Accession ID: MIRT000687 [miRNA, hsa-let-7c-5p :: TGFBR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7cLinkOut: [miRBase ]
Synonyms LET7C, MIRNLET7C, hsa-let-7c, let-7c, MIRLET7C
Description Homo sapiens let-7c stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7c-5p
Mature Sequence 11| UGAGGUAGUAGGUUGUAUGGUU |32
Evidence Experimental
Experiments Cloned
Putative hsa-let-7c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TGFBR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAT5, ACVRLK4, ALK-5, ALK5, LDS1A, LDS2A, MSSE, SKR4, TGFR-1
Description transforming growth factor, beta receptor 1
Transcript NM_0011309    LinkOut: [ RefSeq ]
Other Transcripts NM_0046   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TGFBR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TGFBR1
(miRNA target sites are highlighted)
>TGFBR1|NM_0011309|3'UTR
   1 TTCTACAGCTTTGCCTGAACTCTCCTTTTTTCTTCAGATCTGCTCCTGGGTTTTAATTTGGGAGGTCAATTGTTCTACCT
  81 CACTGAGAGGGAACAGAAGGATATTGCTTCCTTTTGCAGCAGTGTAATAAAGTCAATTAAAAACTTCCCAGGATTTCTTT
 161 GGACCCAGGAAACAGCCATGTGGGTCCTTTCTGTGCACTATGAACGCTTCTTTCCCAGGACAGAAAATGTGTAGTCTACC
 241 TTTATTTTTTATTAACAAAACTTGTTTTTTAAAAAGATGATTGCTGGTCTTAACTTTAGGTAACTCTGCTGTGCTGGAGA
 321 TCATCTTTAAGGGCAAAGGAGTTGGATTGCTGAATTACAATGAAACATGTCTTATTACTAAAGAAAGTGATTTACTCCTG
 401 GTTAGTACATTCTCAGAGGATTCTGAACCACTAGAGTTTCCTTGATTCAGACTTTGAATGTACTGTTCTATAGTTTTTCA
 481 GGATCTTAAAACTAACACTTATAAAACTCTTATCTTGAGTCTAAAAATGACCTCATATAGTAGTGAGGAACATAATTCAT
 561 GCAATTGTATTTTGTATACTATTATTGTTCTTTCACTTATTCAGAACATTACATGCCTTCAAAATGGGATTGTACTATAC
 641 CAGTAAGTGCCACTTCTGTGTCTTTCTAATGGAAATGAGTAGAATTGCTGAAAGTCTCTATGTTAAAACCTATAGTGTTT
 721 GAATTCAAAAAGCTTATTTATCTGGGTAACCCAAACTTTTTCTGTTTTGTTTTTGGAAGGGTTTTTGTGGTATGTCATTT
 801 GGTATTCTATTCTGAAAATGCCTTTCTCCTACCAAAATGTGCTTAAGCCACTAAAGAAATGAAGTGGCATTAATTAGTAA
 881 ATTATTAGCATGGTCATGTTTGAATATTCTCACATCAAGCTTTTGCATTTTAATTGTGTTGTCTAAGTATACTTTTAAAA
 961 AATCAAGTGGCACTCTAGATGCTTATAGTACTTTAATATTTGTAGCATACAGACTAATTTTTCTAAAAGGGAAAGTCTGT
1041 CTAGCTGCTTGTGAAAAGTTATGTGGTATTCTGTAAGCCATTTTTTTCTTTATCTGTTCAAAGACTTATTTTTTAAGACA
1121 TGAATTACATTTAAAATTAGAATATGGTTAATATTAAATAATAGGCCTTTTTCTAGGAAGGCGAAGGTAGTTAATAATTT
1201 GAATAGATAACAGATGTGCAAGAAAGTCACATTTGTTATGTATGTAGGAGTAAACGTTCGGTGGATCCTCTGTCTTTGTA
1281 ACTGAGGTTAGAGCTAGTGTGGTTTTGAGGTCTCACTACACTTTGAGGAAGGCAGCTTTTAATTCAGTGTTTCCTTATGT
1361 GTGCGTACATTGCAACTGCTTACATGTAATTTATGTAATGCATTCAGTGCACCCTTGTTACTTGGGAGAGGTGGTAGCTA
1441 AAGAACATTCTGAGTATAGGTTTTTCTCCATTTACAGATGTCTTTGGTCAAATATTGAAAGCAAACTTGTCATGGTCTTC
1521 TTACATTAAGTTGAAACTAGCTTATAATAACTGGTTTTTACTTCCAATGCTATGAAGTCTCTGCAGGGCTTTTACAGTTT
1601 TCGAAGTCCTTTTATCACTGTGATCTTATTCTGAGGGGAGAAAAAACTATCATAGCTCTGAGGCAAGACTTCGACTTTAT
1681 AGTGCTATCAGTTCCCCGATACAGGGTCAGAGTAACCCATACAGTATTTTGGTCAGGAAGAGAAAGTGGCCATTTACACT
1761 GAATGAGTTGCATTCTGATAATGTCTTATCTCTTATACGTAGAATAAATTTGAAAGACTATTTGATCTTAAAACCAAAGT
1841 AATTTTAGAATGAGTGACATATTACATAGGAATTTAGTGTCAATTTCATGTGTTTAAAAACATCATGGGAAAAATGCTTA
1921 GAGGTTACTATTTTGACTACAAAGTTGAGTTTTTTTCTGTAGTTACCATAATTTCATTGAAGCAAATGAATGAGTTTGAG
2001 AGGTTTGTTTTTATAGTTGTGTTGTATTACTTGTTTAATAATAATCTCTAATTCTGTGATCAGGTACTTTTTTTGTGGGG
2081 GTTTTTTTTTTGTTTTTTTTTTTTTGTTGTTGTTTTTGGGCCATTTCTAAGCCTACCAGATCTGCTTTATGAAATCCAGG
2161 GGACCAATGCATTTTATCACTAAAACTATTTTTATATAATTTTAAGAATATACCAAAAGTTGTCTGATTTAAAGTTGTAA
2241 TACATGATTTCTCACTTTCATGTAAGGTTATCCACTTTTGCTGAAGATATTTTTTATTGAATCAAAGATTGAGTTACAAT
2321 TATACTTTTCTTACCTAAGTGGATAAAATGTACTTTTGATGAATCAGGGAATTTTTTTAAAGTTGGAGTTTAGTTCTAAA
2401 TTGACTTTACGTATTACTGCAGTTAATTCCTTTTTTGGCTAGGGATGGTTTGATAAACCACAATTGGCTGATATTGAAAA
2481 TGAAAGAAACTTAAAAGGTGGGATGGATCATGATTACTGTCGATAACTGCAGATAAATTTGATTAGAGTAATAATTTTGT
2561 CATTTAAAAACACAGTTGTTTATACTGCCCATCCTAGGATGCTCACCTTCCAAGATTCAACGTGGCTAAAACATCTTCTG
2641 GTAAATTGTGCGTCCATATTCATTTTGTCAGTAGCCAGGAGAAATGGGGATGGGGGAAATACGACTTAGTGAGGCATAGA
2721 CATCCCTGGTCCATCCTTTCTGTCTCCAGCTGTTTCTTGGAACCTGCTCTCCTGCTTGCTGGTCCCTGACGCAGAGACCG
2801 TTGCCTCCCCCACAGCCGTTTGACTGAAGGCTGCTCTGGAGACCTAGAGTAAAACGGCTGATGGAAGTTGTGGGACCCAC
2881 TTCCATTTCCTTCAGTCATTAGAGGTGGAAGGGAGGGGTCTCCAAGTTTGGAGATTGAGCAGATGAGGCTTGGGATGCCC
2961 CTGCTTTGACTTCAGCCATGGATGAGGAGTGGGATGGCAGCAAGGTGGCTCCTGTGGCAGTGGAGTTGTGCCAGAAACAG
3041 TGGCCAGTTGTATCGCCTATAAGACAGGGTAAGGTCTGAAGAGCTGAGCCTGTAATTCTGCTGTAATAATGATAGTGCTC
3121 AAGAAGTGCCTTGAGTTGGTGTACAGTGCCATGGCCATCAAGAATCCCAGATTTCAGGTTTTATTACAAAATGTAAGTGG
3201 TCACTTGGCGATTTTGTAGTACATGCATGAGTTACCTTTTTTCTCTATGTCTGAGAACTGTCAGATTAAAACAAGATGGC
3281 AAAGAGATCGTTAGAGTGCACAACAAAATCACTATCCCATTAGACACATCATCAAAAGCTTATTTTTATTCTTGCACTGG
3361 AAGAATCGTAAGTCAACTGTTTCTTGACCATGGCAGTGTTCTGGCTCCAAATGGTAGTGATTCCAAATAATGGTTCTGTT
3441 AACACTTTGGCAGAAAATGCCAGCTCAGATATTTTGAGATACTAAGGATTATCTTTGGACATGTACTGCAGCTTCTTGTC
3521 TCTGTTTTGGATTACTGGAATACCCATGGGCCCTCTCAAGAGTGCTGGACTTCTAGGACATTAAGATGATTGTCAGTACA
3601 TTAAACTTTTCAATCCCATTATGCAATCTTGTTTGTAAATGTAAACTTCTAAAAATATGGTTAATAACATTCAACCTGTT
3681 TATTACAACTTAAAAGGAACTTCAGTGAATTTGTTTTTATTTTTTAACAAGATTTGTGAACTGAATATCATGAACCATGT
3761 TTTGATACCCCTTTTTCACGTTGTGCCAACGGAATAGGGTGTTTGATATTTCTTCATATGTTAAGGAGATGCTTCAAAAT
3841 GTCAATTGCTTTAAACTTAAATTACCTCTCAAGAGACCAAGGTACATTTACCTCATTGTGTATATAATGTTTAATATTTG
3921 TCAGAGCATTCTCCAGGTTTGCAGTTTTATTTCTATAAAGTATGGGTATTATGTTGCTCAGTTACTCAAATGGTACTGTA
4001 TTGTTTATATTTGTACCCCAAATAACATCGTCTGTACTTTCTGTTTTCTGTATTGTATTTGTGCAGGATTCTTTAGGCTT
4081 TATCAGTGTAATCTCTGCCTTTTAAGATATGTACAGAAAATGTCCATATAAATTTCCATTGAAGTCGAATGATACTGAGA
4161 AGCCTGTAAAGAGGAGAAAAAAACATAAGCTGTGTTTCCCCATAAGTTTTTTTAAATTGTATATTGTATTTGTAGTAATA
4241 TTCCAAAAGAATGTAAATAGGAAATAGAAGAGTGATGCTTATGTTAAGTCCTAACACTACAGTAGAAGAATGGAAGCAGT
4321 GCAAATAAATTACATTTTTCCCAAGTGCCAGTGGCATATTTTAAAATAAAGTGTATACGTTGGAATGAGTCATGCCATAT
4401 GTAGTTGCTGTAGATGGCAACTAGAACCTTTGAGTTACAAGAGTCTTTAGAAGTTTTCTAACCCTGCCTAGTGCAAGTTA
4481 CAATATTATAGCGTGTTCGGGGAGTGCCCTCCTGTCTGCAGGTGTGTCTCTGTGCCTGGGGGCTTTTCTCCACATGCTTA
4561 GGGGTGTGGGTCTTCCATTGGGGCATGATGGACCTGTCTACAGGTGATCTCTGTTGCCTTTGGGTCAGCACATTTGTTAG
4641 TCTCCTGGGGGTGAAAACTTGGCTTACAAGAGAACTGGAAAAATGATGAGATGTGGTCCCCAAACCCTTGATTGACTCTG
4721 GGGAGGGGCTTTGTGAATAGGATTGCTCTCACATTAAAGATAGTTACTTCAATTTGAAGGCTGGATTTAGGGATTTTTTT
4801 TTTTCCTTATAACAAAGACATCACCAGGATATGAAGCTTTTGTTGAAAGTTGGAAAAAAAGTGAAATTAAAGACATTCCC
4881 AGACAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugguauGUUGG-AUGAUGGAGu 5'
                 |||:: | ||||||| 
Target 5' gggaggtCAATTGTTCTACCTCa 3'
60 - 82 151.00 -15.00
2
miRNA  3' uuGGUAUGUUGGA--UGAUGGAGu 5'
            |: || |||:|  |:|||||| 
Target 5' tgCTTTA-AACTTAAATTACCTCt 3'
3847 - 3869 145.00 -11.40
3
miRNA  3' uuGGUAUGUUGGAUGAUGGAGu 5'
            ||| :  || | :|||||| 
Target 5' gaCCAAGGTACAT-TTACCTCa 3'
3875 - 3895 135.00 -15.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7c-5p :: TGFBR1    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot , Other
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... TGFb-R1 is a direct target of hsa-let-7c ...

- Tzur, G. Israel, A. Levy, A. Benjamin, H. et al., 2009, PLoS One.

Article - Tzur, G. Israel, A. Levy, A. Benjamin, H. et al.
- PLoS One, 2009
BACKGROUND AND AIMS: microRNAs (miRNAs) are small noncoding RNAs that regulate cognate mRNAs post-transcriptionally. miRNAs have been implicated in regulating gene expression in embryonic developmental processes, including proliferation and differentiation. The liver is a multifunctional organ, which undergoes rapid changes during the developmental period and relies on tightly-regulated gene expression. Little is known regarding the complex expression patterns of both mRNAs and miRNAs during the early stages of human liver development, and the role of miRNAs in the regulation of this process has not been studied. The aim of this work was to study the impact of miRNAs on gene expression during early human liver development. METHODS: Global gene and miRNA expression were profiled in adult and in 9-12w human embryonic livers, using high-density microarrays and quantitative RT-PCR. RESULTS: Embryonic liver samples exhibited a gene expression profile that differentiated upon progression in the developmental process, and revealed multiple regulated genes. miRNA expression profiling revealed four major expression patterns that correlated with the known function of regulated miRNAs. Comparison of the expression of the most regulated miRNAs to that of their putative targets using a novel algorithm revealed a significant anti-correlation for several miRNAs, and identified the most active miRNAs in embryonic and in adult liver. Furthermore, our algorithm facilitated the identification of TGFbeta-R1 as a novel target gene of let-7. CONCLUSIONS: Our results uncover multiple regulated miRNAs and genes throughout human liver development, and our algorithm assists in identification of novel miRNA targets with potential roles in liver development.
LinkOut: [PMID: 19841744]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
166 hsa-let-7c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000407 CDK6 cyclin-dependent kinase 6 1 1
MIRT000408 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000410 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT000687 TGFBR1 transforming growth factor, beta receptor 1 4 1
MIRT002076 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 2 1
MIRT002322 HMGA2 high mobility group AT-hook 2 6 6
MIRT003748 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 1
MIRT004348 DICER1 dicer 1, ribonuclease type III 2 1
MIRT004491 BCL2L1 BCL2-like 1 4 2
MIRT004531 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 4 1
MIRT006403 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032187 MED28 mediator complex subunit 28 1 1
MIRT032188 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT032189 RTCA RNA 3'-terminal phosphate cyclase 1 1
MIRT032190 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) 1 1
MIRT032191 GPS1 G protein pathway suppressor 1 1 1
MIRT032192 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT051728 R3HDM2 R3H domain containing 2 1 1
MIRT051729 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT051730 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT051731 CEP170B KIAA0284 1 1
MIRT051732 ACTB actin, beta 1 1
MIRT051733 ZNF614 zinc finger protein 614 1 1
MIRT051734 SAFB scaffold attachment factor B 1 1
MIRT051735 FOXO3 forkhead box O3 1 1
MIRT051736 ND2 MTND2 1 1
MIRT051737 METAP2 methionyl aminopeptidase 2 1 1
MIRT051738 KIAA0141 KIAA0141 1 1
MIRT051739 CCNF cyclin F 1 1
MIRT051740 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT051741 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT051742 TAZ tafazzin 1 1
MIRT051743 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT051744 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT051745 COX3 cytochrome c oxidase III 1 1
MIRT051746 RYR2 ryanodine receptor 2 (cardiac) 1 1
MIRT051747 ACTN4 actinin, alpha 4 1 1
MIRT051748 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT051749 VWA9 von Willebrand factor A domain containing 9 1 1
MIRT051750 RAB10 RAB10, member RAS oncogene family 1 1
MIRT051751 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT051752 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT051753 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT051754 BCOR BCL6 corepressor 1 1
MIRT051755 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT051756 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 1 1
MIRT051757 CBL Cbl proto-oncogene, E3 ubiquitin protein ligase 1 1
MIRT051758 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051759 PEX6 peroxisomal biogenesis factor 6 1 1
MIRT051760 RPS4Y1 ribosomal protein S4, Y-linked 1 1 1
MIRT051761 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051762 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT051763 RPL18A ribosomal protein L18a 1 1
MIRT051764 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT051765 KRTAP19-1 keratin associated protein 19-1 1 1
MIRT051766 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT051767 LECT2 leukocyte cell-derived chemotaxin 2 1 1
MIRT051768 TMEM165 transmembrane protein 165 1 1
MIRT051769 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051770 ITGA10 integrin, alpha 10 1 1
MIRT051771 DNAJC16 DnaJ (Hsp40) homolog, subfamily C, member 16 1 1
MIRT051772 METTL25 methyltransferase like 25 1 1
MIRT051773 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT051774 SLK STE20-like kinase 1 1
MIRT051775 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT051776 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT051777 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT051778 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT051779 DUSP7 dual specificity phosphatase 7 1 1
MIRT051780 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT051781 CACHD1 cache domain containing 1 1 1
MIRT051782 MBTPS1 membrane-bound transcription factor peptidase, site 1 1 1
MIRT051783 CNOT3 CCR4-NOT transcription complex, subunit 3 1 1
MIRT051784 IPO7 importin 7 1 1
MIRT051785 EYA3 eyes absent homolog 3 (Drosophila) 1 1
MIRT051786 SBDS Shwachman-Bodian-Diamond syndrome 1 1
MIRT051787 RPL3 ribosomal protein L3 1 1
MIRT051788 WDR61 WD repeat domain 61 1 1
MIRT051789 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051790 SIRT1 sirtuin 1 1 1
MIRT051791 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT051792 CCNC cyclin C 1 1
MIRT051793 SNW1 SNW domain containing 1 1 1
MIRT051794 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT051795 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT051796 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT051797 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT051798 PSMG2 proteasome (prosome, macropain) assembly chaperone 2 1 1
MIRT051799 COX1 cytochrome c oxidase subunit I 1 1
MIRT051800 BSDC1 BSD domain containing 1 1 1
MIRT051801 ACVR1B activin A receptor, type IB 1 1
MIRT051802 RPS13 ribosomal protein S13 1 1
MIRT051803 FAM103A1 family with sequence similarity 103, member A1 1 1
MIRT051804 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT051805 SLC10A3 solute carrier family 10 (sodium/bile acid cotransporter family), member 3 1 1
MIRT051806 SH3D19 SH3 domain containing 19 1 1
MIRT051807 BRD2 bromodomain containing 2 1 1
MIRT051808 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT051809 C9orf40 chromosome 9 open reading frame 40 1 1
MIRT051810 SLC35A4 solute carrier family 35, member A4 1 1
MIRT051811 ZNF581 zinc finger protein 581 1 1
MIRT051812 ANKRD17 ankyrin repeat domain 17 1 1
MIRT051813 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT051814 CBX6 chromobox homolog 6 1 1
MIRT051815 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT051816 TMEM184B transmembrane protein 184B 1 1
MIRT051817 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT051818 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT051819 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT051820 NUPL1 nucleoporin like 1 1 1
MIRT051821 LTA4H leukotriene A4 hydrolase 1 1
MIRT051822 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT051823 PCGF3 polycomb group ring finger 3 1 1
MIRT051824 BPTF bromodomain PHD finger transcription factor 1 1
MIRT051825 ARMC8 armadillo repeat containing 8 1 1
MIRT051826 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT051827 LDHA lactate dehydrogenase A 1 1
MIRT051828 RAB34 RAB34, member RAS oncogene family 1 1
MIRT051829 PTGES2 prostaglandin E synthase 2 1 1
MIRT051830 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 1
MIRT051831 KIF1B kinesin family member 1B 1 1
MIRT051832 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT051833 DNAJC6 DnaJ (Hsp40) homolog, subfamily C, member 6 1 1
MIRT051834 SNUPN snurportin 1 1 1
MIRT051835 SF3B4 splicing factor 3b, subunit 4, 49kDa 1 1
MIRT051836 PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 1 1
MIRT051837 WDR3 WD repeat domain 3 1 1
MIRT051838 MKRN1 makorin ring finger protein 1 1 1
MIRT051839 ZNF526 zinc finger protein 526 1 1
MIRT051840 PSMB2 proteasome (prosome, macropain) subunit, beta type, 2 1 1
MIRT051841 RAPGEFL1 Rap guanine nucleotide exchange factor (GEF)-like 1 1 1
MIRT051842 DCTN5 dynactin 5 (p25) 1 1
MIRT051843 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051844 PPAN-P2RY11 PPAN-P2RY11 readthrough 1 1
MIRT051845 COX2 cytochrome c oxidase subunit II 1 1
MIRT051846 DOT1L DOT1-like, histone H3 methyltransferase (S. cerevisiae) 1 1
MIRT051847 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT051848 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT051849 FANCI Fanconi anemia, complementation group I 1 1
MIRT051850 NOTCH2 notch 2 1 1
MIRT051851 PRAF2 PRA1 domain family, member 2 1 1
MIRT051852 MEF2C myocyte enhancer factor 2C 1 1
MIRT051853 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT051854 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT051855 RPS24 ribosomal protein S24 1 1
MIRT051856 GARS glycyl-tRNA synthetase 1 1
MIRT051857 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT051858 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT051859 MESDC1 mesoderm development candidate 1 1 1
MIRT051860 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051861 TRRAP transformation/transcription domain-associated protein 1 1
MIRT051862 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT051863 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT051864 MYO9A myosin IXA 1 1
MIRT051865 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 1 1
MIRT051866 CCNB2 cyclin B2 1 1
MIRT051867 PTK2 PTK2 protein tyrosine kinase 2 1 1
MIRT051868 AIDA axin interactor, dorsalization associated 1 1
MIRT051869 WBP11 WW domain binding protein 11 1 1
MIRT051870 RALGAPA2 Ral GTPase activating protein, alpha subunit 2 (catalytic) 1 1
MIRT051871 FLNB filamin B, beta 1 1
MIRT051872 QKI QKI, KH domain containing, RNA binding 1 1
MIRT051873 FZD8 frizzled family receptor 8 1 1
MIRT051874 CCNG1 cyclin G1 1 1
MIRT051875 NPTX1 neuronal pentraxin I 1 1
MIRT051876 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1