the expression of a reporter under control of APP 3'-UTR. Mutation of predicted site 1, but not site 2, eliminated this reporter response. Delivery of miR-101 directly to human HeLa cells significantly reduced APP levels and this effect was eliminated by co-transfection with a miR-101 antisense inhibitor. Delivery of a specific target protector designed to blockade the interaction between miR-101 and its functional target site within APP 3'-UTR enhanced APP levels in HeLa. Therefore, endogenous miR-101 regulates expression of APP in human cells via a specific site located within its 3'-UTR. Finally, we demonstrate that, across a series of human cell lines, highest expression of miR-101 levels was observed in model NT2 neurons.
LinkOut: [PMID: 21172309]