Accession ID: MIRT000719 [miRNA, hsa-miR-222-3p :: CDKN1C, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-222LinkOut: [miRBase ]
Synonyms MIRN222, miRNA222, mir-222, MIR222
Description Homo sapiens miR-222 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-222-3p
Mature Sequence 69| AGCUACAUCUGGCUACUGGGU |89
Evidence Experimental
Experiments Cloned
Putative hsa-miR-222-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1C LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BWCR, BWS, KIP2, WBS, p57
Description cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0011226 , NM_0011226   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1C LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1C
(miRNA target sites are highlighted)
>CDKN1C|NM_0000|3'UTR
   1 TGAGCCAATTTAGAGCCCAAAGAGCCCCGAGGGAACCTGCCGGGGCAGCGGACGTTGGAAGGGCGCTGGGCCTCGGCTGG
  81 GACCGTTCATGTAGCAGCAACCGGCGGCGGCTGCCGCAGAGCAGCGTTCGGTTTTGTTTTTAAATTTTGAAAACTGTGCA
 161 ATGTATTAATAACGTCTTTTTATATCTAAATGTATTCTGCACGAGAAGGTACACTGGTCCCAAGGTGTAAAGCTTTAAGA
 241 GTCATTTATATAAAATGTTTAATCTCTGCTGAAACTCAGTGCAAAAAAAAGAAAAAAGAAAAAAAAAAGGAAAAAATAAA
 321 AAAACCATGTATATTTGTACAAAAAGTTTTTAAAGTTATACTAACTTATATTTTCTATTTATGTCCAGGCGTGGACCGCT
 401 CTGCCACGCACTAGCTCGGTTATTGGTTATGCCAAAGGCACTCTCCATCTCCCACATCTGGTTATTGACAAGTGTAACTT
 481 TATTTTCATCGCGGACTCTGGGGAAGGGGGTCACTCACAAGCTGTAGCTGCCATACATGCCCATCTAGCTTGCAGTCTCT
 561 TCGCGCTTTCGCTGTCTCTCTTATTATGACTGTGTTTATCTGAAACTTGAAGACAAGTCTGTTAAAATGGTTCCTGAGCC
 641 GTCTGTACCACTGCCCCGGCCCCTCGTCCGCCGGGTTCTAAATAAAGAGGCCGAAAAATGCTGCAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: CDKN1C    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , , Other
Conditions T98G , K562
Location of target site 3'UTR
Tools used in this research TargetCombo , TargetScan , PicTar
Original Description (Extracted from the article) ... Our results show that miR-221 and miR-222 both directly target the 3 untranslated regions of p27 and p57 mRNAs to reduce reporter gene expression, as well as diminish p27 and p57 protein levels. //miR-221 or miR-222 oligonucleotides significantly reduced p57 3`UTR-luciferase and p27 3`UTR-luciferase reporter activities by 60% and 77%, respectively (Fig. 3B) ...

- Medina, R. Zaidi, S. K. Liu, C. G. Stein, et al., 2008, Cancer Res.

Article - Medina, R. Zaidi, S. K. Liu, C. G. Stein, et al.
- Cancer Res, 2008
MicroRNAs (miRNA) have tumor suppressive and oncogenic potential in human cancer, but whether and how miRNAs control cell cycle progression is not understood. To address this question, we carried out a comprehensive analysis of miRNA expression during serum stimulation of quiescent human cells. Time course analyses revealed that four miRNAs are up-regulated and >100 miRNAs are down-regulated, as cells progress beyond the G(1)-S phase transition. We analyzed the function of two up-regulated miRNAs (miR-221 and miR-222) that are both predicted to target the cell growth suppressive cyclin-dependent kinase inhibitors p27 and p57. Our results show that miR-221 and miR-222 both directly target the 3' untranslated regions of p27 and p57 mRNAs to reduce reporter gene expression, as well as diminish p27 and p57 protein levels. Functional studies show that miR-221 and miR-222 prevent quiescence when elevated during growth factor deprivation and induce precocious S-phase entry, thereby triggering cell death. Thus, the physiologic up-regulation of miR-221 and miR-222 is tightly linked to a cell cycle checkpoint that ensures cell survival by coordinating competency for initiation of S phase with growth factor signaling pathways that stimulate cell proliferation.
LinkOut: [PMID: 18413744]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: CDKN1C    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... We show that miR-25 targets p57 through the 3 UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. ...

- Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al., 2009, Nucleic Acids Res.

Article - Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al.
- Nucleic Acids Res, 2009
microRNAs (miRNAs) play integral roles in diverse processes including tumorigenesis. miRNA gene loci are often found in close conjunction, and such clustered miRNA genes are transcribed from a common promoter to generate polycistronic primary transcript. The primary transcript (pri-miRNA) is then processed by two RNase III proteins to release the mature miRNAs. Although it has been speculated that the miRNAs in the same cluster may play related biological functions, this has not been experimentally addressed. Here we report that the miRNAs in two clusters (miR-106b approximately 93 approximately 25 and miR-222 approximately 221) suppress the Cip/Kip family members of Cdk inhibitors (p57(Kip2), p21(Cip1) and p27(Kip1)). We show that miR-25 targets p57 through the 3'-UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. Ectopic expression of these miRNAs results in activation of Cdk2 and facilitation of G1/S phase transition. Consistent with these results, both clusters are abnormally upregulated in gastric cancer tissues compared to the corresponding normal tissues. Ectopic expression of miR-222 cluster enhanced tumor growth in the mouse xenograft model. Our study demonstrates the functional associations between clustered miRNAs and further implicates that effective cancer treatment may require a combinatorial approach to target multiple oncogenic miRNA clusters.
LinkOut: [PMID: 19153141]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: CDKN1C    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Conditions ESCs
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , PicTar , miRBase Target Database
Original Description (Extracted from the article) ... Luciferase activity in ESCs transfected with p57 3 UTR-Luc and the antisense oligonucleotides was increased by 93% as compared those transfected with p57 3 UTR-Luc and negative control (P < 0.05) (Fig. 4B) ...

- Qian, K. Hu, L. Chen, H. Li, H. Liu, N. Li, et al., 2009, Endocrinology.

Article - Qian, K. Hu, L. Chen, H. Li, H. Liu, N. Li, et al.
- Endocrinology, 2009
Decidualization is a critical step during embryo implantation and characterized by the differentiation of endometrial stromal cells (ESCs) into decidual cells. Because miRNAs are important determinants of cellular fate specification, in this study, the miRNA expression in ESCs during in vitro decidualization was profiled by using microarray. Significance analysis of microarrays (SAM) revealed that 49 miRNA genes were differently (>2-fold) expressed between the non-induced ESCs and induced ESCs with a false discovery rate of 0. The expression variance of hsa-miR-222, 221, 143, 101, 30d, 30c, 181b, 27b, 29b, 507, 23a was validated by using quantitative PCR (P<0.05). Based on miRNA and mRNA expression variance and predicted target genes of miRNAs, a bioinformatic model of miRNAs controlling ESCs differentiation was formulated. Finally we proved that down-regulation of has-miR-222 could decrease the number of cells in S phase during ESCs differentiation (P<0.05). Antisense oligonucleotides of has-miR-222 could increase reporter gene expression by targeting the 3' untranslated regions of CDKN1C/p57kip2 mRNAs, as well as increase CDKN1C/p57kip2 protein levels (P<0.05). In conclusion, our results suggest that a subset of microRNAs play a key role in gene re-programming during ESCs decidualization and that hsa-miR-222 participates in ESCs differentiation by regulating ESC terminally withdrawing from the cell cycle.
LinkOut: [PMID: 19589872]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: CDKN1C    [ Functional MTI ]
Validation Method qRT-PCR
Conditions 16HBE
Location of target site 3'UTR
Tools used in this research microRNA.org , miRDB , TargetScan
Original Description (Extracted from the article) ... CDKN1B and CDKNIC , as the bona fide target genes of miR- 222 ...

- Zhang, J. Zhou, Y. Ma, L. Huang, S. Wang, et al., 2013, Biol Trace Elem Res.

Article - Zhang, J. Zhou, Y. Ma, L. Huang, S. Wang, et al.
- Biol Trace Elem Res, 2013
Nickel is an important kind of metal and a necessary trace element in people's production and livelihood; it is also a well-confirmed human carcinogen. In the past few years, researchers did a large number of studies about the molecular mechanisms of nickel carcinogenesis, and they focused on activation of proto-oncogenes and inactivation of anti-oncogenes caused by gene point mutation, gene deletion, gene amplification, DNA methylation, chromosome condensation, and so on that were induced by nickel. However, the researches on tumorigenic molecular mechanisms regulated by microRNAs (miRNAs) are rare. In this study, we established nickel-induced tumor by injecting Ni3S2 compounds to Wistar Rattus. By establishing a cDNA library of miRNA from rat muscle tumor tissue induced by Ni3S2, we found that the expression of miR-222 was significantly upregulated in tumor tissue compared with the normal tissue. As we expected, the expression levels of target genes of miR-222, CDKN1B and CDKN1C, were downregulated in the nickel-induced tumor. The same alteration of miR-222 and its target genes was also found in malignant 16HBE cells induced with Ni3S2 compounds. We conclude that miR-222 may promote cell proliferation infinitely during nickel-induced tumorigenesis in part by regulating the expression of its target genes CDKN1B and CDKN1C. Our study elucidated a novel molecular mechanism of nickel-induced tumorigenesis.
LinkOut: [PMID: 23447020]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
292 hsa-miR-222-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000018 STAT5A signal transducer and activator of transcription 5A 4 1
MIRT000131 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 5 20
MIRT000134 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT000135 SOD2 superoxide dismutase 2, mitochondrial 5 1
MIRT000136 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 5 1
MIRT000433 FOXO3 forkhead box O3 4 1
MIRT000719 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 4 4
MIRT001779 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 4 8
MIRT002334 TMED7 transmembrane emp24 protein transport domain containing 7 3 8
MIRT003191 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 4 3
MIRT003451 TIMP3 TIMP metallopeptidase inhibitor 3 3 4
MIRT003756 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 2 1
MIRT004485 FOS FBJ murine osteosarcoma viral oncogene homolog 4 2
MIRT004595 ICAM1 intercellular adhesion molecule 1 1 2
MIRT005321 ESR1 estrogen receptor 1 4 1
MIRT005369 BBC3 BCL2 binding component 3 3 2
MIRT005586 PTEN phosphatase and tensin homolog 4 3
MIRT005715 SELE selectin E 1 1
MIRT005786 TP53 tumor protein p53 2 2
MIRT005791 CORO1A coronin, actin binding protein, 1A 2 2
MIRT005792 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT006019 DIRAS3 DIRAS family, GTP-binding RAS-like 3 3 1
MIRT006064 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 2
MIRT006377 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006728 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT006842 TRPS1 trichorhinophalangeal syndrome I 4 1
MIRT006918 CERS2 LAG1 homolog, ceramide synthase 2 3 1
MIRT046572 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT046573 SLC25A36 solute carrier family 25, member 36 1 1
MIRT046574 KITLG KIT ligand 1 1
MIRT046575 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT046576 TEX10 testis expressed 10 1 1
MIRT046577 MROH8 chromosome 20 open reading frame 132 1 1
MIRT046578 ATP11B ATPase, class VI, type 11B 1 1
MIRT046579 THOP1 thimet oligopeptidase 1 1 1
MIRT046580 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT046581 ZFYVE16 zinc finger, FYVE domain containing 16 1 1
MIRT046582 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT046583 PRDX4 peroxiredoxin 4 1 1
MIRT046584 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT046585 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT046586 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT046587 PAN2 PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1
MIRT046588 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT046589 ACTB actin, beta 1 1
MIRT046590 ZNF772 zinc finger protein 772 1 1
MIRT046591 DMWD dystrophia myotonica, WD repeat containing 1 1
MIRT046592 RABL6 chromosome 9 open reading frame 86 1 1
MIRT046593 NCKAP5L NCK-associated protein 5-like 1 1
MIRT046594 CDK18 cyclin-dependent kinase 18 1 1
MIRT046595 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT046596 TOM1 target of myb1 (chicken) 1 1
MIRT046597 HIST2H4B histone cluster 2, H4b 1 1
MIRT046598 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 1 1
MIRT046599 IRS4 insulin receptor substrate 4 1 1
MIRT046600 RBM15B RNA binding motif protein 15B 1 1
MIRT046601 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT046602 KIF3B kinesin family member 3B 1 1
MIRT046603 IPO5 importin 5 1 1
MIRT046604 GDI2 GDP dissociation inhibitor 2 1 1
MIRT046605 HDLBP high density lipoprotein binding protein 1 1
MIRT046606 DAZAP1 DAZ associated protein 1 1 1
MIRT046607 FAM53C family with sequence similarity 53, member C 1 1
MIRT046608 COIL coilin 1 1
MIRT046609 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT046610 SAPCD2 chromosome 9 open reading frame 140 1 1
MIRT046611 AUTS2 autism susceptibility candidate 2 1 1
MIRT046612 DERA 2-deoxyribose-5-phosphate aldolase homolog (C. elegans) 1 1
MIRT046613 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT046614 VCP valosin-containing protein 1 1
MIRT046615 UHRF2 ubiquitin-like with PHD and ring finger domains 2 1 1
MIRT046616 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT046617 MINK1 misshapen-like kinase 1 (zebrafish) 1 1
MIRT046618 KPNB1 karyopherin (importin) beta 1 1 1
MIRT046619 SERTAD4 SERTA domain containing 4 1 1
MIRT046620 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT046621 PDXDC1 pyridoxal-dependent decarboxylase domain containing 1 1 1
MIRT046622 FYTTD1 forty-two-three domain containing 1 1 1
MIRT046623 SON SON DNA binding protein 1 1
MIRT046624 RPS17 ribosomal protein S17 1 1
MIRT046625 HES1 hairy and enhancer of split 1, (Drosophila) 1 1
MIRT046626 MGAT4B mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B 1 1
MIRT046627 SMC6 structural maintenance of chromosomes 6 1 1
MIRT046628 TMUB1 transmembrane and ubiquitin-like domain containing 1 1 1
MIRT046629 ZW10 ZW10, kinetochore associated, homolog (Drosophila) 1 1
MIRT046630 BAG6 HLA-B associated transcript 3 1 1
MIRT046631 MROH1 HEAT repeat containing 7A 1 1
MIRT046632 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT046633 CASC3 cancer susceptibility candidate 3 1 1
MIRT046634 NSUN5 NOP2/Sun domain family, member 5 1 1
MIRT046635 CCDC47 coiled-coil domain containing 47 1 1
MIRT046636 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT046637 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT046638 HDGF hepatoma-derived growth factor 1 1
MIRT046639 TOP3A topoisomerase (DNA) III alpha 1 1
MIRT046640 EIF3I eukaryotic translation initiation factor 3, subunit I 1 1
MIRT046641 DBNL drebrin-like 1 1
MIRT046642 TLN1 talin 1 1 1
MIRT046643 RPL8 ribosomal protein L8 1 1
MIRT046644 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT046645 TRMT5 TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) 1 1
MIRT046646 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT046647 MAP1B microtubule-associated protein 1B 1 1
MIRT046648 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT046649 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT046650 RPL12 ribosomal protein L12 1 1
MIRT046651 ZNF708 zinc finger protein 708 1 1
MIRT046652 CSNK1G1 casein kinase 1, gamma 1 1 1
MIRT046653 SART1 squamous cell carcinoma antigen recognized by T cells 1 1
MIRT046654 VCL vinculin 1 1
MIRT046655 HMGA1 high mobility group AT-hook 1 1 1
MIRT046656 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT046657 CDKL5 cyclin-dependent kinase-like 5 1 1
MIRT046658 SETD1B SET domain containing 1B 1 1
MIRT046659 SAP30L SAP30-like 1 1
MIRT046660 GLRX5 glutaredoxin 5 1 1
MIRT046661 SLC25A51 mitochondrial carrier triple repeat 1 1 1
MIRT046662 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT046663 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT046664 TRIM44 tripartite motif-containing 44 1 1
MIRT046665 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT046666 RNF215 ring finger protein 215 1 1
MIRT046667 FASN fatty acid synthase 1 1
MIRT046668 SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 1 1
MIRT046669 STOX2 storkhead box 2 1 1
MIRT046670 SHISA2 shisa homolog 2 (Xenopus laevis) 1 1
MIRT046671 EXOSC10 exosome component 10 1 1
MIRT046672 RPS2 ribosomal protein S2 1 1
MIRT046673 PRRC2A HLA-B associated transcript 2 1 1
MIRT046674 LRP10 low density lipoprotein receptor-related protein 10 1 1
MIRT046675 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT046676 HOXA13 homeobox A13 1 1
MIRT046677 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT046678 ZNF714 zinc finger protein 714 1 1
MIRT046679 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT046680 PKM pyruvate kinase, muscle 1 1
MIRT046681 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT046682 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT046683 NGRN neugrin, neurite outgrowth associated 1 1
MIRT046684 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT046685 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT046686 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT046687 TANGO6 transmembrane and coiled-coil domains 7 1 1
MIRT046688 PCBP2 poly(rC) binding protein 2 1 1
MIRT046689 CANX calnexin 1 1
MIRT046690 XPO6 exportin 6 1 1
MIRT046691 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT046692 CEP250 centrosomal protein 250kDa 1 1
MIRT046693 IARS isoleucyl-tRNA synthetase 1 1
MIRT046694 ZNF770 zinc finger protein 770 1 1
MIRT046695 NARS asparaginyl-tRNA synthetase 1 1
MIRT046696 SPTBN2 spectrin, beta, non-erythrocytic 2 1 1
MIRT046697 GTF3C5 general transcription factor IIIC, polypeptide 5, 63kDa 1 1
MIRT046698 GDI1 GDP dissociation inhibitor 1 1 1
MIRT046699 SV2A synaptic vesicle glycoprotein 2A 1 1
MIRT046700 PELI2 pellino homolog 2 (Drosophila) 1 1
MIRT046701 SKIV2L superkiller viralicidic activity 2-like (S. cerevisiae) 1 1
MIRT046702 SLC37A4 solute carrier family 37 (glucose-6-phosphate transporter), member 4 1 1
MIRT046703 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT046704 CLDN23 claudin 23 1 1
MIRT046705 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 1 1
MIRT046706 SLFN11 schlafen family member 11 1 1
MIRT046707 PFN1 profilin 1 1 1
MIRT046708 UROD uroporphyrinogen decarboxylase 1 1
MIRT046709 USP15 ubiquitin specific peptidase 15 1 1
MIRT046710 MCM7 minichromosome maintenance complex component 7 1 1
MIRT046711 SCARB2 scavenger receptor class B, member 2 1 1
MIRT046712 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT046713 CASKIN2 CASK interacting protein 2 1 1
MIRT046714 GRB10 growth factor receptor-bound protein 10 1 1
MIRT046715 NSMF nasal embryonic LHRH factor 1 1
MIRT046716 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT046717 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT046718 RNF10 ring finger protein 10 1 1
MIRT046719 MESDC2 mesoderm development candidate 2 1 1
MIRT046720 TCERG1 transcription elongation regulator 1 1 1
MIRT046721 DOCK5 dedicator of cytokinesis 5 1 1
MIRT046722 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT046723 KIF5C kinesin family member 5C 1 1
MIRT046724 OAZ2 ornithine decarboxylase antizyme 2 1 1
MIRT046725 GLO1 glyoxalase I 1 1
MIRT046726 MCM3 minichromosome maintenance complex component 3 1 1
MIRT046727 WDR6 WD repeat domain 6 1 1
MIRT046728 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT046729 MARS methionyl-tRNA synthetase 1 1
MIRT046730 MTA2 metastasis associated 1 family, member 2 1 1
MIRT046731 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT046732 BPTF bromodomain PHD finger transcription factor 1 1
MIRT046733 DBN1 drebrin 1 1 1
MIRT046734 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 1
MIRT046735 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT046736 OLA1 Obg-like ATPase 1 1 1
MIRT046737 MORF4L1 mortality factor 4 like 1 1 1
MIRT046738 TATDN2 TatD DNase domain containing 2 1 1
MIRT046739 USP9X ubiquitin specific peptidase 9, X-linked 1 1
MIRT046740 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT046741 CSAG1 chondrosarcoma associated gene 1 1 1
MIRT046742 RBM10 RNA binding motif protein 10 1 1
MIRT046743 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT046744 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046745 CKAP2 cytoskeleton associated protein 2 1 1
MIRT046746 EIF3B eukaryotic translation initiation factor 3, subunit B 1 1
MIRT046747 TXN thioredoxin 1 1
MIRT046748 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT046749 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT046750 DAXX death-domain associated protein 1 1
MIRT046751 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT046752 PAIP2 poly(A) binding protein interacting protein 2 1 1
MIRT046753 COL5A2 collagen, type V, alpha 2 1 1
MIRT046754 FAM83G family with sequence similarity 83, member G 1 1
MIRT046755 APP amyloid beta (A4) precursor protein 1 1
MIRT046756 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT046757 YLPM1 YLP motif containing 1 1 1
MIRT046758 ZMYND11 zinc finger, MYND domain containing 11 1 1
MIRT046759 NFS1 NFS1 nitrogen fixation 1 homolog (S. cerevisiae) 1 1
MIRT046760 HERC4 hect domain and RLD 4 1 1
MIRT046761 ZNF460 zinc finger protein 460 1 1
MIRT046762 YY1AP1 YY1 associated protein 1 1 1
MIRT046763 HSPA14 heat shock 70kDa protein 14 1 1
MIRT046764 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT046765 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT046766 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT046767 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT046768 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT046769 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT046770 JTB jumping translocation breakpoint 1 1
MIRT046771 KIF4A kinesin family member 4A 1 1
MIRT046772 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT046773 DPP8 dipeptidyl-peptidase 8 1 1
MIRT046774 ZNF131 zinc finger protein 131 1 1
MIRT046775 UBIAD1 UbiA prenyltransferase domain containing 1 1 1
MIRT046776 PCNT pericentrin 1 1
MIRT046777 CBX2 chromobox homolog 2 (Pc class homolog, Drosophila) 1 1
MIRT046778 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT046779 RFC1 replication factor C (activator 1) 1, 145kDa 1 1
MIRT046780 PLXNB2 plexin B2 1 1
MIRT046781 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT046782 ACTG1 actin, gamma 1 1 1
MIRT046783 PKP2 plakophilin 2 1 1
MIRT046784 FBXO21 F-box protein 21 1 1
MIRT046785 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT046786 FAM126B family with sequence similarity 126, member B 1 1
MIRT046787 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT046788 PHAX phosphorylated adaptor for RNA export 1 1
MIRT046789 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT046790 ILK integrin-linked kinase 1 1
MIRT046791 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT046792 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT046793 NDC1 transmembrane protein 48 1 1
MIRT046794 POMGNT1 protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase 1 1
MIRT046795 CAPRIN1 cell cycle associated protein 1 1 1
MIRT046796 POLE polymerase (DNA directed), epsilon 1 1
MIRT046797 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT046798 KNSTRN chromosome 15 open reading frame 23 1 1
MIRT046799 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT046800 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT046801 NKRF NFKB repressing factor 1 1
MIRT046802 EZR ezrin 1 1
MIRT046803 RNF4 ring finger protein 4 1 1
MIRT046804 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT046805 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT046806 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT046807 ATXN7L3 ataxin 7-like 3 1 1
MIRT046808 SORT1 sortilin 1 1 1
MIRT046809 PIGQ phosphatidylinositol glycan anchor biosynthesis, class Q 1 1
MIRT046810 RAP1GAP2 RAP1 GTPase activating protein 2 1 1
MIRT046811 FLNA filamin A, alpha 1 1
MIRT046812 PHRF1 PHD and ring finger domains 1 1 1
MIRT046813 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT046814 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT046815 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 1
MIRT046816 FPGS folylpolyglutamate synthase 1 1
MIRT046817 GANAB glucosidase, alpha; neutral AB 1 1
MIRT046818 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT046819 PANK3 pantothenate kinase 3 1 1
MIRT046820 POLD2 polymerase (DNA directed), delta 2, regulatory subunit 50kDa 1 1
MIRT046821 ENO1 enolase 1, (alpha) 1 1
MIRT046822 SLC35A2 solute carrier family 35 (UDP-galactose transporter), member A2 1 1
MIRT046823 PARK7 Parkinson disease (autosomal recessive, early onset) 7 1 1
MIRT046824 SEPT11 septin 11 1 1
MIRT046825 TRAP1 TNF receptor-associated protein 1 1 1
MIRT046826 CAST calpastatin 1 1
MIRT046827 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT046828 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT046829 RANBP10 RAN binding protein 10 1 1
MIRT046830 MEA1 male-enhanced antigen 1 1 1
MIRT046831 ATF5 activating transcription factor 5 1 1
MIRT046832 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT046833 PTDSS2 phosphatidylserine synthase 2 1 1
MIRT046834 EXOSC1 exosome component 1 1 1
MIRT046835 CABYR calcium binding tyrosine-(Y)-phosphorylation regulated 1 1
MIRT046836 SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1 1