Accession ID: MIRT000770 [miRNA, hsa-miR-224-5p :: PDGFRB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-224LinkOut: [miRBase ]
Description Homo sapiens miR-224 stem-loop
Comment This miR was identified and ends mapped by cloning from Weri cells in human. The sequence maps to chromosome X. An erratum corrected the originally published name miR-175 to miR-224. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-224-5p
Mature Sequence 8| CAAGUCACUAGUGGUUCCGUU |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-224-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PDGFRB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD140B, JTK12, PDGFR, PDGFR1
Description platelet-derived growth factor receptor, beta polypeptide
Transcript NM_0026    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PDGFRB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PDGFRB
(miRNA target sites are highlighted)
>PDGFRB|NM_0026|3'UTR
   1 TAGGGGGCTGGCCCCTACCCTGCCCTGCCTGAAGCTCCCCCCCTGCCAGCACCCAGCATCTCCTGGCCTGGCCTGACCGG
  81 GCTTCCTGTCAGCCAGGCTGCCCTTATCAGCTGTCCCCTTCTGGAAGCTTTCTGCTCCTGACGTGTTGTGCCCCAAACCC
 161 TGGGGCTGGCTTAGGAGGCAAGAAAACTGCAGGGGCCGTGACCAGCCCTCTGCCTCCAGGGAGGCCAACTGACTCTGAGC
 241 CAGGGTTCCCCCAGGGAACTCAGTTTTCCCATATGTAAGATGGGAAAGTTAGGCTTGATGACCCAGAATCTAGGATTCTC
 321 TCCCTGGCTGACAGGTGGGGAGACCGAATCCCTCCCTGGGAAGATTCTTGGAGTTACTGAGGTGGTAAATTAACTTTTTT
 401 CTGTTCAGCCAGCTACCCCTCAAGGAATCATAGCTCTCTCCTCGCACTTTTATCCACCCAGGAGCTAGGGAAGAGACCCT
 481 AGCCTCCCTGGCTGCTGGCTGAGCTAGGGCCTAGCCTTGAGCAGTGTTGCCTCATCCAGAAGAAAGCCAGTCTCCTCCCT
 561 ATGATGCCAGTCCCTGCGTTCCCTGGCCCGAGCTGGTCTGGGGCCATTAGGCAGCCTAATTAATGCTGGAGGCTGAGCCA
 641 AGTACAGGACACCCCCAGCCTGCAGCCCTTGCCCAGGGCACTTGGAGCACACGCAGCCATAGCAAGTGCCTGTGTCCCTG
 721 TCCTTCAGGCCCATCAGTCCTGGGGCTTTTTCTTTATCACCCTCAGTCTTAATCCATCCACCAGAGTCTAGAAGGCCAGA
 801 CGGGCCCCGCATCTGTGATGAGAATGTAAATGTGCCAGTGTGGAGTGGCCACGTGTGTGTGCCAGTATATGGCCCTGGCT
 881 CTGCATTGGACCTGCTATGAGGCTTTGGAGGAATCCCTCACCCTCTCTGGGCCTCAGTTTCCCCTTCAAAAAATGAATAA
 961 GTCGGACTTATTAACTCTGAGTGCCTTGCCAGCACTAACATTCTAGAGTATTCCAGGTGGTTGCACATTTGTCCAGATGA
1041 AGCAAGGCCATATACCCTAAACTTCCATCCTGGGGGTCAGCTGGGCTCCTGGGAGATTCCAGATCACACATCACACTCTG
1121 GGGACTCAGGAACCATGCCCCTTCCCCAGGCCCCCAGCAAGTCTCAAGAACACAGCTGCACAGGCCTTGACTTAGAGTGA
1201 CAGCCGGTGTCCTGGAAAGCCCCCAGCAGCTGCCCCAGGGACATGGGAAGACCACGGGACCTCTTTCACTACCCACGATG
1281 ACCTCCGGGGGTATCCTGGGCAAAAGGGACAAAGAGGGCAAATGAGATCACCTCCTGCAGCCCACCACTCCAGCACCTGT
1361 GCCGAGGTCTGCGTCGAAGACAGAATGGACAGTGAGGACAGTTATGTCTTGTAAAAGACAAGAAGCTTCAGATGGGTACC
1441 CCAAGAAGGATGTGAGAGGTGGGCGCTTTGGAGGTTTGCCCCTCACCCACCAGCTGCCCCATCCCTGAGGCAGCGCTCCA
1521 TGGGGGTATGGTTTTGTCACTGCCCAGACCTAGCAGTGACATCTCATTGTCCCCAGCCCAGTGGGCATTGGAGGTGCCAG
1601 GGGAGTCAGGGTTGTAGCCAAGACGCCCCCGCACGGGGAGGGTTGGGAAGGGGGTGCAGGAAGCTCAACCCCTCTGGGCA
1681 CCAACCCTGCATTGCAGGTTGGCACCTTACTTCCCTGGGATCCCCAGAGTTGGTCCAAGGAGGGAGAGTGGGTTCTCAAT
1761 ACGGTACCAAAGATATAATCACCTAGGTTTACAAATATTTTTAGGACTCACGTTAACTCACATTTATACAGCAGAAATGC
1841 TATTTTGTATGCTGTTAAGTTTTTCTATCTGTGTACTTTTTTTTAAGGGAAAGATTTTAATATTAAACCTGGTGCTTCTC
1921 ACTCACAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGCCUUGGUGAUCACUGAAc 5'
            | || |:|  |||||| | 
Target 5' ccCAGACCTAGCAGTGACATc 3'
1543 - 1563 127.00 -8.92
2
miRNA  3' uugccUUGGUGAUCACUGAAc 5'
               |||: : |||| ||| 
Target 5' ttattAACTCTGAGTGCCTTg 3'
968 - 988 124.00 -10.20
3
miRNA  3' uugccuuggugaucACUGAAc 5'
                        |||||| 
Target 5' agctgcacaggcctTGACTTa 3'
1174 - 1194 120.00 -6.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-224-5p :: PDGFRB    [ Functional MTI ]
Validation Method Microarray , Northern blot , Other
Original Description (Extracted from the article) ... Using these algorithms, we listed cancer-related mRNA targets of miRNA (Table 4). Especially, searching a candidate gene for miR-18, we picked up two candidates; connective tissue growth factor (CTGF) and receptor activator nuclear factor kappa B ligand (RANKL). ...

- Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al., 2006, Oncogene.

Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
19 hsa-miR-224-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000454 KLK10 kallikrein-related peptidase 10 3 1
MIRT000635 CXCR4 chemokine (C-X-C motif) receptor 4 4 1
MIRT000636 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 1
MIRT000769 RAB9B RAB9B, member RAS oncogene family 2 1
MIRT000770 PDGFRB platelet-derived growth factor receptor, beta polypeptide 2 1
MIRT003232 AP2M1 adaptor-related protein complex 2, mu 1 subunit 2 1
MIRT003233 NIT1 nitrilase 1 2 1
MIRT003234 FOSB FBJ murine osteosarcoma viral oncogene homolog B 2 1
MIRT003235 NCOA6 nuclear receptor coactivator 6 2 1
MIRT003393 CD40 CD40 molecule, TNF receptor superfamily member 5 3 1
MIRT003987 API5 apoptosis inhibitor 5 4 2
MIRT005755 EYA4 eyes absent homolog 4 (Drosophila) 3 1
MIRT005756 EDNRA endothelin receptor type A 3 1
MIRT006136 DIO1 deiodinase, iodothyronine, type I 3 1
MIRT006527 SMAD4 SMAD family member 4 2 1
MIRT007008 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT024135 KLK1 kallikrein 1 1 1
MIRT046570 ARSB arylsulfatase B 1 1
MIRT046571 ADNP2 ADNP homeobox 2 1 1