Accession ID: MIRT000665 [miRNA, hsa-miR-206 :: NOTCH3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-206LinkOut: [miRBase ]
Description Homo sapiens miR-206 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-206
Mature Sequence 53| UGGAAUGUAAGGAAGUGUGUGG |74
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-206 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CADASIL, CASIL
Description Notch homolog 3 (Drosophila)
Transcript NM_0004    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH3
(miRNA target sites are highlighted)
>NOTCH3|NM_0004|3'UTR
   1 TGAGACGCTCGTCAGTTCTTAGATCTTGGGGGCCTAAAGAGACCCCCGTCCTGCCTCCTTTCTTTCTCTGTCTCTTCCTT
  81 CCTTTTAGTCTTTTTCATCCTCTTCTCTTTCCACCAACCCTCCTGCATCCTTGCCTTGCAGCGTGACCGAGATAGGTCAT
 161 CAGCCCAGGGCTTCAGTCTTCCTTTATTTATAATGGGTGGGGGCTACCACCCACCCTCTCAGTCTTGTGAAGAGTCTGGG
 241 ACCTCCTTCTTCCCCACTTCTCTCTTCCCTCATTCCTTTCTCTCTCCTTCTGGCCTCTCATTTCCTTACACTCTGACATG
 321 AATGAATTATTATTATTTTTATTTTTCTTTTTTTTTTTACATTTTGTATAGAAACAAATTCATTTAAACAAACTTATTAT
 401 TATTATTTTTTACAAAATATATATATGGAGATGCTCCCTCCCCCTGTGAACCCCCCAGTGCCCCCGTGGGGCTGAGTCTG
 481 TGGGCCCATTCGGCCAAGCTGGATTCTGTGTACCTAGTACACAGGCATGACTGGGATCCCGTGTACCGAGTACACGACCC
 561 AGGTATGTACCAAGTAGGCACCCTTGGGCGCACCCACTGGGGCCAGGGGTCGGGGGAGTGTTGGGAGCCTCCTCCCCACC
 641 CCACCTCCCTCACTTCACTGCATTCCAGATGGGACATGTTCCATAGCCTTGCTGGGGAAGGGCCCACTGCCAACTCCCTC
 721 TGCCCCAGCCCCACCCTTGGCCATCTCCCTTTGGGAACTAGGGGGCTGCTGGTGGGAAATGGGAGCCAGGGCAGATGTAT
 801 GCATTCCTTTGTGTCCCTGTAAATGTGGGACTACAAGAAGAGGAGCTGCCTGAGTGGTACTTTCTCTTCCTGGTAATCCT
 881 CTGGCCCAGCCTCATGGCAGAATAGAGGTATTTTTAGGCTATTTTTGTAATATGGCTTCTGGTCAAAATCCCTGTGTAGC
 961 TGAATTCCCAAGCCCTGCATTGTACAGCCCCCCACTCCCCTCACCACCTAATAAAGGAATAGTTAACACTCAAAAAAAAA
1041 AAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gguGUGUGAAGGAAUGUAAGGu 5'
             | ||||||  |:|||||| 
Target 5' tccCTCACTTCACTGCATTCCa 3'
646 - 667 155.00 -23.90
2
miRNA  3' gguGUGUGAAGGAAUGUAAGGu 5'
             | ||:||||||||| ||: 
Target 5' cctCTCATTTCCTTACACTCTg 3'
294 - 315 135.00 -19.30
3
miRNA  3' ggugUGUGAAGGAAUGUAAGGu 5'
              :||  | : |:|||||| 
Target 5' caggGCAGATGTATGCATTCCt 3'
787 - 808 134.00 -9.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-206 :: NOTCH3    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other , Reporter assay
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-206 targets and regulates human notch3.//As expected, miR-206 showed a strong inhibitory effect on normal (Fig. 2A, left) but not deleted (Fig. 2A, right) or mutated (supplemental Fig. S2B) human notch3 3'-UTR-luciferase activity. Similarly, forced expression of full-length notch3 largely rescued the repressive effect of miR-206 on human notch3 3'-UTR-lucif- erase activity (Fig. 2A, left). When the cells were treated with a specific inhibitor of miR-206, the repression of the human notch3 3'-UTR by miR-206 was moderately released (Fig. 2B, left), suggesting that a higher dose of the miR-206 inhibitor would be required to efficiently block the inhibitory effect of miR-206 on the activity of the human notch3 3'-UTR.//As expected, ectopic expression of miR-206 resulted in a significant reduction of human Notch3 protein expression (Fig. 2C and supplemental Fig. S3A). In addition, the level of human notch3 mRNA was also repressed by miR-206 (Fig. 2D) ...

- Song, G. Zhang, Y. Wang, L., 2009, J Biol Chem.

Article - Song, G. Zhang, Y. Wang, L.
- J Biol Chem, 2009
MicroRNAs contribute to cancer development by acting as oncogenes or tumor suppressor genes. However, only a few microRNA target genes were determined. We identified a nearly perfect complementarity between miR-206 and the 3'-untranslated regions of both mouse and human notch3. Expression of miR-206 decreased the luciferase activity dose-dependently when cotransfected with the mouse or human notch3 3'-untranslated region-luciferase reporter containing the miR-206 target site in HeLa cells. This suppression was relieved by deletion and mutation of the miR-206-binding site and was partially recovered by expression of notch3 or by a specific inhibitor of miR-206. Interestingly, overexpression of miR-206 decreased the levels of both Notch3 protein and mRNA. Expression of miR-206 markedly induced apoptotic cell death and blocked the anti-apoptotic activity of Notch3. In addition, ectopic expression of miR-206 inhibited HeLa cell migration and focus formation. Therefore, we identified miR-206 as a pro-apoptotic activator of cell death, which was associated with its inhibition of notch3 signaling and tumor formation. The inhibition of cancer cell migration and focus formation by miR-206 strongly suggests that miR-206 may function as a novel tumor suppressor.
LinkOut: [PMID: 19723635]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
10 hsa-miR-206 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000185 MET met proto-oncogene (hepatocyte growth factor receptor) 4 3
MIRT000665 NOTCH3 Notch homolog 3 (Drosophila) 4 2
MIRT000700 ESR1 estrogen receptor 1 5 4
MIRT001788 UTRN utrophin 1 1
MIRT001789 FSTL1 follistatin-like 1 1 1
MIRT003004 TAC1 tachykinin, precursor 1 2 1
MIRT004671 PAX3 paired box 3 5 1
MIRT005410 Tppp tubulin polymerization promoting protein 4 1
MIRT007217 CCND2 cyclin D2 1 2
MIRT021080 GJA1 gap junction protein, alpha 1, 43kDa 2 2