Accession ID: MIRT000535 [miRNA, hsa-miR-125b ::
TP53, target gene]
| miRNA name | hsa-miR-125b |
|---|
 |
| Gene Symbol | TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] |
|---|---|
| Synonyms | FLJ92943, LFS1, TRP53, p53 |
| Description | tumor protein p53 |
| Transcript | NM_001126114 LinkOut: [ RefSeq ] |
| Other Transcripts | NM_001126112, NM_000546, NM_001126113, NM_001126115, NM_001126116, NM_001126117 |
| Expression | LinkOut: [ BioGPS ] |
| KEGG Pathway |
hsa04010 MAPK signaling pathway - Homo sapiens (human) hsa04110 Cell cycle - Homo sapiens (human) hsa04115 p53 signaling pathway - Homo sapiens (human) hsa04210 Apoptosis - Homo sapiens (human) hsa04310 Wnt signaling pathway - Homo sapiens (human) hsa04722 Neurotrophin signaling pathway - Homo sapiens (human) hsa05014 Amyotrophic lateral sclerosis (ALS) - Homo sapiens (human) hsa05016 Huntington's disease - Homo sapiens (human) hsa05200 Pathways in cancer - Homo sapiens (human) hsa05210 Colorectal cancer - Homo sapiens (human) hsa05212 Pancreatic cancer - Homo sapiens (human) hsa05213 Endometrial cancer - Homo sapiens (human) hsa05214 Glioma - Homo sapiens (human) hsa05215 Prostate cancer - Homo sapiens (human) hsa05216 Thyroid cancer - Homo sapiens (human) hsa05217 Basal cell carcinoma - Homo sapiens (human) hsa05218 Melanoma - Homo sapiens (human) hsa05219 Bladder cancer - Homo sapiens (human) hsa05220 Chronic myeloid leukemia - Homo sapiens (human) hsa05222 Small cell lung cancer - Homo sapiens (human) hsa05223 Non-small cell lung cancer - Homo sapiens (human) |
| Putative miRNA Targets on TP53 | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] |
| 3'UTR of TP53 (miRNA target sites are highlighted) |
>TP53|NM_001126114|3'UTR 1 TAAAGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAA 81 ACTCGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTC 161 AAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTAC 241 CTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGAC 321 AGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTC 401 AGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGG 481 AGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGT 561 TCTTGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTC 641 CCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATT 721 GTGAGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAG 801 GGTGCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTC 881 AAGTCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATC 961 CCACACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCT 1041 TTTTTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTG 1121 ATCTTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTC 1201 ATGCCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCC 1281 TGGGCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGG 1361 TCAACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTT 1441 TTATATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG Target sites Provided by authors Predicted by miRanda |
| miRNA:Target | hsa-miR-125b :: TP53 [ Functional MTI ] | ||||||
|---|---|---|---|---|---|---|---|
| Validation Method | In situ hybridization , Luciferase reporter assay , qRT-PCR , Western blot | ||||||
| Conditions | 293T, H1299, SH-SY5Y | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | miRBase Target Database, TargetScan | ||||||
| Original Description (Extracted from the article) | ... miR-125b binds to the 3' UTR of human and zebrafish p53 mRNAs.//Ectopic expression of miR-125b by transfection of miR-125b duplex into HEK-293T cells suppresses by ;60% (P < 0.01) the activity of a Renilla luciferaseconstruct containing the miR-125b MREs of human or zebrafish p53 at its 3' end. ... - Le, M. T. Teh, C. Shyh-Chang, N. Xie, H. et al., 2009, Genes Dev. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Le, M. T.
Teh, C.
Shyh-Chang, N.
Xie, H. et al. - Genes Dev, 2009
The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.
LinkOut: [PMID: 19293287]
|
| miRNA:Target | hsa-miR-125b :: TP53 [ Functional MTI ] |
|---|---|
| Validation Method | Luciferase reporter assay , Western blot |
| Location of target site | 3'UTR |
| Article |
- Inui, M.
Martello, G.
Piccolo, S. - Nat Rev Mol Cell Biol, 2010
MicroRNAs (miRNAs) are integral elements in the post-transcriptional control of gene expression. After the identification of hundreds of miRNAs, the challenge is now to understand their specific biological function. Signalling pathways are ideal candidates for miRNA-mediated regulation owing to the sharp dose-sensitive nature of their effects. Indeed, emerging evidence suggests that miRNAs affect the responsiveness of cells to signalling molecules such as transforming growth factor-beta, WNT, Notch and epidermal growth factor. As such, miRNAs serve as nodes of signalling networks that ensure homeostasis and regulate cancer, metastasis, fibrosis and stem cell biology.
LinkOut: [PMID: 20216554]
|
| miRNA:Target | hsa-miR-125b :: TP53 [ Functional MTI ] |
|---|---|
| Validation Method | Luciferase reporter assay , qRT-PCR , Western blot |
| Conditions | SH-SY5Y, HEK-293T |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan |
| Original Description (Extracted from the article) | ... Ppp1ca is repressed by miR-125b in all three species, Prkra is repressed by miR-125b in human and mice, while Tp53 is repressed in humans and zebrafish ... - Le, M. T. Shyh-Chang, N. Khaw, S. L. Chin, et al., 2011, PLoS Genet. |
| Article |
- Le, M. T.
Shyh-Chang, N.
Khaw, S. L.
Chin, et al. - PLoS Genet, 2011
MicroRNAs regulate networks of genes to orchestrate cellular functions. MiR-125b, the vertebrate homologue of the Caenorhabditis elegans microRNA lin-4, has been implicated in the regulation of neural and hematopoietic stem cell homeostasis, analogous to how lin-4 regulates stem cells in C. elegans. Depending on the cell context, miR-125b has been proposed to regulate both apoptosis and proliferation. Because the p53 network is a central regulator of both apoptosis and proliferation, the dual roles of miR-125b raise the question of what genes in the p53 network might be regulated by miR-125b. By using a gain- and loss-of-function screen for miR-125b targets in humans, mice, and zebrafish and by validating these targets with the luciferase assay and a novel miRNA pull-down assay, we demonstrate that miR-125b directly represses 20 novel targets in the p53 network. These targets include both apoptosis regulators like Bak1, Igfbp3, Itch, Puma, Prkra, Tp53inp1, Tp53, Zac1, and also cell-cycle regulators like cyclin C, Cdc25c, Cdkn2c, Edn1, Ppp1ca, Sel1l, in the p53 network. We found that, although each miRNA-target pair was seldom conserved, miR-125b regulation of the p53 pathway is conserved at the network level. Our results lead us to propose that miR-125b buffers and fine-tunes p53 network activity by regulating the dose of both proliferative and apoptotic regulators, with implications for tissue stem cell homeostasis and oncogenesis.
LinkOut: [PMID: 21935352]
|