Accession ID: MIRT000665 [miRNA, hsa-miR-206 :: NOTCH3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-206LinkOut: [miRBase ]
Description Homo sapiens miR-206 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-206
Mature Sequence 53| UGGAAUGUAAGGAAGUGUGUGG |74
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-206 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CADASIL, CASIL
Description notch 3
Transcript NM_000435    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH3
(miRNA target sites are highlighted)
>NOTCH3|NM_000435|3'UTR
   1 GACGCTCGTCAGTTCTTAGATCTTGGGGGCCTAAAGAGACCCCCGTCCTGCCTCCTTTCTTTCTCTGTCTCTTCCTTCCT
  81 TTTAGTCTTTTTCATCCTCTTCTCTTTCCACCAACCCTCCTGCATCCTTGCCTTGCAGCGTGACCGAGATAGGTCATCAG
 161 CCCAGGGCTTCAGTCTTCCTTTATTTATAATGGGTGGGGGCTACCACCCACCCTCTCAGTCTTGTGAAGAGTCTGGGACC
 241 TCCTTCTTCCCCACTTCTCTCTTCCCTCATTCCTTTCTCTCTCCTTCTGGCCTCTCATTTCCTTACACTCTGACATGAAT
 321 GAATTATTATTATTTTTATTTTTCTTTTTTTTTTTACATTTTGTATAGAAACAAATTCATTTAAACAAACTTATTATTAT
 401 TATTTTTTACAAAATATATATATGGAGATGCTCCCTCCCCCTGTGAACCCCCCAGTGCCCCCGTGGGGCTGAGTCTGTGG
 481 GCCCATTCGGCCAAGCTGGATTCTGTGTACCTAGTACACAGGCATGACTGGGATCCCGTGTACCGAGTACACGACCCAGG
 561 TATGTACCAAGTAGGCACCCTTGGGCGCACCCACTGGGGCCAGGGGTCGGGGGAGTGTTGGGAGCCTCCTCCCCACCCCA
 641 CCTCCCTCACTTCACTGCATTCCAGATGGGACATGTTCCATAGCCTTGCTGGGGAAGGGCCCACTGCCAACTCCCTCTGC
 721 CCCAGCCCCACCCTTGGCCATCTCCCTTTGGGAACTAGGGGGCTGCTGGTGGGAAATGGGAGCCAGGGCAGATGTATGCA
 801 TTCCTTTGTGTCCCTGTAAATGTGGGACTACAAGAAGAGGAGCTGCCTGAGTGGTACTTTCTCTTCCTGGTAATCCTCTG
 881 GCCCAGCCTCATGGCAGAATAGAGGTATTTTTAGGCTATTTTTGTAATATGGCTTCTGGTCAAAATCCCTGTGTAGCTGA
 961 ATTCCCAAGCCCTGCATTGTACAGCCCCCCACTCCCCTCACCACCTAATAAAGGAATAGTTAACACTCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gguGUGUGAAGGAAUGUAAGGu 5'
             | ||||||  |:|||||| 
Target 5' tccCTCACTTCACTGCATTCCa 3'
643 - 664 155.00 -23.90
2
miRNA  3' gguGUGUGAAGGAAUGUAAGGu 5'
             | ||:||||||||| ||: 
Target 5' cctCTCATTTCCTTACACTCTg 3'
291 - 312 135.00 -19.30
3
miRNA  3' ggugUGUGAAGGAAUGUAAGGu 5'
              :||  | : |:|||||| 
Target 5' caggGCAGATGTATGCATTCCt 3'
784 - 805 134.00 -9.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-206 :: NOTCH3    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other , Reporter assay
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-206 targets and regulates human notch3.//As expected, miR-206 showed a strong inhibitory effect on normal (Fig. 2A, left) but not deleted (Fig. 2A, right) or mutated (supplemental Fig. S2B) human notch3 3'-UTR-luciferase activity. Similarly, forced expression of full-length notch3 largely rescued the repressive effect of miR-206 on human notch3 3'-UTR-lucif- erase activity (Fig. 2A, left). When the cells were treated with a specific inhibitor of miR-206, the repression of the human notch3 3'-UTR by miR-206 was moderately released (Fig. 2B, left), suggesting that a higher dose of the miR-206 inhibitor would be required to efficiently block the inhibitory effect of miR-206 on the activity of the human notch3 3'-UTR.//As expected, ectopic expression of miR-206 resulted in a significant reduction of human Notch3 protein expression (Fig. 2C and supplemental Fig. S3A). In addition, the level of human notch3 mRNA was also repressed by miR-206 (Fig. 2D) ...

- Song, G. Zhang, Y. Wang, L., 2009, J Biol Chem.

Article - Song, G. Zhang, Y. Wang, L.
- J Biol Chem, 2009
MicroRNAs contribute to cancer development by acting as oncogenes or tumor suppressor genes. However, only a few microRNA target genes were determined. We identified a nearly perfect complementarity between miR-206 and the 3'-untranslated regions of both mouse and human notch3. Expression of miR-206 decreased the luciferase activity dose-dependently when cotransfected with the mouse or human notch3 3'-untranslated region-luciferase reporter containing the miR-206 target site in HeLa cells. This suppression was relieved by deletion and mutation of the miR-206-binding site and was partially recovered by expression of notch3 or by a specific inhibitor of miR-206. Interestingly, overexpression of miR-206 decreased the levels of both Notch3 protein and mRNA. Expression of miR-206 markedly induced apoptotic cell death and blocked the anti-apoptotic activity of Notch3. In addition, ectopic expression of miR-206 inhibited HeLa cell migration and focus formation. Therefore, we identified miR-206 as a pro-apoptotic activator of cell death, which was associated with its inhibition of notch3 signaling and tumor formation. The inhibition of cancer cell migration and focus formation by miR-206 strongly suggests that miR-206 may function as a novel tumor suppressor.
LinkOut: [PMID: 19723635]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
95 hsa-miR-206 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000185 MET met proto-oncogene (hepatocyte growth factor receptor) 4 3
MIRT000665 NOTCH3 notch 3 4 2
MIRT000700 ESR1 estrogen receptor 1 5 4
MIRT001788 UTRN utrophin 1 1
MIRT001789 FSTL1 follistatin-like 1 1 1
MIRT003004 TAC1 tachykinin, precursor 1 2 1
MIRT004671 PAX3 paired box 3 5 3
MIRT005410 Tppp tubulin polymerization promoting protein 4 1
MIRT007217 CCND2 cyclin D2 1 2
MIRT021080 GJA1 gap junction protein, alpha 1, 43kDa 2 2
MIRT052933 CDK4 cyclin-dependent kinase 4 2 1
MIRT053344 ACTL6A actin-like 6A 2 1
MIRT054618 NR1H3 nuclear receptor subfamily 1, group H, member 3 3 1
MIRT136940 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT192335 KLF13 Kruppel-like factor 13 1 1
MIRT198640 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT199194 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT215740 C5ORF51 chromosome 5 open reading frame 51 1 2
MIRT269375 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT288812 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 1 1
MIRT301982 NUP50 nucleoporin 50kDa 1 3
MIRT332730 QSER1 glutamine and serine rich 1 1 1
MIRT364222 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 1 1
MIRT394617 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT395575 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 3 1
MIRT437465 TKT transketolase 3 1
MIRT437466 PGD phosphogluconate dehydrogenase 3 1
MIRT437467 G6PD glucose-6-phosphate dehydrogenase 3 1
MIRT437775 VAMP2 vesicle-associated membrane protein 2 (synaptobrevin 2) 1 1
MIRT438222 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT438292 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 3 2
MIRT438353 BDNF brain-derived neurotrophic factor 1 1
MIRT438354 SFRP1 secreted frizzled-related protein 1 1 1
MIRT438355 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT438356 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT438357 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT438358 HDAC4 histone deacetylase 4 1 1
MIRT438359 STC2 stanniocalcin 2 1 1
MIRT438439 CCND1 cyclin D1 2 2
MIRT438512 DUX4L9 double homeobox 4 like 9 1 1
MIRT446164 C8A complement component 8, alpha polypeptide 1 1
MIRT446280 C17orf102 chromosome 17 open reading frame 102 1 1
MIRT448538 RIMS4 regulating synaptic membrane exocytosis 4 1 1
MIRT448838 FGD4 FYVE, RhoGEF and PH domain containing 4 1 1
MIRT449398 TOX4 TOX high mobility group box family member 4 1 1
MIRT449445 STAMBP STAM binding protein 1 1
MIRT451048 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT452042 NT5C1B-RDH14 NT5C1B-RDH14 readthrough 1 1
MIRT456018 PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 1 1
MIRT456592 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT458329 SALL2 sal-like 2 (Drosophila) 1 1
MIRT461317 MRPS27 mitochondrial ribosomal protein S27 1 1
MIRT464024 WBP2 WW domain binding protein 2 1 1
MIRT466872 STX6 syntaxin 6 1 1
MIRT469338 RGP1 RGP1 retrograde golgi transport homolog (S. cerevisiae) 1 1
MIRT472373 TSPAN1 tetraspanin 1 1 1
MIRT473568 MATR3 matrin 3 1 1
MIRT475895 H3F3C H3 histone, family 3C 1 4
MIRT477573 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 1
MIRT478270 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT479333 CERS2 ceramide synthase 2 1 1
MIRT480681 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT482898 SMKR1 uncharacterized LOC100287482 1 3
MIRT484247 ANK1 ankyrin 1, erythrocytic 1 1
MIRT485160 RAB5C RAB5C, member RAS oncogene family 1 4
MIRT485307 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 4
MIRT485737 CALM2 calmodulin 2 (phosphorylase kinase, delta) 1 1
MIRT493702 H3F3B H3 histone, family 3B (H3.3B) 1 2
MIRT498128 MYEF2 myelin expression factor 2 1 1
MIRT501479 PTMA prothymosin, alpha 1 4
MIRT512087 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 2
MIRT512351 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT519967 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT523132 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 2
MIRT526408 TFAM transcription factor A, mitochondrial 1 1
MIRT527094 VSTM5 V-set and transmembrane domain containing 5 1 1
MIRT530392 SULT1B1 sulfotransferase family, cytosolic, 1B, member 1 1 1
MIRT535607 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT554404 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT557238 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT561976 LRRC59 leucine rich repeat containing 59 1 1
MIRT563130 ZNF215 zinc finger protein 215 1 1
MIRT564855 ZBED3 zinc finger, BED-type containing 3 1 1
MIRT568531 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT576356 Pxdn peroxidasin homolog (Drosophila) 1 1
MIRT609376 FAM216B family with sequence similarity 216, member B 1 1
MIRT616890 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 1 1
MIRT639511 FYB FYN binding protein 1 1
MIRT687225 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT689968 ZNF185 zinc finger protein 185 (LIM domain) 1 1
MIRT695510 ALPI alkaline phosphatase, intestinal 1 1
MIRT698424 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT698741 STX12 syntaxin 12 1 1
MIRT718001 ZNF79 zinc finger protein 79 1 1
MIRT720101 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*