Accession ID: MIRT000770 [miRNA, hsa-miR-224-5p :: PDGFRB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-224LinkOut: [miRBase ]
Description Homo sapiens miR-224 stem-loop
Comment This miR was identified and ends mapped by cloning from Weri cells in human. The sequence maps to chromosome X. An erratum corrected the originally published name miR-175 to miR-224. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-224-5p
Mature Sequence 8| CAAGUCACUAGUGGUUCCGUU |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-224-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-224-5p :: PDGFRB    [ Functional MTI ]
Validation Method Microarray , Northern blot , Other
Original Description (Extracted from the article) ... Using these algorithms, we listed cancer-related mRNA targets of miRNA (Table 4). Especially, searching a candidate gene for miR-18, we picked up two candidates; connective tissue growth factor (CTGF) and receptor activator nuclear factor kappa B ligand (RANKL). ...

- Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al., 2006, Oncogene.

Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
116 hsa-miR-224-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000454 KLK10 kallikrein-related peptidase 10 3 1
MIRT000635 CXCR4 chemokine (C-X-C motif) receptor 4 4 1
MIRT000636 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 5 3
MIRT000769 RAB9B RAB9B, member RAS oncogene family 2 1
MIRT000770 PDGFRB platelet-derived growth factor receptor, beta polypeptide 2 1
MIRT003232 AP2M1 adaptor-related protein complex 2, mu 1 subunit 2 1
MIRT003233 NIT1 nitrilase 1 2 1
MIRT003234 FOSB FBJ murine osteosarcoma viral oncogene homolog B 2 1
MIRT003235 NCOA6 nuclear receptor coactivator 6 2 1
MIRT003393 CD40 CD40 molecule, TNF receptor superfamily member 5 3 1
MIRT003987 API5 apoptosis inhibitor 5 4 2
MIRT005755 EYA4 eyes absent homolog 4 (Drosophila) 3 1
MIRT005756 EDNRA endothelin receptor type A 3 1
MIRT006136 DIO1 deiodinase, iodothyronine, type I 3 1
MIRT006527 SMAD4 SMAD family member 4 3 2
MIRT007008 PEBP1 phosphatidylethanolamine binding protein 1 3 2
MIRT024135 KLK1 kallikrein 1 1 1
MIRT046570 ARSB arylsulfatase B 1 1
MIRT046571 ADNP2 ADNP homeobox 2 1 1
MIRT053204 TCEAL1 transcription elongation factor A (SII)-like 1 4 1
MIRT053250 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 2 1
MIRT053520 DPYSL2 dihydropyrimidinase-like 2 2 1
MIRT053521 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 2 1
MIRT054457 HOXD10 homeobox D10 3 1
MIRT054880 PTX3 pentraxin 3, long 3 1
MIRT059146 TXNIP thioredoxin interacting protein 1 1
MIRT067402 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT074442 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT082021 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 2
MIRT099312 QKI QKI, KH domain containing, RNA binding 1 2
MIRT141020 NPTN neuroplastin 1 1
MIRT145280 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT190176 AKIRIN1 akirin 1 1 5
MIRT244294 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT260710 CLDN12 claudin 12 1 3
MIRT286675 ZNF207 zinc finger protein 207 1 1
MIRT316821 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT325703 CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa 1 1
MIRT333389 EFNA3 ephrin-A3 1 1
MIRT373360 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT437393 MBD2 methyl-CpG binding domain protein 2 5 1
MIRT437894 TPD52 tumor protein D52 3 1
MIRT437913 SERPINF2 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 2 1
MIRT438014 TRIB1 tribbles homolog 1 (Drosophila) 4 1
MIRT438617 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT438618 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 3 1
MIRT438619 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT442442 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT451335 ZNF573 zinc finger protein 573 1 1
MIRT461784 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT463240 ZKSCAN8 zinc finger protein 192 1 1
MIRT463847 WRN Werner syndrome, RecQ helicase-like 1 1
MIRT464343 USP6NL USP6 N-terminal like 1 1
MIRT466708 TADA2B transcriptional adaptor 2B 1 1
MIRT476376 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT477183 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT483225 ZWINT ZW10 interactor 1 1
MIRT490788 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT492526 RAB15 RAB15, member RAS oncogene family 1 2
MIRT494868 TOM1L2 target of myb1-like 2 (chicken) 1 1
MIRT499691 KCTD2 potassium channel tetramerisation domain containing 2 1 2
MIRT500106 SLC46A3 solute carrier family 46, member 3 1 1
MIRT501145 SLC12A5 solute carrier family 12 (potassium/chloride transporter), member 5 1 1
MIRT501827 NCOA3 nuclear receptor coactivator 3 1 1
MIRT502268 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT506916 KBTBD8 kelch repeat and BTB (POZ) domain containing 8 1 2
MIRT506957 HOXB3 homeobox B3 1 2
MIRT508852 CACNG7 calcium channel, voltage-dependent, gamma subunit 7 1 3
MIRT511424 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 2
MIRT513371 ADAP1 ArfGAP with dual PH domains 1 1 3
MIRT513551 SLC7A14 solute carrier family 7 (orphan transporter), member 14 1 1
MIRT516319 F8A2 coagulation factor VIII-associated 2 1 1
MIRT516345 F8A3 coagulation factor VIII-associated 3 1 1
MIRT527311 ZNF135 zinc finger protein 135 1 1
MIRT528579 ITGB3BP integrin beta 3 binding protein (beta3-endonexin) 1 1
MIRT528922 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 3
MIRT529782 C17orf82 chromosome 17 open reading frame 82 1 1
MIRT530743 STARD5 StAR-related lipid transfer (START) domain containing 5 1 1
MIRT533130 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT533537 TPR translocated promoter region, nuclear basket protein 1 1
MIRT537460 FAM84B family with sequence similarity 84, member B 1 1
MIRT543292 ZNF585B zinc finger protein 585B 1 1
MIRT545981 XPO1 exportin 1 (CRM1 homolog, yeast) 1 2
MIRT547443 MED13 mediator complex subunit 13 1 1
MIRT548842 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 2
MIRT557884 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558142 ENC1 ectodermal-neural cortex 1 (with BTB-like domain) 1 1
MIRT560900 RPL15 ribosomal protein L15 1 1
MIRT562184 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT564354 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT565803 SEC14L5 SEC14-like 5 (S. cerevisiae) 1 1
MIRT566309 COASY CoA synthase 1 1
MIRT567213 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT567390 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT610031 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT615814 COQ7 coenzyme Q7 homolog, ubiquinone (yeast) 1 1
MIRT618139 GABARAPL3 GABA(A) receptors associated protein like 3, pseudogene 1 1
MIRT619261 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT622505 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 2
MIRT639737 MAP2K2 mitogen-activated protein kinase kinase 2 1 1
MIRT641261 C8orf46 chromosome 8 open reading frame 46 1 1
MIRT642686 KRT74 keratin 74 1 1
MIRT646106 GORAB golgin, RAB6-interacting 1 1
MIRT650625 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT653521 SLC41A1 solute carrier family 41, member 1 1 1
MIRT655294 PELI1 pellino E3 ubiquitin protein ligase 1 1 1
MIRT667639 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT695321 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT701952 MITF microphthalmia-associated transcription factor 1 1
MIRT702513 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT706013 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT708888 MOCS2 molybdenum cofactor synthesis 2 1 1
MIRT714020 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT714139 IL20RB interleukin 20 receptor beta 1 1
MIRT718586 ARL4D ADP-ribosylation factor-like 4D 1 1
MIRT725457 HIPK3 homeodomain interacting protein kinase 3 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*