Accession ID: MIRT000472 [miRNA, hsa-let-7g-5p :: COL1A2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7gLinkOut: [miRBase ]
Synonyms LET7G, MIRNLET7G, hsa-let-7g, MIRLET7G
Description Homo sapiens let-7g stem-loop
Comment let-7g-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7g-5p
Mature Sequence 5| UGAGGUAGUAGUUUGUACAGUU |26
Evidence Experimental
Experiments Cloned
Putative hsa-let-7g-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol COL1A2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms OI4
Description collagen, type I, alpha 2
Transcript NM_0000    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on COL1A2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of COL1A2
(miRNA target sites are highlighted)
>COL1A2|NM_0000|3'UTR
   1 TAAATGAACTCAATCTAAATTAAAAAAGAAAGAAATTTGAAAAAACTTTCTCTTTGCCATTTCTTCTTCTTCTTTTTTAA
  81 CTGAAAGCTGAATCCTTCCATTTCTTCTGCACATCTACTTGCTTAAATTGTGGGCAAAAGAGAAAAAGAAGGATTGATCA
 161 GAGCATTGTGCAATACAGTTTCATTAACTCCTTCCCCCGCTCCCCCAAAAATTTGAATTTTTTTTTCAACACTCTTACAC
 241 CTGTTATGGAAAATGTCAACCTTTGTAAGAAAACCAAAATAAAAATTGAAAAATAAAAACCATAAACATTTGCACCACTT
 321 GTGGCTTTTGAATATCTTCCACAGAGGGAAGTTTAAAACCCAAACTTCCAAAGGTTTAAACTACCTCAAAACACTTTCCC
 401 ATGAGTGTGATCCACATTGTTAGGTGCTGACCTAGACAGAGATGAACTGAGGTCCTTGTTTTGTTTTGTTCATAATACAA
 481 AGGTGCTAATTAATAGTATTTCAGATACTTGAAGAATGTTGATGGTGCTAGAAGAATTTGAGAAGAAATACTCCTGTATT
 561 GAGTTGTATCGTGTGGTGTATTTTTTAAAAAATTTGATTTAGCATTCATATTTTCCATCTTATTCCCAATTAAAAGTATG
 641 CAGATTATTTGCCCAAATCTTCTTCAGATTCAGCATTTGTTCTTTGCCAGTCTCATTTTCATCTTCTTCCATGGTTCCAC
 721 AGAAGCTTTGTTTCTTGGGCAAGCAGAAAAATTAAATTGTACCTATTTTGTATATGTGAGATGTTTAAATAAATTGTGAA
 801 AAAAATGAAATAAAGCATGTTTGGTTTTCCAAAAGAACATAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGACAUGUUU---GA--UGAUGGAGu 5'
            || | ||||   :|  |||||||| 
Target 5' aaCT-TCCAAAGGTTTAAACTACCTCa 3'
363 - 388 153.00 -14.30
2
miRNA  3' uuGACAUGUUUGAUGAUGGAgu 5'
            ||| |||   | ||||:|  
Target 5' ttCTGCACA---T-CTACTTgc 3'
105 - 122 116.00 -9.70
3
miRNA  3' uuGACAUGUU-UG----A-UGAUGGAGu 5'
            :|||:||| ||    | |:|| ||| 
Target 5' caTTGTGCAATACAGTTTCATTAACTCc 3'
164 - 191 114.00 -10.16
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7g-5p :: COL1A2    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot , Other
Conditions Huh7 , HuH1
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Consistently, the levels of type I collagen a2 (COL1A2) and let-7g were inversely correlated in HCC clinical specimens. COL1A2 was experimentally validated as a direct target of let-7g. Moreover, addition of COL1A2 counteracted the inhibitory effect of let-7g on cell migration//COL1A2 as a direct target of let-7g-mediated silencing//, COL1A2 expression was signi´Čücantly down-regulated in huH1-let7g cells at both the mRNA and protein levels (Fig. 5C). ...

- Ji, J. Zhao, L. Budhu, A. Forgues, M. Jia, et al., 2010, J Hepatol.

Article - Ji, J. Zhao, L. Budhu, A. Forgues, M. Jia, et al.
- J Hepatol, 2010
BACKGROUND & AIMS: Hepatocellular carcinoma (HCC) is an aggressive cancer with a poor prognosis mainly due to metastasis. MicroRNAs are endogenous small noncoding RNAs that regulate cellular gene expression and are functionally linked to tumourigenesis. Using microarray analysis, we recently identified 20 miRNAs associated with HCC metastasis. Here, we carried out further analyses on one of these microRNAs, let-7g, to determine whether it is functionally linked to HCC metastasis. METHODS: Quantitative real-time polymerase chain reaction was used to determine the level of mature let-7g transcript in HCC clinical specimens and its correlation with patient survival. Ectopic expression of let-7g was carried out in HCC cell lines to assess its influence on cell growth, migration and invasion. RESULTS: We confirmed that the level of let-7g was significantly lower in metastatic HCCs compared to metastasis-free HCCs. Moreover, low let-7g expression in a tumour was predictive of poor survival in HCC patients. Functional studies indicated that ectopic expression of let-7g significantly inhibits HCC cell migration and cell growth. In-silico analysis revealed members of soluble collagens as potential targets of let-7g. Consistently, the levels of type I collagen alpha2 (COL1A2) and let-7g were inversely correlated in HCC clinical specimens. COL1A2 was experimentally validated as a direct target of let-7g. Moreover, addition of COL1A2 counteracted the inhibitory effect of let-7g on cell migration. CONCLUSIONS: These results suggest that let-7g may suppress HCC metastasis partially through targeting COL1A2.
LinkOut: [PMID: 20338660]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
30 hsa-let-7g-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000396 CDK6 cyclin-dependent kinase 6 1 1
MIRT000397 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000399 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT000472 COL1A2 collagen, type I, alpha 2 4 1
MIRT000475 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 2
MIRT002097 HMGA2 high mobility group AT-hook 2 4 3
MIRT003831 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 4 2
MIRT004489 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 4 1
MIRT004490 BCL2L1 BCL2-like 1 4 1
MIRT006161 GAB2 GRB2-associated binding protein 2 3 1
MIRT006162 FN1 fibronectin 1 3 1
MIRT006399 IL13 interleukin 13 2 1
MIRT024117 DAD1 defender against cell death 1 1 1
MIRT024118 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT024119 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 2 1
MIRT024120 BMI1 BMI1 polycomb ring finger oncogene 2 1
MIRT046555 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT046556 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046557 UBE3C ubiquitin protein ligase E3C 1 1
MIRT046558 RPL12 ribosomal protein L12 1 1
MIRT046559 SFT2D1 SFT2 domain containing 1 1 1
MIRT046560 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT046561 BRD1 bromodomain containing 1 1 1
MIRT046562 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT046563 RAB21 RAB21, member RAS oncogene family 1 1
MIRT046564 HMGB1 high-mobility group box 1 1 1
MIRT046565 RRM2 ribonucleotide reductase M2 1 1
MIRT046566 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT046567 RANBP2 RAN binding protein 2 1 1
MIRT046568 SART3 squamous cell carcinoma antigen recognized by T cells 3 1 1