Accession ID: MIRT000815 [miRNA, hsa-miR-15a-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15aLinkOut: [miRBase ]
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Mature Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions CLL patient samples
Location of target site 3'UTR
Original Description (Extracted from the article) ... BCL2 Is a Target of Posttranscriptional Repression by miR-15 and miR-16.//both mutants completely abolish the interaction between miR-15a and miR-16-1 and the 3'UTR of BCL2 (Fig. 2C).//These data indicate that both miRNAs directly interact with the 3'UTR of BCL2. ...

- Cimmino, A. Calin, G. A. Fabbri, M. Iorio, et al., 2005, Proc Natl Acad Sci U S A.

Article - Cimmino, A. Calin, G. A. Fabbri, M. Iorio, et al.
- Proc Natl Acad Sci U S A, 2005
Chronic lymphocytic leukemia (CLL) is the most common human leukemia and is characterized by predominantly nondividing malignant B cells overexpressing the antiapoptotic B cell lymphoma 2 (Bcl2) protein. miR-15a and miR-16-1 are deleted or down-regulated in the majority of CLLs. Here, we demonstrate that miR-15a and miR-16-1 expression is inversely correlated to Bcl2 expression in CLL and that both microRNAs negatively regulate Bcl2 at a posttranscriptional level. BCL2 repression by these microRNAs induces apoptopsis in a leukemic cell line model. Therefore, miR-15 and miR-16 are natural antisense Bcl2 interactors that could be used for therapy of Bcl2-overexpressing tumors.
LinkOut: [PMID: 16166262]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Microarray , qRT-PCR , Other
Conditions HL60 , NB41A3
Disease Acute promyelocytic leukemia (APL);
Location of target site 3'UTR
Tools used in this research microRNA.org , miRanda , PicTar
Original Description (Extracted from the article) ... we report the miRNA gene expression profile of an APL cell line (NB4) upon granulocytic differentiation with ATRA. The results were also confirmed in HL-60 cells, another mycloid leukemia cell line that undergoes granulocytic differentiation upon ATRA treatment and in primary APL patient samples treated in vitro with ATRA ...

- Garzon, R. Pichiorri, F. Palumbo, T. et al., 2007, Oncogene.

Article - Garzon, R. Pichiorri, F. Palumbo, T. et al.
- Oncogene, 2007
MicroRNAs (miRNAs) are small non-coding RNAs of 19-25 nucleotides that are involved in the regulation of critical cell processes such as apoptosis, cell proliferation and differentiation. However, little is known about the role of miRNAs in granulopoiesis. Here, we report the expression of miRNAs in acute promyelocytic leukemia patients and cell lines during all-trans-retinoic acid (ATRA) treatment by using a miRNA microarrays platform and quantitative real time-polymerase chain reaction (qRT-PCR). We found upregulation of miR-15a, miR-15b, miR-16-1, let-7a-3, let-7c, let-7d, miR-223, miR-342 and miR-107, whereas miR-181b was downregulated. Among the upregulated miRNAs, miR-107 is predicted to target NFI-A, a gene that has been involved in a regulatory loop involving miR-223 and C/EBPa during granulocytic differentiation. Indeed, we have confirmed that miR-107 targets NF1-A. To get insights about ATRA regulation of miRNAs, we searched for ATRA-modulated transcription factors binding sites in the upstream genomic region of the let-7a-3/let-7b cluster and identified several putative nuclear factor-kappa B (NF-kappaB) consensus elements. The use of reporter gene assays, chromatin immunoprecipitation and site-directed mutagenesis revealed that one proximal NF-kappaB binding site is essential for the transactivation of the let-7a-3/let-7b cluster. Finally, we show that ATRA downregulation of RAS and Bcl2 correlate with the activation of known miRNA regulators of those proteins, let-7a and miR-15a/miR-16-1, respectively.
LinkOut: [PMID: 17260024]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Calin, G. A. Pekarsky, Y. Croce, C. M.
- Best Pract Res Clin Haematol, 2007
New findings support the view that chronic lymphocytic leukemia (CLL) is a genetic disease in which the main alterations occur in a new class of genes named microRNAs (miRNAs). Cases with good prognostic features typically are characterized by miRNA down-regulation of genes miR-15a and miR-16-1, located at 13q14.3. Both microRNAs negatively regulate BCL2 at a post-transcriptional level. On the other hand, in CLL cases that use unmutated immunoglobulin heavy-chain variable-region genes (IgV(H)) or have high-level expression of the 70-kD zeta-associated protein (ZAP-70) have high levels of TCL1 due to low-level expression of miR-29 and miR-181, which directly target this oncogene. Conceivably, these miRNAs might be used to target BCL2 or TCL1 for therapy of this disease.
LinkOut: [PMID: 17707831]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Cho, W. C.
- Mol Cancer, 2007
microRNAs (miRNAs) are evolutionarily conserved, endogenous, small, noncoding RNA molecules of about 22 nucleotides in length that function as posttranscriptional gene regulators. They are deemed to play a crucial role in the initiation and progression of human cancer, and those with a role in cancer are designated as oncogenic miRNAs (oncomiRs). For example, miR-15 and miR-16 induce apoptosis by targeting Bcl2. miRNAs from the miR-17-92 cluster modulate tumor formation and function as oncogenes by influencing the translation of E2F1 mRNA. miR-21 modulates gemcitabine-induced apoptosis by phosphatase and tensin homolog deleted on chromosome 10-dependent activation of PI 3-kinase signaling. miR-34a acts as a suppressor of neuroblastoma tumorigenesis by targeting the mRNA encoding E2F3 and reducing E2F3 protein levels. The chromosomal translocations associating with human tumors disrupt the repression of High mobility group A2 by let-7 miRNA. In addition, the oncomiRs expression profiling of human malignancies has also identified a number of diagnostic and prognostic cancer signatures. This article introduces the roles of oncomiRs in neoplasm development, progression, diagnosis, prognostication, as well as their mechanism of actions on target mRNAs and the functional outcomes of their actions on mRNAs. The paper ends with a brief perspective to the future of oncomiRs.
LinkOut: [PMID: 17894887]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method qRT-PCR , proteomics analysis , Other
Location of target site 3'UTR
Original Description (Extracted from the article) ... changed ...

- Calin, G. A. Cimmino, A. Fabbri, M. et al., 2008, Proc Natl Acad Sci U S A.

Article - Calin, G. A. Cimmino, A. Fabbri, M. et al.
- Proc Natl Acad Sci U S A, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method
Article - Xia, L. Zhang, D. Du, R. Pan, Y. Zhao, L. et al.
- Int J Cancer, 2008
microRNAs are endogenous small noncoding RNAs that regulate gene expression negatively at posttranscriptional level. This latest addition to the complex gene regulatory circuitry revolutionizes our way to understanding physiological and pathological processes in the human body. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in gastric cancer cells. microRNA expression profiling revealed a limited set of microRNAs with altered expression in multidrug- resistant gastric cancer cell line SGC7901/VCR compared to its parental SGC7901 cell line. Among the downregulated microRNAs are miR-15b and miR-16, members of miR-15/16 family, whose expression was further validated by qRT-PCR. In vitro drug sensitivity assay demonstrated that overexpression of miR-15b or miR-16 sensitized SGC7901/VCR cells to anticancer drugs whereas inhibition of them using antisense oligonucleotides conferred SGC7901 cells MDR. The downregulation of miR-15b and miR-16 in SGC7901/VCR cells was concurrent with the upregulation of Bcl-2 protein. Enforced mir-15b or miR-16 expression reduced Bcl-2 protein level and the luciferase activity of a BCL2 3' untranslated region-based reporter construct in SGC7901/VCR cells, suggesting that BCL2 is a direct target of miR-15b and miR-16. Moreover, overexpression of miR-15b or miR-16 could sensitize SGC7901/VCR cells to VCR-induced apoptosis. Taken together, our findings suggest that miR-15b and miR-16 could play a role in the development of MDR in gastric cancer cells at least in part by modulation of apoptosis via targeting BCL2.
LinkOut: [PMID: 18449891]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Bonci, D. Coppola, V. Musumeci, M. Addario, et al.
- Nat Med, 2008
MicroRNAs (miRNAs) are noncoding small RNAs that repress protein translation by targeting specific messenger RNAs. miR-15a and miR-16-1 act as putative tumor suppressors by targeting the oncogene BCL2. These miRNAs form a cluster at the chromosomal region 13q14, which is frequently deleted in cancer. Here, we report that the miR-15a and miR-16-1 cluster targets CCND1 (encoding cyclin D1) and WNT3A, which promotes several tumorigenic features such as survival, proliferation and invasion. In cancer cells of advanced prostate tumors, the miR-15a and miR-16 level is significantly decreased, whereas the expression of BCL2, CCND1 and WNT3A is inversely upregulated. Delivery of antagomirs specific for miR-15a and miR-16 to normal mouse prostate results in marked hyperplasia, and knockdown of miR-15a and miR-16 promotes survival, proliferation and invasiveness of untransformed prostate cells, which become tumorigenic in immunodeficient NOD-SCID mice. Conversely, reconstitution of miR-15a and miR-16-1 expression results in growth arrest, apoptosis and marked regression of prostate tumor xenografts. Altogether, we propose that miR-15a and miR-16 act as tumor suppressor genes in prostate cancer through the control of cell survival, proliferation and invasion. These findings have therapeutic implications and may be exploited for future treatment of prostate cancer.
LinkOut: [PMID: 18931683]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HEK293
Disease chronic lymphocytic leukemia
Location of target site 3'UTR
Tools used in this research FASTH
Original Description (Extracted from the article) ... Assessed by p-value, this decrease was significant for the TSPYL2 and WNT9B constructs at 10 and 50 nM, and for the BCL2 and TNFSF12 constructs at 50 nM. BCL2 mRNA has previously been validated as a target for has-miR-15a inhibition [30]. The CREBBP construct showed ,32% mean reduction at 50 nM, although this reduction is not significant as assessed by p-value.//A recent study shows that hsa-miR-15a and miR-16 induce apoptosis by targeting the BCL2 mRNA, and our results confirm this targeting for hsa-miR-15a. ...

- Ragan, C. Cloonan, N. Grimmond, S. M. et al., 2009, PLoS One.

Article - Ragan, C. Cloonan, N. Grimmond, S. M. et al.
- PLoS One, 2009
Transcriptional regulation by microRNAs (miRNAs) involves complementary base-pairing at target sites on mRNAs, yielding complex secondary structures. Here we introduce an efficient computational approach and software (FASTH) for genome-scale prediction of miRNA target sites based on minimizing the free energy of duplex structure. We apply our approach to identify miRNA target sites in the human and mouse transcriptomes. Our results show that short sequence motifs in the 5' end of miRNAs frequently match mRNAs perfectly, not only at validated target sites but additionally at many other, energetically favourable sites. High-quality matching regions are abundant and occur at similar frequencies in all mRNA regions, not only the 3'UTR. About one-third of potential miRNA target sites are reassigned to different mRNA regions, or gained or lost altogether, among different transcript isoforms from the same gene. Many potential miRNA target sites predicted in human are not found in mouse, and vice-versa, but among those that do occur in orthologous human and mouse mRNAs most are situated in corresponding mRNA regions, i.e. these sites are themselves orthologous. Using a luciferase assay in HEK293 cells, we validate four of six predicted miRNA-mRNA interactions, with the mRNA level reduced by an average of 73%. We demonstrate that a thermodynamically based computational approach to prediction of miRNA binding sites on mRNAs can be scaled to analyse complete mammalian transcriptome datasets. These results confirm and extend the scope of miRNA-mediated species- and transcript-specific regulation in different cell types, tissues and developmental conditions.
LinkOut: [PMID: 19478946]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Western blot
Conditions OV-202
Original Description (Extracted from the article) ... MiR-15a and miR-16 also target Bcl-2 in ovarian cancer cell lines. ...

- Bhattacharya, R. Nicoloso, M. Arvizo, R. et al., 2009, Cancer Res.

Article - Bhattacharya, R. Nicoloso, M. Arvizo, R. et al.
- Cancer Res, 2009
Oncogenic activation of Bmi-1 is found in a wide variety of epithelial malignancies including ovarian cancer, yet a specific mechanism for overexpression of Bmi-1 has not been determined. Thus, realizing the immense pathologic significance of Bmi-1 in cancer, we wanted to investigate if microRNA (miRNA) aberrations played a role in the regulation of Bmi-1 in ovarian cancer. In this report, we identify two miRNAs, miR-15a and miR-16, that are underexpressed in ovarian cell lines and in primary ovarian tissues. We show that these miRNAs directly target the Bmi-1 3' untranslated region and significantly correlate with Bmi-1 protein levels in ovarian cancer patients and cell lines. Furthermore, Bmi-1 protein levels are downregulated in response to miR-15a or miR-16 expression and lead to significant reduction in ovarian cancer cell proliferation and clonal growth. These findings suggest the development of therapeutic strategies by restoring miR-15a and miR-16 expression in ovarian cancer and in other cancers that involve upregulation of Bmi-1.
LinkOut: [PMID: 19903841]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Western blot
Conditions MCF-7 , MDA-MB-231
Disease breast carcinoma
Location of target site 3'UTR
Original Description (Extracted from the article) ... These results further implicate the BCL-2 targeting miR-15a/16 as important regulators of BCL-2 expression and tamoxifen response and suggest that oncogene suppression of miR-15a and/or miR-16 may represent an important mechanism of tamoxifen resistance. ...

- Cittelly, D. M. Das, P. M. Salvo, V. A. et al., 2010, Carcinogenesis.

Article - Cittelly, D. M. Das, P. M. Salvo, V. A. et al.
- Carcinogenesis, 2010
Tamoxifen is the most commonly prescribed therapy for patients with estrogen receptor (ERalpha) positive breast tumors. Tumor resistance to tamoxifen remains a serious clinical problem especially in patients with tumors that also overexpress HER2. Current preclinical models of HER2 overexpression fail to recapitulate the clinical spectrum of endocrine resistance associated with HER2/ER positive tumors. Here we show that ectopic expression of a clinically important oncogenic isoform of HER2, HER2Delta16, which is expressed in over 30% of ER positive breast tumors, promotes tamoxifen resistance and estrogen independence of MCF-7 xenografts. MCF-7/HER2Delta16 cells evade tamoxifen through upregulation of BCL-2, whereas RNAi-mediated suppression of BCL-2 expression or treatment of MCF-7/HER2Delta16 cells with the BCL-2 family pharmacological inhibitor ABT-737 restores tamoxifen sensitivity. Tamoxifen-resistant MCF-7/HER2Delta16 cells upregulate BCL-2 protein levels in response to suppressed ERalpha signaling mediated by estrogen withdrawal, tamoxifen treatment, or fulvestrant treatment. In addition, HER2Delta16 expression results in suppression of BCL-2 targeting microRNAs miR-15a and miR-16. Reintroduction of miR-15a/16 reduced tamoxifen-induced BCL-2 expression and sensitized MCF-7/HER2Delta16 to tamoxifen. Conversely, inhibition of miR-15a/16 in tamoxifen sensitive cells activated BCL-2 expression and promoted tamoxifen resistance. Our results suggest that HER2Delta16 expression promotes endocrine-resistant HER2/ERalpha positive breast tumors and in contrast to wild-type HER2, preclinical models of HER2Delta16 overexpression recapitulate multiple phenotypes of endocrine resistant human breast tumors. The mechanism of HER2Delta16 therapeutic evasion, involving tamoxifen induced upregulation of BCL-2 and suppression of miR-15a/16, provides a template for unique therapeutic interventions combining tamoxifen with modulation of microRNAs and/or ABT-737 mediated BCL-2 inhibition and apoptosis.
LinkOut: [PMID: 20876285]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Klein, U. Dalla-Favera, R.
- Semin Cancer Biol, 2010
Chronic lymphocytic leukemia (CLL), an incurable disease of the elderly, stands out as unique among the malignancies derived from mature B lymphocytes. The histology, immunophenotype, immunoglobulin variable region (IgV) gene somatic hypermutation status, and the pattern of genetic alterations of the tumor cells are markedly distinct from that of any other B-cell tumor. Most notably, CLL cases can have somatically mutated as well as unmutated IgV genes which largely correlate with a favorable and unfavorable clinical prognosis, respectively. Moreover, recent evidence suggests that 6% of the normal elderly population develops a monoclonal B-cell lymphocytosis (MBL) that appears as the precursor to CLL in 1-2% of cases. Over the last decade, global gene expression profile analysis was instrumental in defining CLL as a malignancy originating from the oncogenic transformation of a common cellular precursor that resembles an antigen-experienced B cell. These findings were complemented by the realization that all CLL, independent of their IgV gene somatic mutation status, express B-cell receptors (BCRs) that show evidence of antigen-experience. Indeed, the BCRs of CLL cases among different individuals can be similar to the extent that one was able to define subsets of stereotyped receptors based on the homology in the antigen-binding regions. Together, these observations strongly support the notion that antigen plays a critical role in CLL pathogenesis. This role is complemented by genetic alterations that, analogous to most cancer types, represent the initiating pathogenetic event. In fact, CLL cases display recurrent genetic aberrations including trisomy 12 and monoallelic or biallelic deletion/inactivation of chromosomal regions 17p, 11q and 13q14. However, virtually all CLL cases lack balanced reciprocal chromosomal translocations, the genetic hallmark of germinal center (GC)-derived lymphomas. The most frequent genetic aberration in CLL, deletion of chromosomal region 13q14, was recently shown to have a specific role in CLL pathogenesis. This region encodes a tumor suppressor locus comprising a microRNA cluster embedded in a long sterile RNA gene, whose deletion in the mouse leads to lymphoproliferative syndromes recapitulating the human CLL-associated spectrum, including MBL, CLL and B-cell non-Hodgkin lymphoma (B-NHL). This review will focus on the cellular origin of CLL, its relationship to the mechanisms of generating CLL-associated genetic lesions and on the role of the 13q14 deletion in CLL pathogenesis as emerging from the analysis of a newly generated mouse model.
LinkOut: [PMID: 21029776]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
132 hsa-miR-15a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT000282 WNT3A wingless-type MMTV integration site family, member 3A 3 2
MIRT000283 MYB v-myb myeloblastosis viral oncogene homolog (avian) 5 3
MIRT000284 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT000285 CCND2 cyclin D2 3 3
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 B-cell CLL/lymphoma 2 5 12
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2 (Drosophila) 2 1
MIRT000823 TMEM251 chromosome 14 open reading frame 109 2 1
MIRT000825 CARD8 caspase recruitment domain family, member 8 2 1
MIRT000827 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63kDa 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein-like 2 2 1
MIRT000835 ECHDC1 enoyl CoA hydratase domain containing 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3-like 2 1
MIRT000851 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 2 1
MIRT000853 H3F3B H3 histone, family 3B (H3.3B) 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 2 1
MIRT000859 HERC6 hect domain and RLD 6 2 1
MIRT000863 HRSP12 heat-responsive protein 12 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock 70kDa protein 1A 2 1
MIRT000868 JUN jun oncogene 2 1
MIRT000878 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT000880 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 2 1
MIRT000884 OMA1 OMA1 homolog, zinc metallopeptidase (S. cerevisiae) 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase, beta 2 1
MIRT000892 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT000898 RAD51C RAD51 homolog C (S. cerevisiae) 2 1
MIRT000900 RHOT1 ras homolog gene family, member T1 2 1
MIRT000902 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 2 1
MIRT000906 SLC35A1 solute carrier family 35 (CMP-sialic acid transporter), member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35, member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 6
MIRT001228 CCNE1 cyclin E1 5 4
MIRT001802 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT002946 DMTF1 cyclin D binding myb-like transcription factor 1 2 1
MIRT003333 BRCA1 breast cancer 1, early onset 2 2
MIRT003334 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT003872 WIPF1 WAS/WASL interacting protein family, member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 2 1
MIRT003874 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69, member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 coiled-coil domain containing 111 2 1
MIRT003883 C2orf43 chromosome 2 open reading frame 43 2 1
MIRT003884 C4orf27 chromosome 4 open reading frame 27 2 1
MIRT003885 NIPAL2 NIPA-like domain containing 2 2 1
MIRT003886 TRMT13 coiled-coil domain containing 76 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta (A4) precursor protein 2 1
MIRT004046 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 4 3
MIRT004680 TSPYL2 TSPY-like 2 2 1
MIRT004829 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 (keratinocyte growth factor) 2 1
MIRT006176 CLCN3 chloride channel 3 4 1
MIRT006177 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 4 1
MIRT006181 MN1 meningioma (disrupted in balanced translocation) 1 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 3 1
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon, gamma 2 1
MIRT006998 PURA purine-rich element binding protein A 1 1
MIRT007090 RECK reversion-inducing-cysteine-rich protein with kazal motifs 2 1
MIRT032077 DLK1 delta-like 1 homolog (Drosophila) 2 1
MIRT051311 PLA2G2D phospholipase A2, group IID 1 1
MIRT051312 ACVR1B activin A receptor, type IB 1 1
MIRT051313 IKBKG inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT051315 PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 1 1
MIRT051316 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y-like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3, acidic 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT051329 CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC-like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 1
MIRT051342 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 1 1
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif-containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT051349 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing 1 1