Accession ID: MIRT000441 [miRNA, hsa-miR-802 :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-802LinkOut: [miRBase ]
Synonyms MIRN802, hsa-mir-802, MIR802
Description Homo sapiens miR-802 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-802
Mature Sequence 18| CAGUAACAAAGAUUCAUCCUUGU |40
Evidence Experimental
Experiments MiRAP-cloned
Putative hsa-miR-802 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-802 :: MECP2    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions SK-N-SH
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , PITA , TargetScan
Original Description (Extracted from the article) ... miR-802 and the mutant construct co-transfection experiments demonstrated that miR-802 can interfere with luciferase expression via direct interaction with only the second miR-802 site (i.e. 6875– 6896 bp) in this in vitro surrogate assay// ...

- Kuhn, D. E. Nuovo, G. J. Terry, A. V., Jr. et al., 2010, J Biol Chem.

Article - Kuhn, D. E. Nuovo, G. J. Terry, A. V., Jr. et al.
- J Biol Chem, 2010
Down syndrome (DS), or Trisomy 21, is the most common genetic cause of cognitive impairment and congenital heart defects in the human population. Bioinformatic annotation has established that human chromosome 21 (Hsa21) harbors five microRNA (miRNAs) genes: miR-99a, let-7c, miR-125b-2, miR-155, and miR-802. Our laboratory recently demonstrated that Hsa21-derived miRNAs are overexpressed in DS brain and heart specimens. The aim of this study was to identify important Hsa21-derived miRNA/mRNA target pairs that may play a role, in part, in mediating the DS phenotype. We demonstrate by luciferase/target mRNA 3'-untranslated region reporter assays, and gain- and loss-of-function experiments that miR-155 and -802 can regulate the expression of the predicted mRNA target, the methyl-CpG-binding protein (MeCP2). We also demonstrate that MeCP2 is underexpressed in DS brain specimens isolated from either humans or mice. We further demonstrate that, as a consequence of attenuated MeCP2 expression, transcriptionally activated and silenced MeCP2 target genes, CREB1/Creb1 and MEF2C/Mef2c, are also aberrantly expressed in these DS brain specimens. Finally, in vivo silencing of endogenous miR-155 or -802, by antagomir intra-ventricular injection, resulted in the normalization of MeCP2 and MeCP2 target gene expression. Taken together, these results suggest that improper repression of MeCP2, secondary to trisomic overexpression of Hsa21-derived miRNAs, may contribute, in part, to the abnormalities in the neurochemistry observed in the brains of DS individuals. Finally these results suggest that selective inactivation of Hsa21-derived miRNAs may provide a novel therapeutic tool in the treatment of DS.
LinkOut: [PMID: 19897480]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-802 :: MECP2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Microarray
Location of target site 3'UTR
Original Description (Extracted from the article) ... Recently, Kuhn et al. (2008) used microarrays, RT-PCR and miRNA in situ hybridization methods to investigate five miRNA genes (miR-99a, let-7c, miR-125b-2, miR-155, and miR-802) located on human chromosome 21. They showed that these miRNAs were up-regulated in the fetal brain tissue of DS patients compared to age- and sex-matched controls. In a follow-up study, the same group used luciferase/target mRNA 3′UTR reporter assays to demonstrate that miR-155 and miR-802 can regulate MeCP2 expression. ...

- Xu, B. Karayiorgou, M. Gogos, J. A., 2010, Brain Res.

Article - Xu, B. Karayiorgou, M. Gogos, J. A.
- Brain Res, 2010
Abnormalities in microRNA (miRNA)-mediated gene regulation have been observed in a variety of human diseases, especially in cancer. Here, we provide an account of newly emerging connections between miRNAs with various psychiatric and neurodevelopmental disorders, including recent findings of miRNA dysregulation in the 22q11.2 microdeletion syndrome, a well-established genetic risk factor for schizophrenia. miRNAs appear to be components of both the genetic architecture of these complex phenotypes as well as integral parts of the biological pathways that mediate the effects of primary genetic deficits. Therefore, they may contribute to both genetic heterogeneity and phenotypic variation of psychiatric and neurodevelopmental disorders and could serve as novel therapeutic targets.
LinkOut: [PMID: 20388499]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1 hsa-miR-802 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000441 MECP2 methyl CpG binding protein 2 (Rett syndrome) 5 2