Accession ID: MIRT000430 [miRNA, hsa-miR-101-3p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-101-1LinkOut: [miRBase ]
Description Homo sapiens miR-101-1 stem-loop
Comment Reference .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-101-3p
Evidence Experimental
Experiments Cloned
Putative hsa-miR-101-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_001136016    LinkOut: [ RefSeq ]
Other Transcripts NM_000484 , NM_001136129 , NM_001136130 , NM_001136131 , NM_201413 , NM_201414   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :||| |::: ||||||| 
Target 5' atgGGTT-TTGT-GTACTGTa 3'
232 - 250 148.00 -10.50
               ||: || | ||:|||| 
Target 5' gccttTTGACAGCTGTGCTGTa 3'
120 - 141 136.00 -10.60
miRNA  3' aagucaauaGU-GUCAUGACAu 5'
                   || ||||| ||| 
Target 5' taatccacaCATCAGTAATGTa 3'
168 - 189 120.00 -8.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-101-3p :: APP    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot ,
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research TargetScan , PicTar
Original Description (Extracted from the article) ... In addition, miR-101 contributed to the regulation of APP in response to the proinflammatory cytokine interleukin-1β (IL-lβ). Thus, miR-101 is a negative regulator of APP expression and affects the accumulation of Aβ, suggesting a possible role for miR-101 in neuropathological conditions//Among microRNAs potentially targeting the APP 3’UTR, miR-101 is a microRNA with two putative REs within the APP 3’UTR and is also expressed in adult hippocampal tissue. Expression of miR-101 and APP both in embryonic primary hippocampal cell cultures and in postnatal rat hippocampal tissues further support the hypothesis that miR-101 is a repressor of hippocampal APP expression.// These data suggest that modification of the site 1 RE of the APP 3’UTR is sufficient to block the inhibitory function of miR-101 (Fig. 4B). Thus, miR-101 functionally interacts with the APP 3’UTR. ...

- Vilardo, E. Barbato, C. Ciotti, M. Cogoni, et al., 2010, J Biol Chem.

Article - Vilardo, E. Barbato, C. Ciotti, M. Cogoni, et al.
- J Biol Chem, 2010
The amyloid precursor protein (APP) and its proteolytic product amyloid beta (Abeta) are associated with both familial and sporadic forms of Alzheimer disease (AD). Aberrant expression and function of microRNAs has been observed in AD. Here, we show that in rat hippocampal neurons cultured in vitro, the down-regulation of Argonaute-2, a key component of the RNA-induced silencing complex, produced an increase in APP levels. Using site-directed mutagenesis, a microRNA responsive element (RE) for miR-101 was identified in the 3'-untranslated region (UTR) of APP. The inhibition of endogenous miR-101 increased APP levels, whereas lentiviral-mediated miR-101 overexpression significantly reduced APP and Abeta load in hippocampal neurons. In addition, miR-101 contributed to the regulation of APP in response to the proinflammatory cytokine interleukin-1beta (IL-lbeta). Thus, miR-101 is a negative regulator of APP expression and affects the accumulation of Abeta, suggesting a possible role for miR-101 in neuropathological conditions.
LinkOut: [PMID: 20395292]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-101-3p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions HeLa , HEK293T , U373 , SK-N-SH , PC12
Disease Alzheimer's disease
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , PITA , TargetScan
Original Description (Extracted from the article) ... Endogenous miR-101 regulates expression of APP in human cells via a specific site located within its 3'UTR ...

- Long, J. M. Lahiri, D. K., 2011, Biochemical and Biophysical Research Communications.

Article - Long, J. M. Lahiri, D. K.
- Biochemical and Biophysical Research Communications, 2011
The full repertoire of regulatory interactions utilized by human cells to control expression of amyloid-beta precursor protein (APP) is still undefined. We investigated here the contribution of microRNA (miRNA) to this regulatory network. Several bioinformatic algorithms predicted miR-101 target sites within the APP 3'-untranslated region (3'-UTR). Using reporter assays, we confirmed that, in human cell cultures, miR-101 significantly reduced the expression of a reporter under control of APP 3'-UTR. Mutation of predicted site 1, but not site 2, eliminated this reporter response. Delivery of miR-101 directly to human HeLa cells significantly reduced APP levels and this effect was eliminated by co-transfection with a miR-101 antisense inhibitor. Delivery of a specific target protector designed to blockade the interaction between miR-101 and its functional target site within APP 3'-UTR enhanced APP levels in HeLa. Therefore, endogenous miR-101 regulates expression of APP in human cells via a specific site located within its 3'-UTR. Finally, we demonstrate that, across a series of human cell lines, highest expression of miR-101 levels was observed in model NT2 neurons.
LinkOut: [PMID: 21172309]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000346798.3 | 3UTR | UGACUGCAUUUUACUGUACAGAUUGCUGCUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000346798.3 | 3UTR | UGACUGCAUUUUACUGUACAGAUUGCUGCUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

MiRNA-Target Expression Profile(TCGA):

MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
338 hsa-miR-101-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000378 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 4 5
MIRT000379 ATXN1 ataxin 1 5 2
MIRT000381 EZH2 enhancer of zeste homolog 2 (Drosophila) 5 15
MIRT000430 APP amyloid beta (A4) precursor protein 5 3
MIRT001219 FOS FBJ murine osteosarcoma viral oncogene homolog 4 5
MIRT002436 ICOS inducible T-cell co-stimulator 1 1
MIRT003921 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 5 6
MIRT003965 COX2 cytochrome c oxidase subunit II 4 2
MIRT004012 FBN2 fibrillin 2 2 1
MIRT004027 ARID1A AT rich interactive domain 1A (SWI-like) 3 2
MIRT004084 SUZ12 suppressor of zeste 12 homolog (Drosophila) 2 1
MIRT004086 EED embryonic ectoderm development 2 1
MIRT004297 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 4 3
MIRT005560 ATM ataxia telangiectasia mutated 3 1
MIRT005602 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 4 1
MIRT005876 DUSP1 dual specificity phosphatase 1 3 1
MIRT006149 STMN1 stathmin 1 4 2
MIRT006150 RAB5A RAB5A, member RAS oncogene family 5 3
MIRT006151 ATG4D autophagy related 4D, cysteine peptidase 4 1
MIRT007091 SOX9 SRY (sex determining region Y)-box 9 3 1
MIRT007188 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 3 1
MIRT007375 FMR1 fragile X mental retardation 1 1 1
MIRT027240 PPP4R1 protein phosphatase 4, regulatory subunit 1 1 1
MIRT027241 CERK ceramide kinase 1 1
MIRT027242 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT027243 GMEB2 glucocorticoid modulatory element binding protein 2 1 1
MIRT027244 TGFBR3 transforming growth factor, beta receptor III 1 2
MIRT027245 MRPL44 mitochondrial ribosomal protein L44 1 1
MIRT027246 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT027247 UBE2B ubiquitin-conjugating enzyme E2B 1 1
MIRT027248 VEGFA vascular endothelial growth factor A 3 2
MIRT027249 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT027250 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT027251 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 1 1
MIRT027252 ZNF567 zinc finger protein 567 1 1
MIRT027253 TMEM192 transmembrane protein 192 1 2
MIRT027254 PRPF38B PRP38 pre-mRNA processing factor 38 (yeast) domain containing B 1 1
MIRT027255 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT027256 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT027257 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT027258 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT027259 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT027260 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 2
MIRT027261 SLC38A2 solute carrier family 38, member 2 1 3
MIRT027262 REEP5 receptor accessory protein 5 1 1
MIRT027263 ZNF792 zinc finger protein 792 1 1
MIRT027264 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT027265 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT027266 TMEM168 transmembrane protein 168 1 1
MIRT027267 DIMT1 DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae) 1 1
MIRT027268 INA internexin neuronal intermediate filament protein, alpha 1 1
MIRT027269 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027270 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 3
MIRT027271 KCNG3 potassium voltage-gated channel, subfamily G, member 3 1 1
MIRT027272 CCDC125 coiled-coil domain containing 125 1 1
MIRT027273 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT027274 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT027275 CHAMP1 chromosome alignment maintaining phosphoprotein 1 1 1
MIRT027276 MNX1 motor neuron and pancreas homeobox 1 1 2
MIRT027277 FRMD6 FERM domain containing 6 1 1
MIRT027278 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT027279 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT027280 MPPE1 metallophosphoesterase 1 1 1
MIRT027281 MRPL42 mitochondrial ribosomal protein L42 1 1
MIRT027282 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 1 5
MIRT027283 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT027284 OTUD4 OTU domain containing 4 1 1
MIRT027285 C10orf88 chromosome 10 open reading frame 88 1 1
MIRT027286 KIAA1462 KIAA1462 1 2
MIRT027287 MORC3 MORC family CW-type zinc finger 3 1 2
MIRT027288 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT027289 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT027290 AP1S3 adaptor-related protein complex 1, sigma 3 subunit 1 1
MIRT027291 STAMBP STAM binding protein 1 2
MIRT027292 UBE2D3 ubiquitin-conjugating enzyme E2D 3 1 1
MIRT027293 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 2
MIRT027294 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT027295 NUPL2 nucleoporin like 2 1 1
MIRT027296 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT027297 MBNL2 muscleblind-like splicing regulator 2 1 1
MIRT027298 RANBP9 RAN binding protein 9 1 1
MIRT027299 ICK intestinal cell (MAK-like) kinase 1 1
MIRT027300 MTSS1L metastasis suppressor 1-like 1 1
MIRT027301 ZBTB21 zinc finger protein 295 1 1
MIRT027302 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT027303 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT027304 MRGBP MRG/MORF4L binding protein 1 1
MIRT027305 MOB4 MOB family member 4, phocein 1 1
MIRT027306 INO80D INO80 complex subunit D 1 2
MIRT027307 MEIS1 Meis homeobox 1 1 1
MIRT027308 DCTD dCMP deaminase 1 1
MIRT027309 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT027310 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT027311 ZCCHC2 zinc finger, CCHC domain containing 2 1 3
MIRT027312 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT027313 ACVR2B activin A receptor, type IIB 1 1
MIRT027314 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT027315 MBTD1 mbt domain containing 1 1 1
MIRT027316 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT027317 KIF2C kinesin family member 2C 1 1
MIRT027318 JUN jun proto-oncogene 1 1
MIRT027319 USP25 ubiquitin specific peptidase 25 1 1
MIRT027320 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT027321 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT027322 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT027323 LTN1 listerin E3 ubiquitin protein ligase 1 1 1
MIRT027324 FZD6 frizzled family receptor 6 1 4
MIRT027325 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT027326 XPO7 exportin 7 1 1
MIRT027327 BTG2 BTG family, member 2 1 1
MIRT027328 MMS22L MMS22-like, DNA repair protein 1 1
MIRT027329 FOXP4 forkhead box P4 1 1
MIRT027330 RPL7L1 ribosomal protein L7-like 1 1 2
MIRT027331 SPATA2 spermatogenesis associated 2 1 3
MIRT027332 FBXO11 F-box protein 11 1 1
MIRT027333 RNF44 ring finger protein 44 1 1
MIRT027334 E2F3 E2F transcription factor 3 1 1
MIRT027335 LMNB1 lamin B1 1 1
MIRT027336 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 3
MIRT027337 HOXA9 homeobox A9 1 1
MIRT027338 FAR1 fatty acyl CoA reductase 1 1 1
MIRT027339 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 2
MIRT027340 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT027341 RTN4 reticulon 4 1 1
MIRT027342 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT027343 CTR9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT027344 CERS2 ceramide synthase 2 1 1
MIRT027345 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT027346 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT027347 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT027348 RIOK2 RIO kinase 2 (yeast) 1 1
MIRT027349 CBX4 chromobox homolog 4 1 1
MIRT027350 SEPT11 septin 11 1 1
MIRT027351 QSER1 glutamine and serine rich 1 1 1
MIRT027352 MYO9A myosin IXA 1 1
MIRT027353 CAPN2 calpain 2, (m/II) large subunit 1 1
MIRT027354 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 2
MIRT027355 SSFA2 sperm specific antigen 2 1 1
MIRT027356 TBC1D12 TBC1 domain family, member 12 1 1
MIRT027357 SPAG1 sperm associated antigen 1 1 1
MIRT027358 ZNF800 zinc finger protein 800 1 1
MIRT027359 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT027360 BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 1 1
MIRT027361 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT027362 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027363 TMEM170B transmembrane protein 170B 1 1
MIRT027364 AFF4 AF4/FMR2 family, member 4 1 1
MIRT027365 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 2
MIRT027366 LBR lamin B receptor 1 1
MIRT027367 ZFX zinc finger protein, X-linked 1 3
MIRT027368 KLF12 Kruppel-like factor 12 1 1
MIRT027369 PHF3 PHD finger protein 3 1 1
MIRT027370 C1orf52 chromosome 1 open reading frame 52 1 1
MIRT027371 TSPAN12 tetraspanin 12 1 1
MIRT027372 FAM217B family with sequence similarity 217, member B 1 1
MIRT027373 SUB1 SUB1 homolog (S. cerevisiae) 1 2
MIRT027374 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT027375 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT027376 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 2
MIRT027377 TRERF1 transcriptional regulating factor 1 1 1
MIRT027378 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT027379 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma 1 1
MIRT027380 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT027381 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT027382 TGFBR1 transforming growth factor, beta receptor 1 2 2
MIRT027383 LRCH2 leucine-rich repeats and calponin homology (CH) domain containing 2 1 1
MIRT027384 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT027385 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 1 1
MIRT027386 POU2F1 POU class 2 homeobox 1 1 1
MIRT027387 CBFA2T2 core-binding factor, runt domain, alpha subunit 2; translocated to, 2 1 1
MIRT027388 LCOR ligand dependent nuclear receptor corepressor 1 4
MIRT027389 AEBP2 AE binding protein 2 1 1
MIRT027390 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT027391 MFSD6 major facilitator superfamily domain containing 6 1 3
MIRT053051 CDH5 cadherin 5, type 2 (vascular endothelium) 2 1
MIRT053160 ZEB1 zinc finger E-box binding homeobox 1 2 1
MIRT053339 PTGER4 prostaglandin E receptor 4 (subtype EP4) 3 1
MIRT053584 CPEB1 cytoplasmic polyadenylation element binding protein 1 4 1
MIRT054040 MTOR mechanistic target of rapamycin (serine/threonine kinase) 3 1
MIRT054057 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 2 1
MIRT054869 KLF6 Kruppel-like factor 6 1 1
MIRT054930 ZEB2 zinc finger E-box binding homeobox 2 2 1
MIRT068842 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT082058 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT086535 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 1
MIRT097055 TNPO1 transportin 1 1 1
MIRT102616 UBN2 ubinuclein 2 1 1
MIRT112563 MLEC malectin 1 1
MIRT145022 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT147277 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 5
MIRT188232 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT194216 FAM103A1 family with sequence similarity 103, member A1 1 1
MIRT196792 ZNF207 zinc finger protein 207 1 1
MIRT200053 ZNF431 zinc finger protein 431 1 1
MIRT208757 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT210927 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211237 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT211639 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT218854 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 2
MIRT303303 SNRNP27 small nuclear ribonucleoprotein 27kDa (U4/U6.U5) 1 1
MIRT308546 ZNF654 zinc finger protein 654 1 1
MIRT338018 DAZAP2 DAZ associated protein 2 1 1
MIRT399110 RNF213 ring finger protein 213 1 1
MIRT437858 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT438193 NLK nemo-like kinase 1 1
MIRT438717 MITF microphthalmia-associated transcription factor 3 1
MIRT444392 ZNF480 zinc finger protein 480 1 1
MIRT449015 ANKRD17 ankyrin repeat domain 17 1 1
MIRT451770 USP36 ubiquitin specific peptidase 36 1 1
MIRT452413 QDPR quinoid dihydropteridine reductase 1 1
MIRT458487 RMI1 RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) 1 5
MIRT459618 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT460768 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 1
MIRT461158 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461268 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 1
MIRT463488 ZC3H11A zinc finger CCCH-type containing 11A 1 6
MIRT465090 TSN translin 1 1
MIRT466390 TGOLN2 trans-golgi network protein 2 1 1
MIRT466406 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 2
MIRT466804 STYX serine/threonine/tyrosine interacting protein 1 1
MIRT466883 STX16 syntaxin 16 1 1
MIRT467147 SREBF2 sterol regulatory element binding transcription factor 2 1 1
MIRT468154 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468832 RRM2 ribonucleotide reductase M2 1 1
MIRT469425 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT470123 PSPC1 paraspeckle component 1 1 2
MIRT470274 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT470359 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT470432 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 3
MIRT470518 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 2
MIRT471100 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 1
MIRT471629 PAPD7 PAP associated domain containing 7 1 1
MIRT472408 NCKAP1 NCK-associated protein 1 1 1
MIRT472556 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT475275 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT475569 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 2
MIRT476590 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 2
MIRT478914 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT479637 CD81 CD81 molecule 1 1
MIRT479712 CCNF cyclin F 1 1
MIRT480226 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT480283 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT480577 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT480914 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT481937 ANKRD11 ankyrin repeat domain 11 1 6
MIRT485643 DICER1 dicer 1, ribonuclease type III 1 2
MIRT492248 SLC35F5 solute carrier family 35, member F5 1 1
MIRT493269 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT496253 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT497710 ZNF645 zinc finger protein 645 1 1
MIRT502490 FAM84B family with sequence similarity 84, member B 1 1
MIRT503888 PGBD4 piggyBac transposable element derived 4 1 1
MIRT504261 C1orf147 chromosome 1 open reading frame 147 1 2
MIRT507720 CLIC4 chloride intracellular channel 4 1 2
MIRT512042 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 3
MIRT512876 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT513078 IL20RB interleukin 20 receptor beta 1 3
MIRT513562 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT513632 UBE2A ubiquitin-conjugating enzyme E2A 1 2
MIRT513691 RNF111 ring finger protein 111 1 1
MIRT513760 PEX5L peroxisomal biogenesis factor 5-like 1 2
MIRT516746 ZNF100 zinc finger protein 100 1 1
MIRT520784 TBX18 T-box 18 1 2
MIRT521024 SLC30A5 solute carrier family 30 (zinc transporter), member 5 1 1
MIRT521902 PIAS1 protein inhibitor of activated STAT, 1 1 3
MIRT522364 NAP1L1 nucleosome assembly protein 1-like 1 1 3
MIRT523400 GRIK3 glutamate receptor, ionotropic, kainate 3 1 2
MIRT525712 DCAF12L2 DDB1 and CUL4 associated factor 12-like 2 1 1
MIRT526325 UGT2A1 UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus 1 1
MIRT526565 UGT2A2 UDP glucuronosyltransferase 2 family, polypeptide A2 1 1
MIRT526793 ZNF223 zinc finger protein 223 1 1
MIRT527746 NANOGNB NANOG neighbor homeobox 1 1
MIRT528459 NXT2 nuclear transport factor 2-like export factor 2 1 1
MIRT532825 ZNF827 zinc finger protein 827 1 1
MIRT534604 RORA RAR-related orphan receptor A 1 1
MIRT534670 RNF152 ring finger protein 152 1 1
MIRT535722 N4BP1 NEDD4 binding protein 1 1 1
MIRT536332 LEFTY1 left-right determination factor 1 1 1
MIRT536625 IPO7 importin 7 1 1
MIRT537095 GPR135 G protein-coupled receptor 135 1 1
MIRT537901 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 2
MIRT541193 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT545416 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT546237 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 1 2
MIRT547360 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT547538 MAML3 mastermind-like 3 (Drosophila) 1 1
MIRT548060 GOLGA7 golgin A7 1 1
MIRT549247 ATXN1L ataxin 1-like 1 2
MIRT551438 ZNF490 zinc finger protein 490 1 2
MIRT552563 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 2
MIRT553238 TVP23C family with sequence similarity 18, member B2 1 1
MIRT554919 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT555004 RAB39B RAB39B, member RAS oncogene family 1 1
MIRT555005 RAB33B RAB33B, member RAS oncogene family 1 1
MIRT555110 PURB purine-rich element binding protein B 1 1
MIRT555439 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT555536 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555561 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT557624 GLRX5 glutaredoxin 5 1 1
MIRT558189 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 2
MIRT558369 DIDO1 death inducer-obliterator 1 1 2
MIRT559235 BICD2 bicaudal D homolog 2 (Drosophila) 1 2
MIRT559244 BEND4 BEN domain containing 4 1 1
MIRT561655 RNF219 ring finger protein 219 1 1
MIRT561719 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT562682 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT562889 NACA2 nascent polypeptide-associated complex alpha subunit 2 1 1
MIRT563555 KIAA1586 KIAA1586 1 1
MIRT564994 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT565180 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT565943 RREB1 ras responsive element binding protein 1 1 1
MIRT566486 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT566865 LRRC1 leucine rich repeat containing 1 1 1
MIRT567244 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT567291 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT570699 FAM69A family with sequence similarity 69, member A 1 1
MIRT570927 ZNF284 zinc finger protein 284 1 1
MIRT571063 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT571646 SIX4 SIX homeobox 4 1 1
MIRT573692 RBM12B RNA binding motif protein 12B 1 1
MIRT574265 ZNF350 zinc finger protein 350 1 1
MIRT574300 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT574584 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT574844 CADM1 cell adhesion molecule 1 1 1
MIRT608127 TSC22D2 TSC22 domain family, member 2 1 1
MIRT609020 WNT7A wingless-type MMTV integration site family, member 7A 1 2
MIRT618890 PABPC1L2A poly(A) binding protein, cytoplasmic 1-like 2A 1 1
MIRT644803 NKX3-2 NK3 homeobox 2 1 1
MIRT662979 PAK3 p21 protein (Cdc42/Rac)-activated kinase 3 1 1
MIRT668624 EEA1 early endosome antigen 1 1 1
MIRT679150 ZDHHC15 zinc finger, DHHC-type containing 15 1 1
MIRT697516 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT701145 PANK1 pantothenate kinase 1 1 1
MIRT704285 DENND5B DENN/MADD domain containing 5B 1 1
MIRT704542 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT705741 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT707679 GPR50 G protein-coupled receptor 50 1 1
MIRT710016 KCNQ5 potassium voltage-gated channel, KQT-like subfamily, member 5 1 1
Error report submission
Your e-Mail*