Accession ID: MIRT000709 [miRNA, hsa-miR-196a :: ANXA1, target gene]
miRNA Infomation
miRNA namehsa-miR-196a
miRNA-target interaction network
Gene Information
Gene Symbol ANXA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ANX1, LPC1
Description annexin A1
Transcript NM_000700   LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ANXA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ANXA1
(miRNA target sites are highlighted)
>ANXA1|NM_000700|3'UTR
   1 TAAACATTCCCTTGATGGTCTCAAGCTATGATCAGAAGACTTTAATTATATATTTTCATCCTATAAGCTTAAATAGGAAA
  81 GTTTCTTCAACAGGATTACAGTGTAGCTACCTACATGCTGAAAAATATAGCCTTTAAATCATTTTTATATTATAACTCTG
 161 TATAATAGAGATAAGTCCATTTTTTAAAAATGTTTTCCCCAAACCATAAAACCCTATACAAGTTGTTCTAGTAACAATAC
 241 ATGAGAAAGATGTCTATGTAGCTGAAAATAAAATGACGTCACAAGAC
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196a :: ANXA1    [ Functional MTI ]
Validation Method real time qRT-PCR , Luciferase reporter assay , Western blot
Conditions SEG-1, MDA-231, HEC1B,
Location of target site 3'UTR, unknown
Original Description (Extracted from the article) ... This study demonstrated a novel mechanism of post-transcriptional regulation of ANXA1 expression and identified miR-196a as a marker of esophageal cancer.//RNA mimics of miR-196a directly target the 3'-UTR of ANXA1 mRNA ...

- Luthra, R. Singh, R. R. Luthra, M. G. Li, et al., 2008, Oncogene.

Article - Luthra, R. Singh, R. R. Luthra, M. G. Li, et al.
- Oncogene, 2008
Suppression of annexin A1 (ANXA1), a mediator of apoptosis and inhibitor of cell proliferation, is well documented in various cancers but the underlying mechanism remains unknown. We investigated whether decreased ANXA1 expression was mediated by microRNAs (miRNAs), which are small, non-coding RNAs that negatively regulate gene expression. Using Sanger miRBase, we identified miR-584, miR-196a and miR-196b as potential miRNAs targeting ANXA1. Only miRNA-196a showed significant inverse correlation with ANXA1 mRNA levels in 12 cancer cell lines of esophageal, breast and endometrial origin (Pearson's correlation -0.66, P=0.019), identifying this as the candidate miRNA targeting ANXA1. Inverse correlation was also observed in 10 esophageal adenocarcinomas (Pearson's correlation -0.64, P=0.047). Analysis of paired normal/tumor tissues from additional 10 patients revealed an increase in miR-196a in the cancers (P=0.003), accompanied by a decrease in ANXA1 mRNA (P=0.004). Increasing miR-196a levels in cells by miR-196a mimics resulted in decreased ANXA1 mRNA and protein. In addition, miR-196a mimics inhibited luciferase expression in luciferase plasmid reporter that included predicted miR-196a recognition sequence from ANXA1 3'-untranslated region confirming that miR-196a directly targets ANXA1. miR-196a promoted cell proliferation, anchorage-independent growth and suppressed apoptosis, suggesting its oncogenic potential. This study demonstrated a novel mechanism of post-transcriptional regulation of ANXA1 expression and identified miR-196a as a marker of esophageal cancer.
LinkOut: [PMID: 18663355]