Accession ID: MIRT000441 [miRNA, hsa-miR-802 :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-802LinkOut: [miRBase ]
Synonyms MIRN802, hsa-mir-802, MIR802
Description Homo sapiens miR-802 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-802
Mature Sequence 18| CAGUAACAAAGAUUCAUCCUUGU |40
Evidence Experimental
Experiments MiRAP-cloned
Putative hsa-miR-802 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MECP2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AUTSX3, DKFZp686A24160, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT
Description methyl CpG binding protein 2 (Rett syndrome)
Transcript NM_0049    LinkOut: [ RefSeq ]
Other Transcripts NM_0011107   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MECP2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MECP2
(miRNA target sites are highlighted)
>MECP2|NM_0049|3'UTR
   1 TGACTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCT
  81 CTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGT
 161 GGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAG
 241 CTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCAC
 321 CTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCCGTTTT
 401 CGGTGCCATCAGTGCCCCGTCTACAGCTCCCCCAGCTCCCCCCACCTCCCCCACTCCCAACCACGTTGGGACAGGGAGGT
 481 GTGAGGCAGGAGAGACAGTTGGATTCTTTAGAGAAGATGGATATGACCAGTGGCTATGGCCTGTGCGATCCCACCCGTGG
 561 TGGCTCAAGTCTGGCCCCACACCAGCCCCAATCCAAAACTGGCAAGGACGCTTCACAGGACAGGAAAGTGGCACCTGTCT
 641 GCTCCAGCTCTGGCATGGCTAGGAGGGGGGAGTCCCTTGAACTACTGGGTGTAGACTGGCCTGAACCACAGGAGAGGATG
 721 GCCCAGGGTGAGGTGGCATGGTCCATTCTCAAGGGACGTCCTCCAACGGGTGGCGCTAGAGGCCATGGAGGCAGTAGGAC
 801 AAGGTGCAGGCAGGCTGGCCTGGGGTCAGGCCGGGCAGAGCACAGCGGGGTGAGAGGGATTCCTAATCACTCAGAGCAGT
 881 CTGTGACTTAGTGGACAGGGGAGGGGGCAAAGGGGGAGGAGAAGAAAATGTTCTTCCAGTTACTTTCCAATTCTCCTTTA
 961 GGGACAGCTTAGAATTATTTGCACTATTGAGTCTTCATGTTCCCACTTCAAAACAAACAGATGCTCTGAGAGCAAACTGG
1041 CTTGAATTGGTGACATTTAGTCCCTCAAGCCACCAGATGTGACAGTGTTGAGAACTACCTGGATTTGTATATATACCTGC
1121 GCTTGTTTTAAAGTGGGCTCAGCACATAGGGTTCCCACGAAGCTCCGAAACTCTAAGTGTTTGCTGCAATTTTATAAGGA
1201 CTTCCTGATTGGTTTCTCTTCTCCCCTTCCATTTCTGCCTTTTGTTCATTTCATCCTTTCACTTCTTTCCCTTCCTCCGT
1281 CCTCCTCCTTCCTAGTTCATCCCTTCTCTTCCAGGCAGCCGCGGTGCCCAACCACACTTGTCGGCTCCAGTCCCCAGAAC
1361 TCTGCCTGCCCTTTGTCCTCCTGCTGCCAGTACCAGCCCCACCCTGTTTTGAGCCCTGAGGAGGCCTTGGGCTCTGCTGA
1441 GTCCGACCTGGCCTGTCTGTGAAGAGCAAGAGAGCAGCAAGGTCTTGCTCTCCTAGGTAGCCCCCTCTTCCCTGGTAAGA
1521 AAAAGCAAAAGGCATTTCCCACCCTGAACAACGAGCCTTTTCACCCTTCTACTCTAGAGAAGTGGACTGGAGGAGCTGGG
1601 CCCGATTTGGTAGTTGAGGAAAGCACAGAGGCCTCCTGTGGCCTGCCAGTCATCGAGTGGCCCAACAGGGGCTCCATGCC
1681 AGCCGACCTTGACCTCACTCAGAAGTCCAGAGTCTAGCGTAGTGCAGCAGGGCAGTAGCGGTACCAATGCAGAACTCCCA
1761 AGACCCGAGCTGGGACCAGTACCTGGGTCCCCAGCCCTTCCTCTGCTCCCCCTTTTCCCTCGGAGTTCTTCTTGAATGGC
1841 AATGTTTTGCTTTTGCTCGATGCAGACAGGGGGCCAGAACACCACACATTTCACTGTCTGTCTGGTCCATAGCTGTGGTG
1921 TAGGGGCTTAGAGGCATGGGCTTGCTGTGGGTTTTTAATTGATCAGTTTTCATGTGGGATCCCATCTTTTTAACCTCTGT
2001 TCAGGAAGTCCTTATCTAGCTGCATATCTTCATCATATTGGTATATCCTTTTCTGTGTTTACAGAGATGTCTCTTATATC
2081 TAAATCTGTCCAACTGAGAAGTACCTTATCAAAGTAGCAAATGAGACAGCAGTCTTATGCTTCCAGAAACACCCACAGGC
2161 ATGTCCCATGTGAGCTGCTGCCATGAACTGTCAAGTGTGTGTTGTCTTGTGTATTTCAGTTATTGTCCCTGGCTTCCTTA
2241 CTATGGTGTAATCATGAAGGAGTGAAACATCATAGAAACTGTCTAGCACTTCCTTGCCAGTCTTTAGTGATCAGGAACCA
2321 TAGTTGACAGTTCCAATCAGTAGCTTAAGAAAAAACCGTGTTTGTCTCTTCTGGAATGGTTAGAAGTGAGGGAGTTTGCC
2401 CCGTTCTGTTTGTAGAGTCTCATAGTTGGACTTTCTAGCATATATGTGTCCATTTCCTTATGCTGTAAAAGCAAGTCCTG
2481 CAACCAAACTCCCATCAGCCCAATCCCTGATCCCTGATCCCTTCCACCTGCTCTGCTGATGACCCCCCCAGCTTCACTTC
2561 TGACTCTTCCCCAGGAAGGGAAGGGGGGTCAGAAGAGAGGGTGAGTCCTCCAGAACTCTTCCTCCAAGGACAGAAGGCTC
2641 CTGCCCCCATAGTGGCCTCGAACTCCTGGCACTACCAAAGGACACTTATCCACGAGAGCGCAGCATCCGACCAGGTTGTC
2721 ACTGAGAAGATGTTTATTTTGGTCAGTTGGGTTTTTATGTATTATACTTAGTCAAATGTAATGTGGCTTCTGGAATCATT
2801 GTCCAGAGCTGCTTCCCCGTCACCTGGGCGTCATCTGGTCCTGGTAAGAGGAGTGCGTGGCCCACCAGGCCCCCCTGTCA
2881 CCCATGACAGTTCATTCAGGGCCGATGGGGCAGTCGTGGTTGGGAACACAGCATTTCAAGCGTCACTTTATTTCATTCGG
2961 GCCCCACCTGCAGCTCCCTCAAAGAGGCAGTTGCCCAGCCTCTTTCCCTTCCAGTTTATTCCAGAGCTGCCAGTGGGGCC
3041 TGAGGCTCCTTAGGGTTTTCTCTCTATTTCCCCCTTTCTTCCTCATTCCCTCGTCTTTCCCAAAGGCATCACGAGTCAGT
3121 CGCCTTTCAGCAGGCAGCCTTGGCGGTTTATCGCCCTGGCAGGCAGGGGCCCTGCAGCTCTCATGCTGCCCCTGCCTTGG
3201 GGTCAGGTTGACAGGAGGTTGGAGGGAAAGCCTTAAGCTGCAGGATTCTCACCAGCTGTGTCCGGCCCAGTTTTGGGGTG
3281 TGACCTCAATTTCAATTTTGTCTGTACTTGAACATTATGAAGATGGGGGCCTCTTTCAGTGAATTTGTGAACAGCAGAAT
3361 TGACCGACAGCTTTCCAGTACCCATGGGGCTAGGTCATTAAGGCCACATCCACAGTCTCCCCCACCCTTGTTCCAGTTGT
3441 TAGTTACTACCTCCTCTCCTGACAATACTGTATGTCGTCGAGCTCCCCCCAGGTCTACCCCTCCCGGCCCTGCCTGCTGG
3521 TGGGCTTGTCATAGCCAGTGGGATTGCCGGTCTTGACAGCTCAGTGAGCTGGAGATACTTGGTCACAGCCAGGCGCTAGC
3601 ACAGCTCCCTTCTGTTGATGCTGTATTCCCATATCAAAAGACACAGGGGACACCCAGAAACGCCACATCCCCCAATCCAT
3681 CAGTGCCAAACTAGCCAACGGCCCCAGCTTCTCAGCTCGCTGGATGGCGGAAGCTGCTACTCGTGAGCGCCAGTGCGGGT
3761 GCAGACAATCTTCTGTTGGGTGGCATCATTCCAGGCCCGAAGCATGAACAGTGCACCTGGGACAGGGAGCAGCCCCAAAT
3841 TGTCACCTGCTTCTCTGCCCAGCTTTTCATTGCTGTGACAGTGATGGCGAAAGAGGGTAATAACCAGACACAAACTGCCA
3921 AGTTGGGTGGAGAAAGGAGTTTCTTTAGCTGACAGAATCTCTGAATTTTAAATCACTTAGTAAGCGGCTCAAGCCCAGGA
4001 GGGAGCAGAGGGATACGAGCGGAGTCCCCTGCGCGGGACCATCTGGAATTGGTTTAGCCCAAGTGGAGCCTGACAGCCAG
4081 AACTCTGTGTCCCCCGTCTAACCACAGCTCCTTTTCCAGAGCATTCCAGTCAGGCTCTCTGGGCTGACTGGGCCAGGGGA
4161 GGTTACAGGTACCAGTTCTTTAAGAAGATCTTTGGGCATATACATTTTTAGCCTGTGTCATTGCCCCAAATGGATTCCTG
4241 TTTCAAGTTCACACCTGCAGATTCTAGGACCTGTGTCCTAGACTTCAGGGAGTCAGCTGTTTCTAGAGTTCCTACCATGG
4321 AGTGGGTCTGGAGGACCTGCCCGGTGGGGGGGCAGAGCCCTGCTCCCTCCGGGTCTTCCTACTCTTCTCTCTGCTCTGAC
4401 GGGATTTGTTGATTCTCTCCATTTTGGTGTCTTTCTCTTTTAGATATTGTATCAATCTTTAGAAAAGGCATAGTCTACTT
4481 GTTATAAATCGTTAGGATACTGCCTCCCCCAGGGTCTAAAATTACATATTAGAGGGGAAAAGCTGAACACTGAAGTCAGT
4561 TCTCAACAATTTAGAAGGAAAACCTAGAAAACATTTGGCAGAAAATTACATTTCGATGTTTTTGAATGAATACGAGCAAG
4641 CTTTTACAACAGTGCTGATCTAAAAATACTTAGCACTTGGCCTGAGATGCCTGGTGAGCATTACAGGCAAGGGGAATCTG
4721 GAGGTAGCCGACCTGAGGACATGGCTTCTGAACCTGTCTTTTGGGAGTGGTATGGAAGGTGGAGCGTTCACCAGTGACCT
4801 GGAAGGCCCAGCACCACCCTCCTTCCCACTCTTCTCATCTTGACAGAGCCTGCCCCAGCGCTGACGTGTCAGGAAAACAC
4881 CCAGGGAACTAGGAAGGCACTTCTGCCTGAGGGGCAGCCTGCCTTGCCCACTCCTGCTCTGCTCGCCTCGGATCAGCTGA
4961 GCCTTCTGAGCTGGCCTCTCACTGCCTCCCCAAGGCCCCCTGCCTGCCCTGTCAGGAGGCAGAAGGAAGCAGGTGTGAGG
5041 GCAGTGCAAGGAGGGAGCACAACCCCCAGCTCCCGCTCCGGGCTCCGACTTGTGCACAGGCAGAGCCCAGACCCTGGAGG
5121 AAATCCTACCTTTGAATTCAAGAACATTTGGGGAATTTGGAAATCTCTTTGCCCCCAAACCCCCATTCTGTCCTACCTTT
5201 AATCAGGTCCTGCTCAGCAGTGAGAGCAGATGAGGTGAAAAGGCCAAGAGGTTTGGCTCCTGCCCACTGATAGCCCCTCT
5281 CCCCGCAGTGTTTGTGTGTCAAGTGGCAAAGCTGTTCTTCCTGGTGACCCTGATTATATCCAGTAACACATAGACTGTGC
5361 GCATAGGCCTGCTTTGTCTCCTCTATCCTGGGCTTTTGTTTTGCTTTTTAGTTTTGCTTTTAGTTTTTCTGTCCCTTTTA
5441 TTTAACGCACCGACTAGACACACAAAGCAGTTGAATTTTTATATATATATCTGTATATTGCACAATTATAAACTCATTTT
5521 GCTTGTGGCTCCACACACACAAAAAAAGACCTGTTAAAATTATACCTGTTGCTTAATTACAATATTTCTGATAACCATAG
5601 CATAGGACAAGGGAAAATAAAAAAAGAAAAAAAAGAAAAAAAAACGACAAATCTGTCTGCTGGTCACTTCTTCTGTCCAA
5681 GCAGATTCGTGGTCTTTTCCTCGCTTCTTTCAAGGGCTTTCCTGTGCCAGGTGAAGGAGGCTCCAGGCAGCACCCAGGTT
5761 TTGCACTCTTGTTTCTCCCGTGCTTGTGAAAGAGGTCCCAAGGTTCTGGGTGCAGGAGCGCTCCCTTGACCTGCTGAAGT
5841 CCGGAACGTAGTCGGCACAGCCTGGTCGCCTTCCACCTCTGGGAGCTGGAGTCCACTGGGGTGGCCTGACTCCCCCAGTC
5921 CCCTTCCCGTGACCTGGTCAGGGTGAGCCCATGTGGAGTCAGCCTCGCAGGCCTCCCTGCCAGTAGGGTCCGAGTGTGTT
6001 TCATCCTTCCCACTCTGTCGAGCCTGGGGGCTGGAGCGGAGACGGGAGGCCTGGCCTGTCTCGGAACCTGTGAGCTGCAC
6081 CAGGTAGAACGCCAGGGACCCCAGAATCATGTGCGTCAGTCCAAGGGGTCCCCTCCAGGAGTAGTGAAGACTCCAGAAAT
6161 GTCCCTTTCTTCTCCCCCATCCTACGAGTAATTGCATTTGCTTTTGTAATTCTTAATGAGCAATATCTGCTAGAGAGTTT
6241 AGCTGTAACAGTTCTTTTTGATCATCTTTTTTTAATAATTAGAAACACCAAAAAAATCCAGAAACTTGTTCTTCCAAAGC
6321 AGAGAGCATTATAATCACCAGGGCCAAAAGCTTCCCTCCCTGCTGTCATTGCTTCTTCTGAGGCCTGAATCCAAAAGAAA
6401 AACAGCCATAGGCCCTTTCAGTGGCCGGGCTACCCGTGAGCCCTTCGGAGGACCAGGGCTGGGGCAGCCTCTGGGCCCAC
6481 ATCCGGGGCCAGCTCCGGCGTGTGTTCAGTGTTAGCAGTGGGTCATGATGCTCTTTCCCACCCAGCCTGGGATAGGGGCA
6561 GAGGAGGCGAGGAGGCCGTTGCCGCTGATGTTTGGCCGTGAACAGGTGGGTGTCTGCGTGCGTCCACGTGCGTGTTTTCT
6641 GACTGACATGAAATCGACGCCCGAGTTAGCCTCACCCGGTGACCTCTAGCCCTGCCCGGATGGAGCGGGGCCCACCCGGT
6721 TCAGTGTTTCTGGGGAGCTGGACAGTGGAGTGCAAAAGGCTTGCAGAACTTGAAGCCTGCTCCTTCCCTTGCTACCACGG
6801 CCTCCTTTCCGTTTGATTTGTCACTGCTTCAATCAATAACAGCCGCTCCAGAGTCAGTAGTCAATGAATATATGACCAAA
6881 TATCACCAGGACTGTTACTCAATGTGTGCCGAGCCCTTGCCCATGCTGGGCTCCCGTGTATCTGGACACTGTAACGTGTG
6961 CTGTGTTTGCTCCCCTTCCCCTTCCTTCTTTGCCCTTTACTTGTCTTTCTGGGGTTTTTCTGTTTGGGTTTGGTTTGGTT
7041 TTTATTTCTCCTTTTGTGTTCCAAACATGAGGTTCTCTCTACTGGTCCTCTTAACTGTGGTGTTGAGGCTTATATTTGTG
7121 TAATTTTTGGTGGGTGAAAGGAATTTTGCTAAGTAAATCTCTTCTGTGTTTGAACTGAAGTCTGTATTGTAACTATGTTT
7201 AAAGTAATTGTTCCAGAGACAAATATTTCTAGACACTTTTTCTTTACAAACAAAAGCATTCGGAGGGAGGGGGATGGTGA
7281 CTGAGATGAGAGGGGAGAGCTGAACAGATGACCCCTGCCCAGATCAGCCAGAAGCCACCCAAAGCAGTGGAGCCCAGGAG
7361 TCCCACTCCAAGCCAGCAAGCCGAATAGCTGATGTGTTGCCACTTTCCAAGTCACTGCAAAACCAGGTTTTGTTCCGCCC
7441 AGTGGATTCTTGTTTTGCTTCCCCTCCCCCCGAGATTATTACCACCATCCCGTGCTTTTAAGGAAAGGCAAGATTGATGT
7521 TTCCTTGAGGGGAGCCAGGAGGGGATGTGTGTGTGCAGAGCTGAAGAGCTGGGGAGAATGGGGCTGGGCCCACCCAAGCA
7601 GGAGGCTGGGACGCTCTGCTGTGGGCACAGGTCAGGCTAATGTTGGCAGATGCAGCTCTTCCTGGACAGGCCAGGTGGTG
7681 GGCATTCTCTCTCCAAGGTGTGCCCCGTGGGCATTACTGTTTAAGACACTTCCGTCACATCCCACCCCATCCTCCAGGGC
7761 TCAACACTGTGACATCTCTATTCCCCACCCTCCCCTTCCCAGGGCAATAAAATGACCATGGAGGGGGCTTGCACTCTCTT
7841 GGCTGTCACCCGATCGCCAGCAAAACTTAGATGTGAGAAAACCCCTTCCCATTCCATGGCGAAAACATCTCCTTAGAAAA
7921 GCCATTACCCTCATTAGGCATGGTTTTGGGCTCCCAAAACACCTGACAGCCCCTCCCTCCTCTGAGAGGCGGAGAGTGCT
8001 GACTGTAGTGACCATTGCATGCCGGGTGCAGCATCTGGAAGAGCTAGGCAGGGTGTCTGCCCCCTCCTGAGTTGAAGTCA
8081 TGCTCCCCTGTGCCAGCCCAGAGGCCGAGAGCTATGGACAGCATTGCCAGTAACACAGGCCACCCTGTGCAGAAGGGAGC
8161 TGGCTCCAGCCTGGAAACCTGTCTGAGGTTGGGAGAGGTGCACTTGGGGCACAGGGAGAGGCCGGGACACACTTAGCTGG
8241 AGATGTCTCTAAAAGCCCTGTATCGTATTCACCTTCAGTTTTTGTGTTTTGGGACAATTACTTTAGAAAATAAGTAGGTC
8321 GTTTTAAAAACAAAAATTATTGATTGCTTTTTTGTAGTGTTCAGAAAAAAGGTTCTTTGTGTATAGCCAAATGACTGAAA
8401 GCACTGATATATTTAAAAACAAAAGGCAATTTATTAAGGAAATTTGTACCATTTCAGTAAACCTGTCTGAATGTACCTGT
8481 ATACGTTTCAAAAACACCCCCCCCCCACTGAATCCCTGTAACCTATTTATTATATAAAGAGTTTGCCTTATAAATTT
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-802 :: MECP2    [ Functional MTI ]
Validation Method Immunohistochemistry , Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions SK-N-SH
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , PITA , TargetScan
Original Description (Extracted from the article) ... miR-802 and the mutant construct co-transfection experiments demonstrated that miR-802 can interfere with luciferase expression via direct interaction with only the second miR-802 site (i.e. 6875– 6896 bp) in this in vitro surrogate assay// ...

- Kuhn, D. E. Nuovo, G. J. Terry, A. V., Jr. et al., 2010, J Biol Chem.

Article - Kuhn, D. E. Nuovo, G. J. Terry, A. V., Jr. et al.
- J Biol Chem, 2010
Down syndrome (DS), or Trisomy 21, is the most common genetic cause of cognitive impairment and congenital heart defects in the human population. Bioinformatic annotation has established that human chromosome 21 (Hsa21) harbors five microRNA (miRNAs) genes: miR-99a, let-7c, miR-125b-2, miR-155, and miR-802. Our laboratory recently demonstrated that Hsa21-derived miRNAs are overexpressed in DS brain and heart specimens. The aim of this study was to identify important Hsa21-derived miRNA/mRNA target pairs that may play a role, in part, in mediating the DS phenotype. We demonstrate by luciferase/target mRNA 3'-untranslated region reporter assays, and gain- and loss-of-function experiments that miR-155 and -802 can regulate the expression of the predicted mRNA target, the methyl-CpG-binding protein (MeCP2). We also demonstrate that MeCP2 is underexpressed in DS brain specimens isolated from either humans or mice. We further demonstrate that, as a consequence of attenuated MeCP2 expression, transcriptionally activated and silenced MeCP2 target genes, CREB1/Creb1 and MEF2C/Mef2c, are also aberrantly expressed in these DS brain specimens. Finally, in vivo silencing of endogenous miR-155 or -802, by antagomir intra-ventricular injection, resulted in the normalization of MeCP2 and MeCP2 target gene expression. Taken together, these results suggest that improper repression of MeCP2, secondary to trisomic overexpression of Hsa21-derived miRNAs, may contribute, in part, to the abnormalities in the neurochemistry observed in the brains of DS individuals. Finally these results suggest that selective inactivation of Hsa21-derived miRNAs may provide a novel therapeutic tool in the treatment of DS.
LinkOut: [PMID: 19897480]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-802 :: MECP2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Microarray
Location of target site 3'UTR
Original Description (Extracted from the article) ... Recently, Kuhn et al. (2008) used microarrays, RT-PCR and miRNA in situ hybridization methods to investigate five miRNA genes (miR-99a, let-7c, miR-125b-2, miR-155, and miR-802) located on human chromosome 21. They showed that these miRNAs were up-regulated in the fetal brain tissue of DS patients compared to age- and sex-matched controls. In a follow-up study, the same group used luciferase/target mRNA 3′UTR reporter assays to demonstrate that miR-155 and miR-802 can regulate MeCP2 expression. ...

- Xu, B. Karayiorgou, M. Gogos, J. A., 2010, Brain Res.

Article - Xu, B. Karayiorgou, M. Gogos, J. A.
- Brain Res, 2010
Abnormalities in microRNA (miRNA)-mediated gene regulation have been observed in a variety of human diseases, especially in cancer. Here, we provide an account of newly emerging connections between miRNAs with various psychiatric and neurodevelopmental disorders, including recent findings of miRNA dysregulation in the 22q11.2 microdeletion syndrome, a well-established genetic risk factor for schizophrenia. miRNAs appear to be components of both the genetic architecture of these complex phenotypes as well as integral parts of the biological pathways that mediate the effects of primary genetic deficits. Therefore, they may contribute to both genetic heterogeneity and phenotypic variation of psychiatric and neurodevelopmental disorders and could serve as novel therapeutic targets.
LinkOut: [PMID: 20388499]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1 hsa-miR-802 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000441 MECP2 methyl CpG binding protein 2 (Rett syndrome) 5 2