Accession ID: MIRT000639 [miRNA, hsa-miR-9-5p :: POU2F2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-9-1LinkOut: [miRBase ]
Synonyms MIRN9-1, hsa-mir-9-1, miRNA9-1, MIR9-1
Description Homo sapiens miR-9-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-9-5p
Mature Sequence 16| UCUUUGGUUAUCUAGCUGUAUGA |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-9-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-9-5p :: POU2F2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research EIMMO , TargetScan
Original Description (Extracted from the article) ... we find the following: mir-424 targets ANLN, CCNE1, CCND1,WEE1, ATF6, KIF23, CHEK1, CDC25A, CDC14A and CCNF whereas mir-503 targets CDC14A, ANLN, CCND1, ATF6,EIF2C1, CDC25A, CHEK1, CCNE1, CCNE2, WEE1, CCNF and CDKN1A. ...

- Forrest, A. R. Kanamori-Katayama, M. et al., 2010, Leukemia.

Article - Forrest, A. R. Kanamori-Katayama, M. et al.
- Leukemia, 2010
Acute myeloid leukemia (AML) involves a block in terminal differentiation of the myeloid lineage and uncontrolled proliferation of a progenitor state. Using phorbol myristate acetate (PMA), it is possible to overcome this block in THP-1 cells (an M5-AML containing the MLL-MLLT3 fusion), resulting in differentiation to an adherent monocytic phenotype. As part of FANTOM4, we used microarrays to identify 23 microRNAs that are regulated by PMA. We identify four PMA-induced microRNAs (mir-155, mir-222, mir-424 and mir-503) that when overexpressed cause cell-cycle arrest and partial differentiation and when used in combination induce additional changes not seen by any individual microRNA. We further characterize these pro-differentiative microRNAs and show that mir-155 and mir-222 induce G2 arrest and apoptosis, respectively. We find mir-424 and mir-503 are derived from a polycistronic precursor mir-424-503 that is under repression by the MLL-MLLT3 leukemogenic fusion. Both of these microRNAs directly target cell-cycle regulators and induce G1 cell-cycle arrest when overexpressed in THP-1. We also find that the pro-differentiative mir-424 and mir-503 downregulate the anti-differentiative mir-9 by targeting a site in its primary transcript. Our study highlights the combinatorial effects of multiple microRNAs within cellular systems.
LinkOut: [PMID: 19956200]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
307 hsa-miR-9-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000025 MMP13 matrix metallopeptidase 13 (collagenase 3) 2 1
MIRT000026 REST RE1-silencing transcription factor 3 2
MIRT000029 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 3 2
MIRT000639 POU2F2 POU class 2 homeobox 2 2 1
MIRT000640 BCL6 B-cell CLL/lymphoma 6 2 1
MIRT000641 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 2 2
MIRT001202 RAB34 RAB34, member RAS oncogene family 5 2
MIRT001736 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT001937 PRDM1 PR domain containing 1, with ZNF domain 4 3
MIRT003193 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 4 5
MIRT003300 FOXO1 forkhead box O1 4 2
MIRT003323 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 3 5
MIRT004982 NR2E1 nuclear receptor subfamily 2, group E, member 1 4 1
MIRT005390 ONECUT2 one cut homeobox 2 5 2
MIRT005783 CDX2 caudal type homeobox 2 2 1
MIRT006781 AP3B1 adaptor-related protein complex 3, beta 1 subunit 4 1
MIRT006782 CCNG1 cyclin G1 4 2
MIRT006833 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT006892 SIRT1 sirtuin 1 3 2
MIRT006894 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT007035 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT007060 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 2 1
MIRT007326 FOXO3 forkhead box O3 1 1
MIRT007372 CCND1 cyclin D1 1 1
MIRT021318 KLRC1 killer cell lectin-like receptor subfamily C, member 1 1 1
MIRT021319 DSP desmoplakin 1 1
MIRT021320 POGZ pogo transposable element with ZNF domain 1 1
MIRT021321 CCL19 chemokine (C-C motif) ligand 19 1 1
MIRT021322 EFNA1 ephrin-A1 1 1
MIRT021323 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT021324 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT021325 MYF6 myogenic factor 6 (herculin) 1 1
MIRT021326 LRP1 low density lipoprotein receptor-related protein 1 1 1
MIRT021327 SLC35E2 solute carrier family 35, member E2 1 1
MIRT021328 HOXC12 homeobox C12 1 1
MIRT021329 SYNE1 spectrin repeat containing, nuclear envelope 1 1 1
MIRT021330 STK3 serine/threonine kinase 3 1 1
MIRT021331 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT021332 PLEKHB1 pleckstrin homology domain containing, family B (evectins) member 1 1 1
MIRT021333 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 1
MIRT021334 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT021335 ATG10 autophagy related 10 1 1
MIRT021336 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT021337 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT021338 CMTM2 CKLF-like MARVEL transmembrane domain containing 2 1 1
MIRT021339 CERS4 ceramide synthase 4 1 1
MIRT021340 PPAP2A phosphatidic acid phosphatase type 2A 1 1
MIRT021341 KCNJ15 potassium inwardly-rectifying channel, subfamily J, member 15 1 1
MIRT021342 SUMF2 sulfatase modifying factor 2 1 1
MIRT021343 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT021344 CXXC5 CXXC finger protein 5 1 1
MIRT021345 TCL1B T-cell leukemia/lymphoma 1B 1 1
MIRT021346 EP300 E1A binding protein p300 1 1
MIRT021347 AUH AU RNA binding protein/enoyl-CoA hydratase 1 1
MIRT021348 TRRAP transformation/transcription domain-associated protein 1 1
MIRT021349 DMXL1 Dmx-like 1 1 1
MIRT021350 EOGT EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT021351 RCC2 regulator of chromosome condensation 2 1 1
MIRT021352 PIGB phosphatidylinositol glycan anchor biosynthesis, class B 1 1
MIRT021353 NAV1 neuron navigator 1 1 1
MIRT021354 ATP6V1C2 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 1 1
MIRT021355 PLCB4 phospholipase C, beta 4 1 1
MIRT021356 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT021357 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT021358 AVIL advillin 1 1
MIRT021359 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT021360 CA13 carbonic anhydrase XIII 1 1
MIRT021361 FLNB filamin B, beta 1 1
MIRT021362 IREB2 iron-responsive element binding protein 2 1 1
MIRT021363 KLRK1 killer cell lectin-like receptor subfamily K, member 1 1 1
MIRT021364 CDH3 cadherin 3, type 1, P-cadherin (placental) 1 1
MIRT021365 MCC mutated in colorectal cancers 1 1
MIRT021366 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT021367 MAP1B microtubule-associated protein 1B 1 1
MIRT021368 NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 1 1
MIRT021369 SPAG9 sperm associated antigen 9 1 1
MIRT021370 ZNF407 zinc finger protein 407 1 1
MIRT021371 SEC23IP SEC23 interacting protein 1 1
MIRT021372 NBEA neurobeachin 1 1
MIRT021373 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 1 1
MIRT021374 PQLC3 PQ loop repeat containing 3 1 1
MIRT021375 C9orf89 chromosome 9 open reading frame 89 1 1
MIRT021376 NCOR2 nuclear receptor corepressor 2 1 1
MIRT021377 P4HA2 prolyl 4-hydroxylase, alpha polypeptide II 1 1
MIRT021378 MYLK myosin light chain kinase 1 1
MIRT021379 NIN ninein (GSK3B interacting protein) 1 1
MIRT021380 FERMT1 fermitin family member 1 1 1
MIRT021381 PRKD3 protein kinase D3 1 1
MIRT021382 SYAP1 synapse associated protein 1 2 2
MIRT021383 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT021384 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT021385 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT021386 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT021387 SNX7 sorting nexin 7 1 1
MIRT021388 LMNA lamin A/C 1 1
MIRT021389 FBN2 fibrillin 2 1 1
MIRT021390 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT021391 TBPL1 TBP-like 1 1 1
MIRT021392 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT021393 FAIM Fas apoptotic inhibitory molecule 1 1
MIRT021394 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT021395 VIM vimentin 1 1
MIRT021396 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT021397 XRN2 5'-3' exoribonuclease 2 1 1
MIRT021398 HIST1H4H histone cluster 1, H4h 1 3
MIRT021399 TWISTNB TWIST neighbor 2 2
MIRT021400 ZBED3 zinc finger, BED-type containing 3 2 2
MIRT021401 VEGFA vascular endothelial growth factor A 2 1
MIRT021402 CHMP2B charged multivesicular body protein 2B 2 1
MIRT021403 STMN1 stathmin 1 3 2
MIRT021404 GRN granulin 1 1
MIRT021405 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT021406 TAGLN transgelin 1 1
MIRT021407 EFCAB14 KIAA0494 1 1
MIRT021408 FSTL3 follistatin-like 3 (secreted glycoprotein) 1 1
MIRT021409 BIK BCL2-interacting killer (apoptosis-inducing) 1 1
MIRT021410 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 1 1
MIRT021411 HLA-A major histocompatibility complex, class I, A 1 1
MIRT021412 CALML5 calmodulin-like 5 1 1
MIRT021413 HTR3A 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic 1 1
MIRT021414 F2 coagulation factor II (thrombin) 1 1
MIRT021415 LPXN leupaxin 1 1
MIRT021416 LINC00483 long intergenic non-protein coding RNA 483 1 1
MIRT021417 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT021418 MTX3 metaxin 3 1 1
MIRT021419 AKR1CL1 aldo-keto reductase family 1, member C-like 1 1 1
MIRT021420 IDS iduronate 2-sulfatase 1 1
MIRT021421 ELF3 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) 1 1
MIRT021422 GNAT2 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 1 1
MIRT021423 SLC30A4 solute carrier family 30 (zinc transporter), member 4 1 1
MIRT021424 IPO7 importin 7 1 1
MIRT021425 WNT8A wingless-type MMTV integration site family, member 8A 1 1
MIRT021426 GIP gastric inhibitory polypeptide 1 1
MIRT021427 SLC22A5 solute carrier family 22 (organic cation/carnitine transporter), member 5 1 1
MIRT021428 SPON2 spondin 2, extracellular matrix protein 1 1
MIRT021429 MAGEA2B melanoma antigen family A, 2B 1 1
MIRT021430 ATL1 atlastin GTPase 1 1 1
MIRT021431 RHOV ras homolog family member V 1 1
MIRT021432 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT021433 LRRTM1 leucine rich repeat transmembrane neuronal 1 1 1
MIRT021434 WNT6 wingless-type MMTV integration site family, member 6 1 1
MIRT021435 NKX2-2 NK2 homeobox 2 1 1
MIRT021436 SLC25A30 solute carrier family 25, member 30 1 1
MIRT021437 CUEDC1 CUE domain containing 1 1 1
MIRT021438 ALDH1A3 aldehyde dehydrogenase 1 family, member A3 1 1
MIRT021439 MN1 meningioma (disrupted in balanced translocation) 1 1 1
MIRT021440 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT021441 SLC22A3 solute carrier family 22 (extraneuronal monoamine transporter), member 3 1 1
MIRT021442 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 1
MIRT021443 KIF1B kinesin family member 1B 1 1
MIRT021444 E2F7 E2F transcription factor 7 1 1
MIRT021445 HN1L hematological and neurological expressed 1-like 1 1
MIRT021446 SNHG16 small nucleolar RNA host gene 16 (non-protein coding) 1 1
MIRT021447 CYP39A1 cytochrome P450, family 39, subfamily A, polypeptide 1 1 1
MIRT021448 MORF4L1 mortality factor 4 like 1 1 1
MIRT021449 ARHGEF10 Rho guanine nucleotide exchange factor (GEF) 10 1 1
MIRT021450 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT021451 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT021452 ATP11C ATPase, class VI, type 11C 1 1
MIRT021453 FRMD4B FERM domain containing 4B 1 1
MIRT021454 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT021455 OPTN optineurin 1 1
MIRT021456 FNBP1 formin binding protein 1 1 1
MIRT021457 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT021458 PRG4 p53-responsive gene 4 1 1
MIRT021459 SDC1 syndecan 1 1 1
MIRT021460 EEF2K eukaryotic elongation factor-2 kinase 1 1
MIRT021461 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT021462 CERS2 ceramide synthase 2 1 1
MIRT021463 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT021464 COL12A1 collagen, type XII, alpha 1 1 1
MIRT021465 PDZK1 PDZ domain containing 1 1 1
MIRT021466 CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 1 1
MIRT021467 PPP4R2 protein phosphatase 4, regulatory subunit 2 1 1
MIRT021468 SERAC1 serine active site containing 1 1 1
MIRT021469 TESK2 testis-specific kinase 2 1 1
MIRT021470 LDLRAP1 low density lipoprotein receptor adaptor protein 1 1 1
MIRT021471 MYH9 myosin, heavy chain 9, non-muscle 2 2
MIRT021472 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT021473 FAM46A family with sequence similarity 46, member A 1 1
MIRT021474 CCNDBP1 cyclin D-type binding-protein 1 1 1
MIRT021475 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 1
MIRT021476 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021477 POU2F1 POU class 2 homeobox 1 1 1
MIRT021478 SYNGR2 synaptogyrin 2 1 1
MIRT021479 SYPL1 synaptophysin-like 1 1 1
MIRT021480 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT021481 RNF44 ring finger protein 44 1 1
MIRT021482 TC2N tandem C2 domains, nuclear 1 1
MIRT021483 COLEC12 collectin sub-family member 12 1 1
MIRT021484 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT021485 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT021486 CD34 CD34 molecule 1 1
MIRT021487 MESDC1 mesoderm development candidate 1 1 1
MIRT045780 BOD1L1 biorientation of chromosomes in cell division 1-like 1 1 1
MIRT045781 ITGB3BP integrin beta 3 binding protein (beta3-endonexin) 1 1
MIRT045782 QARS glutaminyl-tRNA synthetase 1 1
MIRT045783 KIF1A kinesin family member 1A 1 1
MIRT053098 PPARA peroxisome proliferator-activated receptor alpha 1 1
MIRT053115 PRTG protogenin 1 1
MIRT053212 KLF17 Kruppel-like factor 17 2 1
MIRT053357 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 1
MIRT053358 CYFIP2 cytoplasmic FMR1 interacting protein 2 2 1
MIRT053359 ENDOD1 endonuclease domain containing 1 2 1
MIRT053360 HBP1 HMG-box transcription factor 1 2 1
MIRT053361 JAK1 Janus kinase 1 2 1
MIRT053362 KLF6 Kruppel-like factor 6 2 1
MIRT053363 LHFPL2 lipoma HMGIC fusion partner-like 2 2 1
MIRT053364 MAP3K8 mitogen-activated protein kinase kinase kinase 8 2 1
MIRT053365 RAB8B RAB8B, member RAS oncogene family 2 1
MIRT053366 RHAG Rh-associated glycoprotein 2 1
MIRT053367 RHOH ras homolog family member H 2 1
MIRT053368 RYBP RING1 and YY1 binding protein 2 1
MIRT053369 SERPINB9 serpin peptidase inhibitor, clade B (ovalbumin), member 9 2 1
MIRT053370 TAL1 T-cell acute lymphocytic leukemia 1 2 1
MIRT053371 TFRC transferrin receptor (p90, CD71) 2 1
MIRT053372 TRAK2 trafficking protein, kinesin binding 2 2 1
MIRT053373 VAMP5 vesicle-associated membrane protein 5 2 1
MIRT053481 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 1 1
MIRT053482 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 1 1
MIRT053793 CREB1 cAMP responsive element binding protein 1 3 1
MIRT053794 NF1 neurofibromin 1 3 1
MIRT054041 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 3 1
MIRT054042 DICER1 dicer 1, ribonuclease type III 4 2
MIRT054196 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 1
MIRT054369 Cthrc1 collagen triple helix repeat containing 1 3 1
MIRT054715 CXCR4 chemokine (C-X-C motif) receptor 4 3 3
MIRT054798 FOXP1 forkhead box P1 3 1
MIRT100125 HIST1H2AI histone cluster 1, H2ai 1 3
MIRT251627 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 1 1
MIRT303632 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT437375 PRTG protogenin 3 1
MIRT437469 ACAT1 acetyl-CoA acetyltransferase 1 3 1
MIRT437956 HDAC4 histone deacetylase 4 1 1
MIRT437986 DRD2 dopamine receptor D2 1 1
MIRT438117 MIRLET7D microRNA let-7d 1 1
MIRT438536 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 2 1
MIRT438746 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 3 1
MIRT438753 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 1
MIRT442709 UBE4B ubiquitination factor E4B 1 1
MIRT442743 SERINC5 serine incorporator 5 1 1
MIRT444344 GALNTL6 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 1 1
MIRT445645 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT447217 ATXN7 ataxin 7 1 1
MIRT468282 SFT2D2 SFT2 domain containing 2 1 1
MIRT468533 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT482004 AMOTL1 angiomotin like 1 1 6
MIRT485305 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 3
MIRT492094 TAOK1 TAO kinase 1 1 3
MIRT493465 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 2
MIRT493883 FAM73B family with sequence similarity 73, member B 1 2
MIRT497210 CDH7 cadherin 7, type 2 1 1
MIRT507388 EN2 engrailed homeobox 2 1 2
MIRT511642 HIST1H3F histone cluster 1, H3f 1 2
MIRT511782 HIST1H2AE histone cluster 1, H2ae 1 2
MIRT513555 IL5 interleukin 5 (colony-stimulating factor, eosinophil) 1 1
MIRT517439 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT526994 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT530210 NSUN7 NOP2/Sun domain family, member 7 1 1
MIRT534703 RNF103-CHMP3 RNF103-CHMP3 readthrough 1 2
MIRT538532 CHMP3 charged multivesicular body protein 3 1 2
MIRT547741 KIAA1468 KIAA1468 1 1
MIRT548083 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT553524 TMEM245 transmembrane protein 245 1 2
MIRT555487 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT558992 CA8 carbonic anhydrase VIII 1 1
MIRT609369 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT609845 ZNF557 zinc finger protein 557 1 1
MIRT610639 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT620230 PACS1 phosphofurin acidic cluster sorting protein 1 1 1
MIRT622432 NUDT19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 1 1
MIRT624367 CDK12 cyclin-dependent kinase 12 1 1
MIRT624796 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT626462 CMKLR1 chemokine-like receptor 1 1 1
MIRT626610 ACAA2 acetyl-CoA acyltransferase 2 1 2
MIRT629750 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT630036 MTL5 metallothionein-like 5, testis-specific (tesmin) 1 1
MIRT634055 NUP155 nucleoporin 155kDa 1 1
MIRT637896 SLC19A3 solute carrier family 19, member 3 1 1
MIRT640384 EMC1 ER membrane protein complex subunit 1 1 2
MIRT641973 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT643403 PAX1 paired box 1 1 1
MIRT645378 MKX mohawk homeobox 1 1
MIRT646920 TRIM14 tripartite motif containing 14 1 1
MIRT649452 WDR70 WD repeat domain 70 1 1
MIRT650621 UMPS uridine monophosphate synthetase 1 1
MIRT651245 ZMAT4 zinc finger, matrin-type 4 1 1
MIRT653306 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT653594 SLC35B3 solute carrier family 35, member B3 1 1
MIRT655095 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 1 1
MIRT656624 LRRC15 leucine rich repeat containing 15 1 1
MIRT656891 KIF1C kinesin family member 1C 1 1
MIRT658522 ESR1 estrogen receptor 1 1 1
MIRT660676 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT663674 TMEM216 transmembrane protein 216 1 1
MIRT679093 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT682590 CPA4 carboxypeptidase A4 1 1
MIRT690125 ZFAND1 zinc finger, AN1-type domain 1 1 1
MIRT704058 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT705652 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 1 1
MIRT707304 PRRX1 paired related homeobox 1 1 1
MIRT711360 VPS8 vacuolar protein sorting 8 homolog (S. cerevisiae) 1 1
MIRT712224 RNF146 ring finger protein 146 1 1
MIRT719696 STX6 syntaxin 6 1 1
MIRT722385 TRMT13 tRNA methyltransferase 13 homolog (S. cerevisiae) 1 1
MIRT723019 MSR1 macrophage scavenger receptor 1 1 1
MIRT723398 OAF OAF homolog (Drosophila) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*