Accession ID: MIRT000709 [miRNA, hsa-miR-196a-5p :: ANXA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-196a-1LinkOut: [miRBase ]
Synonyms MIRN196-1, MIRN196A1, MIR196A1
Description Homo sapiens miR-196a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-196a-5p
Mature Sequence 7| UAGGUAGUUUCAUGUUGUUGGG |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-196a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ANXA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ANX1, LPC1
Description annexin A1
Transcript NM_0007    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ANXA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ANXA1
(miRNA target sites are highlighted)
>ANXA1|NM_0007|3'UTR
   1 TAAACATTCCCTTGATGGTCTCAAGCTATGATCAGAAGACTTTAATTATATATTTTCATCCTATAAGCTTAAATAGGAAA
  81 GTTTCTTCAACAGGATTACAGTGTAGCTACCTACATGCTGAAAAATATAGCCTTTAAATCATTTTTATATTATAACTCTG
 161 TATAATAGAGATAAGTCCATTTTTTAAAAATGTTTTCCCCAAACCATAAAACCCTATACAAGTTGTTCTAGTAACAATAC
 241 ATGAGAAAGATGTCTATGTAGCTGAAAATAAAATGACGTCACAAGAC
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196a-5p :: ANXA1    [ Functional MTI ]
Validation Method real time qRT-PCR , Luciferase reporter assay , Western blot , , Other
Conditions SEG-1 , MDA-231 , HEC1B
Location of target site 3'UTR
Original Description (Extracted from the article) ... This study demonstrated a novel mechanism of post-transcriptional regulation of ANXA1 expression and identiļ¬ed miR-196a as a marker of esophageal cancer.//RNA mimics of miR-196a directly target the 3'-UTR of ANXA1 mRNA ...

- Luthra, R. Singh, R. R. Luthra, M. G. Li, et al., 2008, Oncogene.

Article - Luthra, R. Singh, R. R. Luthra, M. G. Li, et al.
- Oncogene, 2008
Suppression of annexin A1 (ANXA1), a mediator of apoptosis and inhibitor of cell proliferation, is well documented in various cancers but the underlying mechanism remains unknown. We investigated whether decreased ANXA1 expression was mediated by microRNAs (miRNAs), which are small, non-coding RNAs that negatively regulate gene expression. Using Sanger miRBase, we identified miR-584, miR-196a and miR-196b as potential miRNAs targeting ANXA1. Only miRNA-196a showed significant inverse correlation with ANXA1 mRNA levels in 12 cancer cell lines of esophageal, breast and endometrial origin (Pearson's correlation -0.66, P=0.019), identifying this as the candidate miRNA targeting ANXA1. Inverse correlation was also observed in 10 esophageal adenocarcinomas (Pearson's correlation -0.64, P=0.047). Analysis of paired normal/tumor tissues from additional 10 patients revealed an increase in miR-196a in the cancers (P=0.003), accompanied by a decrease in ANXA1 mRNA (P=0.004). Increasing miR-196a levels in cells by miR-196a mimics resulted in decreased ANXA1 mRNA and protein. In addition, miR-196a mimics inhibited luciferase expression in luciferase plasmid reporter that included predicted miR-196a recognition sequence from ANXA1 3'-untranslated region confirming that miR-196a directly targets ANXA1. miR-196a promoted cell proliferation, anchorage-independent growth and suppressed apoptosis, suggesting its oncogenic potential. This study demonstrated a novel mechanism of post-transcriptional regulation of ANXA1 expression and identified miR-196a as a marker of esophageal cancer.
LinkOut: [PMID: 18663355]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
226 hsa-miR-196a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000218 BMP4 bone morphogenetic protein 4 1 1
MIRT000219 SPRR2C small proline-rich protein 2C (pseudogene) 3 2
MIRT000220 S100A9 S100 calcium binding protein A9 3 2
MIRT000221 KRT5 keratin 5 3 2
MIRT000709 ANXA1 annexin A1 4 1
MIRT002266 HOXB8 homeobox B8 4 6
MIRT002940 HOXA7 homeobox A7 4 5
MIRT002941 HOXD8 homeobox D8 3 3
MIRT002942 HOXC8 homeobox C8 5 9
MIRT004244 HOXB7 homeobox B7 4 1
MIRT004718 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 4 1
MIRT004719 HMOX1 heme oxygenase (decycling) 1 4 1
MIRT005065 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 2 1
MIRT006802 HMGA1 high mobility group AT-hook 1 3 1
MIRT006803 HMGA2 high mobility group AT-hook 2 3 1
MIRT006906 HOXA5 homeobox A5 3 1
MIRT026026 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 1 1
MIRT026027 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT026028 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 2
MIRT026029 DIEXF chromosome 1 open reading frame 107 1 1
MIRT026030 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT026031 NR4A1 nuclear receptor subfamily 4, group A, member 1 1 1
MIRT026032 ABT1 activator of basal transcription 1 1 1
MIRT026033 SPATA2 spermatogenesis associated 2 1 1
MIRT026034 NHLRC3 NHL repeat containing 3 1 1
MIRT026035 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT026036 CEP120 centrosomal protein 120kDa 1 1
MIRT026037 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT026038 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT026039 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT026040 PNP purine nucleoside phosphorylase 1 1
MIRT026041 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT026042 NUP50 nucleoporin 50kDa 1 1
MIRT026043 ZNF763 zinc finger protein 763 1 1
MIRT026044 FOXJ3 forkhead box J3 1 1
MIRT026045 BIN3 bridging integrator 3 1 1
MIRT026046 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT026047 RAD9A RAD9 homolog A (S. pombe) 1 1
MIRT026048 PCGF3 polycomb group ring finger 3 1 1
MIRT026049 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT026050 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT026051 LBR lamin B receptor 1 1
MIRT026052 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT026053 GLMN glomulin, FKBP associated protein 1 1
MIRT026054 STK40 serine/threonine kinase 40 1 1
MIRT026055 TMEM135 transmembrane protein 135 1 1
MIRT026056 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT026057 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT026058 LGR4 leucine-rich repeat-containing G protein-coupled receptor 4 1 1
MIRT026059 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT026060 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT026061 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT026062 SYT9 synaptotagmin IX 1 1
MIRT026063 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT026064 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT026065 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 1
MIRT026066 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT026067 RAB31 RAB31, member RAS oncogene family 1 1
MIRT026068 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 1
MIRT026069 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 1
MIRT026070 TIMM23 translocase of inner mitochondrial membrane 23 homolog (yeast) 1 1
MIRT026071 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT026072 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT026073 CCNT2 cyclin T2 1 1
MIRT026074 CCND2 cyclin D2 1 1
MIRT026075 USP24 ubiquitin specific peptidase 24 1 1
MIRT026076 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 1
MIRT026077 SMC3 structural maintenance of chromosomes 3 1 1
MIRT026078 TMEM2 transmembrane protein 2 1 1
MIRT026079 RDH10 retinol dehydrogenase 10 (all-trans) 1 1
MIRT026080 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT026081 FAM127A family with sequence similarity 127, member A 1 1
MIRT026082 PRUNE2 prune homolog 2 (Drosophila) 1 1
MIRT026083 SPRYD4 SPRY domain containing 4 1 1
MIRT026084 TMEM161B transmembrane protein 161B 1 1
MIRT026085 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT026086 FAM104A family with sequence similarity 104, member A 1 1
MIRT026087 RAB7L1 RAB7, member RAS oncogene family-like 1 1 1
MIRT026088 ITGAV integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) 1 1
MIRT026089 CPD carboxypeptidase D 1 1
MIRT026090 ZNF354B zinc finger protein 354B 1 1
MIRT026091 TMEM194A transmembrane protein 194A 1 1
MIRT026092 EPHA7 EPH receptor A7 1 1
MIRT026093 KIAA1804 mixed lineage kinase 4 1 1
MIRT026094 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 1 1
MIRT026095 TSPAN12 tetraspanin 12 1 1
MIRT026096 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT026097 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT026098 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT026099 CCDC47 coiled-coil domain containing 47 1 1
MIRT026100 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT026101 LLGL1 lethal giant larvae homolog 1 (Drosophila) 1 1
MIRT048150 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT048151 PSMC3 proteasome (prosome, macropain) 26S subunit, ATPase, 3 1 1
MIRT048152 TMX2 thioredoxin-related transmembrane protein 2 1 1
MIRT048153 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT048154 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT048155 GLUL glutamate-ammonia ligase 1 1
MIRT048156 NRXN1 neurexin 1 1 1
MIRT048157 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT048158 HIST2H4B histone cluster 2, H4b 1 1
MIRT048159 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT048160 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT048161 SAP18 Sin3A-associated protein, 18kDa 1 1
MIRT048162 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT048163 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT048164 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT048165 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT048166 LYRM2 LYR motif containing 2 1 1
MIRT048167 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT048168 C19orf55 chromosome 19 open reading frame 55 1 1
MIRT048169 LRP2 low density lipoprotein receptor-related protein 2 1 1
MIRT048170 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT048171 NKX6-1 NK6 homeobox 1 1 1
MIRT048172 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT048173 RPS2 ribosomal protein S2 1 1
MIRT048174 RBMX RNA binding motif protein, X-linked 1 1
MIRT048175 ZFP64 zinc finger protein 64 homolog (mouse) 1 1
MIRT048176 REEP2 receptor accessory protein 2 1 1
MIRT048177 MED13 mediator complex subunit 13 1 1
MIRT048178 MYCBP2 MYC binding protein 2 1 1
MIRT048179 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT048180 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT048181 VDAC3 voltage-dependent anion channel 3 1 1
MIRT048182 ZNF529 zinc finger protein 529 1 1
MIRT048183 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT048184 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT048185 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048186 APP amyloid beta (A4) precursor protein 1 1
MIRT048187 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT048188 HIST1H2BB histone cluster 1, H2bb 1 1
MIRT048189 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT048190 TUBA1B tubulin, alpha 1b 1 1
MIRT048191 USP19 ubiquitin specific peptidase 19 1 1
MIRT048192 COX3 cytochrome c oxidase III 1 1
MIRT048193 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT048194 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT048195 MRPL35 mitochondrial ribosomal protein L35 1 1
MIRT048196 KCTD1 potassium channel tetramerisation domain containing 1 1 1
MIRT048197 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT048198 ZNF581 zinc finger protein 581 1 1
MIRT048199 CNOT11 chromosome 2 open reading frame 29 1 1
MIRT048200 POTEG POTE ankyrin domain family, member G 1 1
MIRT048201 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT048202 SRP9 signal recognition particle 9kDa 1 1
MIRT048203 BCORL1 BCL6 corepressor-like 1 1 1
MIRT048204 NRBP1 nuclear receptor binding protein 1 1 1
MIRT048205 LRRC41 leucine rich repeat containing 41 1 1
MIRT048206 ATP6 ATP synthase F0 subunit 6 1 1
MIRT048207 FKTN fukutin 1 1
MIRT048208 RANBP9 RAN binding protein 9 1 1
MIRT048209 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT048210 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT048211 ATG16L1 ATG16 autophagy related 16-like 1 (S. cerevisiae) 1 1
MIRT048212 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT048213 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT048214 HAUS6 HAUS augmin-like complex, subunit 6 1 1
MIRT048215 CKAP2L cytoskeleton associated protein 2-like 1 1
MIRT048216 IFNGR1 interferon gamma receptor 1 1 1
MIRT048217 ANXA7 annexin A7 1 1
MIRT048218 ENAH enabled homolog (Drosophila) 1 1
MIRT048219 FOXO1 forkhead box O1 1 1
MIRT048220 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT048221 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT048222 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT048223 SLC25A17 solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17 1 1
MIRT048224 ZNF398 zinc finger protein 398 1 1
MIRT048225 RASSF7 Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 1 1
MIRT048226 SBF1 SET binding factor 1 1 1
MIRT048227 TP53RK TP53 regulating kinase 1 1
MIRT048228 MED12 mediator complex subunit 12 1 1
MIRT048229 FLNA filamin A, alpha 1 1
MIRT048230 CCNE2 cyclin E2 1 1
MIRT048231 CANX calnexin 1 1
MIRT048232 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT048233 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT048234 KIF18B kinesin family member 18B 1 1
MIRT048235 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT048236 SH3GL3 SH3-domain GRB2-like 3 1 1
MIRT048237 VCP valosin-containing protein 1 1
MIRT048238 ETV3 ets variant 3 1 1
MIRT048239 BCS1L BCS1-like (yeast) 1 1
MIRT048240 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT048241 ZCCHC11 zinc finger, CCHC domain containing 11 1 1
MIRT048242 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT048243 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT048244 ACTB actin, beta 1 1
MIRT048245 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT048246 EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa 1 1
MIRT048247 GMFB glia maturation factor, beta 1 1
MIRT048248 PALLD palladin, cytoskeletal associated protein 1 1
MIRT048249 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT048250 VCL vinculin 1 1
MIRT048251 IPO5 importin 5 1 1
MIRT048252 PATL1 protein associated with topoisomerase II homolog 1 (yeast) 1 1
MIRT048253 NAP1L4 nucleosome assembly protein 1-like 4 1 1
MIRT048254 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT048255 TUBB tubulin, beta 1 1
MIRT048256 CCND1 cyclin D1 1 1
MIRT048257 GID8 chromosome 20 open reading frame 11 1 1
MIRT048258 VDAC2 voltage-dependent anion channel 2 1 1
MIRT048259 SLC6A8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT048260 FXR2 fragile X mental retardation, autosomal homolog 2 1 1
MIRT048261 SCN11A sodium channel, voltage-gated, type XI, alpha subunit 1 1
MIRT048262 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 1 1
MIRT048263 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 1 1
MIRT048264 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT048265 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT048266 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT048267 OAT ornithine aminotransferase 1 1
MIRT048268 TRAP1 TNF receptor-associated protein 1 1 1
MIRT048269 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT048270 GLTP glycolipid transfer protein 1 1
MIRT048271 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT048272 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT048273 GRIK4 glutamate receptor, ionotropic, kainate 4 1 1
MIRT048274 PDE6D phosphodiesterase 6D, cGMP-specific, rod, delta 1 1
MIRT048275 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT048276 SAR1B SAR1 homolog B (S. cerevisiae) 1 1
MIRT048277 MAP4 microtubule-associated protein 4 1 1
MIRT048278 RAB21 RAB21, member RAS oncogene family 1 1
MIRT048279 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT048280 OGFRL1 opioid growth factor receptor-like 1 1 1
MIRT048281 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT048282 NRDE2 chromosome 14 open reading frame 102 1 1
MIRT048283 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1