Accession ID: MIRT000928 [miRNA, hsa-miR-29c-3p :: COL1A1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29cLinkOut: [miRBase ]
Description Homo sapiens miR-29c stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29c-3p
Mature Sequence 54| UAGCACCAUUUGAAAUCGGUUA |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29c-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol COL1A1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms OI4
Description collagen, type I, alpha 1
Transcript NM_0000    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on COL1A1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of COL1A1
(miRNA target sites are highlighted)
>COL1A1|NM_0000|3'UTR
   1 TAAACTCCCTCCATCCCAACCTGGCTCCCTCCCACCCAACCAACTTTCCCCCCAACCCGGAAACAGACAAGCAACCCAAA
  81 CTGAACCCCCTCAAAAGCCAAAAAATGGGAGACAATTTCACATGGACTTTGGAAAATATTTTTTTCCTTTGCATTCATCT
 161 CTCAAACTTAGTTTTTATCTTTGACCAACCGAACATGACCAAAAACCAAAAGTGCATTCAACCTTACCAAAAAAAAAAAA
 241 AAAAAAAGAATAAATAAATAACTTTTTAAAAAAGGAAGCTTGGTCCACTTGCTTGAAGACCCATGCGGGGGTAAGTCCCT
 321 TTCTGCCCGTTGGGCTTATGAAACCCCAATGCTGCCCTTTCTGCTCCTTTCTCCACACCCCCCTTGGGGCCTCCCCTCCA
 401 CTCCTTCCCAAATCTGTCTCCCCAGAAGACACAGGAAACAATGTATTGTCTGCCCAGCAATCAAAGGCAATGCTCAAACA
 481 CCCAAGTGGCCCCCACCCTCAGCCCGCTCCTGCCCGCCCAGCACCCCCAGGCCCTGGGGGACCTGGGGTTCTCAGACTGC
 561 CAAAGAAGCCTTGCCATCTGGCGCTCCCATGGCTCTTGCAACATCTCCCCTTCGTTTTTGAGGGGGTCATGCCGGGGGAG
 641 CCACCAGCCCCTCACTGGGTTCGGAGGAGAGTCAGGAAGGGCCACGACAAAGCAGAAACATCGGATTTGGGGAACGCGTG
 721 TCAATCCCTTGTGCCGCAGGGCTGGGCGGGAGAGACTGTTCTGTTCCTTGTGTAACTGTGTTGCTGAAAGACTACCTCGT
 801 TCTTGTCTTGATGTGTCACCGGGGCAACTGCCTGGGGGCGGGGATGGGGGCAGGGTGGAAGCGGCTCCCCATTTTATACC
 881 AAAGGTGCTACATCTATGTGATGGGTGGGGTGGGGAGGGAATCACTGGTGCTATAGAAATTGAGATGCCCCCCCAGGCCA
 961 GCAAATGTTCCTTTTTGTTCAAAGTCTATTTTTATTCCTTGATATTTTTCTTTTTTTTTTTTTTTTTTTGTGGATGGGGA
1041 CTTGTGAATTTTTCTAAAGGTGCTATTTAACATGGGAGGAGAGCGTGTGCGGCTCCAGCCCAGCCCGCTGCTCACTTTCC
1121 ACCCTCTCTCCACCTGCCTCTGGCTTCTCAGGCCTCTGCTCTCCGACCTCTCTCCTCTGAAACCCTCCTCCACAGCTGCA
1201 GCCCATCCTCCCGGCTCCCTCCTAGTCTGTCCTGCGTCCTCTGTCCCCGGGTTTCAGAGACAACTTCCCAAAGCACAAAG
1281 CAGTTTTTCCCCCTAGGGGTGGGAGGAAGCAAAAGACTCTGTACCTATTTTGTATGTGTATAATAATTTGAGATGTTTTT
1361 AATTATTTTGATTGCTGGAATAAAGCATGTGGAAATGACCCAAACATAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' auuggcuaaAGUUUACCACGAu 5'
                   || | ||||||| 
Target 5' gggagggaaTC-ACTGGTGCTa 3'
913 - 933 144.00 -11.90
2
miRNA  3' auuGGCUAAAGU----UUACCACGAu 5'
             || ||||:|    || |||||| 
Target 5' ctcCCCATTTTATACCAAAGGTGCTa 3'
865 - 890 137.00 -12.50
3
miRNA  3' auuggcuAAAGUUUACCACGAu 5'
                 |||| || |||||| 
Target 5' gtgaattTTTCTAAAGGTGCTa 3'
1044 - 1065 135.00 -12.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29c-3p :: COL1A1    [ Functional MTI ]
Validation Method Luciferase reporter assay , ,
Conditions HeLa , HepG2
Location of target site 3'UTR
Tools used in this research TargetScan , PicTar
Original Description (Extracted from the article) ... In cultured cells, introduction of mir-29c down-regulated these genes at the level of mRNA and inhibited expression of luciferase encoded by vectors having the 3UTRs of these genes. Moreover, for each of several genes tested, mutating the mir-29c target sites in the 3 UTR abrogated mir-29c-induced inhibition of luciferase expression. ...

- Sengupta, S. den Boon, J. A. Chen, I. H. et al., 2008, Proc Natl Acad Sci U S A.

Article - Sengupta, S. den Boon, J. A. Chen, I. H. et al.
- Proc Natl Acad Sci U S A, 2008
Using highly sensitive microarray-based procedures, we identified eight microRNAs (miRNAs) showing robust differential expression between 31 laser-capture-microdissected nasopharyngeal carcinomas (NPCs) and 10 normal healthy nasopharyngeal epithelial samples. In particular, miRNA mir-29c was expressed at one-fifth the levels in tumors as in normal epithelium. In NPC tumors, the lower mir-29c levels correlated with higher levels of multiple mRNAs whose 3' UTRs can bind mir-29c at target sequences conserved across many vertebrates. In cultured cells, introduction of mir-29c down-regulated these genes at the level of mRNA and inhibited expression of luciferase encoded by vectors having the 3' UTRs of these genes. Moreover, for each of several genes tested, mutating the mir-29c target sites in the 3' UTR abrogated mir-29c-induced inhibition of luciferase expression. Most of the mir-29c-targeted genes identified encode extracellular matrix proteins, including multiple collagens and laminin gamma1, that are associated with tumor cell invasiveness and metastatic potential, prominent characteristics of NPC. Thus, we identify eight miRNAs differentially expressed in NPC and demonstrate the involvement of one in regulating genes involved in metastasis.
LinkOut: [PMID: 18390668]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29c-3p :: COL1A1    [ Functional MTI ]
Validation Method Immunohistochemistry , qRT-PCR
Conditions EEC , ECS
Disease endometrial carcinoma
Location of target site 3'UTR
Tools used in this research unknown
Original Description (Extracted from the article) ... Our study suggests that the interplay between transcriptional repressors of E-cadherin and miRNAs links EMT-activation (loss of epithelial characteristics and acquisition of mesenchymal features) and the maintenance of stemness in human ECS. A role for the TGFβ pathway as a modulator of EMT in human ECS is also suggested. ...

- Castilla, M. A. Moreno-Bueno, G. et al., 2010, The Journal of pathology.

Article - Castilla, M. A. Moreno-Bueno, G. et al.
- The Journal of pathology, 2010
Endometrial carcinosarcomas (ECSs) undergo a true epithelial-mesenchymal transition (EMT). The molecular determinants of the EMT in vivo are unclear, although a role for some miRNAs, mainly involving the miR-200 family, was recently suggested from in vitro cellular models. We analysed the microRNA (miRNA) signatures associated to EMT in human carcinosarcomas, and determined their relationships with EMT markers and repressors of E-cadherin transcription. The expression of E-, P- and N-cadherin, cadherin-11, p120, vimentin, SPARC, fascin and caveolin-1 was studied in a group of 76 ECS by immunohistochemistry. In addition, real-time PCR was used to measure the differences in the expression of 384 miRNAs, E-cadherin, cadherin-11, SPARC, SNAIL, ZEB1, ZEB2, TWIST-1, TCF4, TGFbeta1 and TGFbeta2 between the epithelial and mesenchymal components of 23 ECSs. A loss of epithelial characteristics, including cadherin switching and the acquisition of a mesenchymal phenotype, was accompanied by changes in the profile of miRNA expression and the up-regulation of all the E-cadherin repressors analysed. A greater than five-fold difference in the expression of 14 miRNAs between both neoplastic components was seen. Members of the miR-200 family were down-regulated in the mesenchymal part of the ECS. In addition, miR-23b and miR-29c, which are involved in the inhibition of mesenchymal markers, and miR-203, which is involved in the inhibition of cell stemness, were also down-regulated. Up-regulated miRNAs included miR-155, miR-369-5p, miR-370, miR-450a and miR-542-5p. These data suggest that in human ECS, the interplay between transcriptional repressors of E-cadherin and miRNAs provides a link between EMT-activation and the maintenance of stemness. Copyright (c) 2010 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
LinkOut: [PMID: 21038317]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
107 hsa-miR-29c-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000927 COL3A1 collagen, type III, alpha 1 2 1
MIRT000928 COL1A1 collagen, type I, alpha 1 3 2
MIRT001921 TDG thymine-DNA glycosylase 2 1
MIRT001922 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 3 2
MIRT001923 LAMC1 laminin, gamma 1 (formerly LAMB2) 2 1
MIRT001925 COL15A1 collagen, type XV, alpha 1 3 1
MIRT001926 COL4A2 collagen, type IV, alpha 2 2 1
MIRT001927 COL4A1 collagen, type IV, alpha 1 3 2
MIRT001928 COL1A2 collagen, type I, alpha 2 3 2
MIRT001929 GAPDH glyceraldehyde-3-phosphate dehydrogenase 2 1
MIRT003025 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 1
MIRT003028 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 3
MIRT003200 CDK6 cyclin-dependent kinase 6 4 1
MIRT003288 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 6 3
MIRT003289 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT003829 FBN1 fibrillin 1 3 1
MIRT003994 SRSF10 splicing factor, arginine/serine-rich 13A 2 1
MIRT005375 Col6a2 collagen, type VI, alpha 2 3 1
MIRT005376 Ctsk cathepsin K 3 1
MIRT005382 Mmp15 matrix metallopeptidase 15 3 1
MIRT005384 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005386 MMP24 matrix metallopeptidase 24 (membrane-inserted) 3 1
MIRT005388 Mmp24 matrix metallopeptidase 24 2 1
MIRT005525 FGG fibrinogen gamma chain 2 1
MIRT005526 FGB fibrinogen beta chain 2 1
MIRT005527 FGA fibrinogen alpha chain 2 1
MIRT006382 COL7A1 collagen, type VII, alpha 1 1 1
MIRT006383 COL21A1 collagen, type XXI, alpha 1 1 1
MIRT006384 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 1 1
MIRT006385 WNT4 wingless-type MMTV integration site family, member 4 1 1
MIRT006386 IGFBP1 insulin-like growth factor binding protein 1 1 1
MIRT006487 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 2 1
MIRT006489 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 1
MIRT020357 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT020358 MKL2 MKL/myocardin-like 2 1 1
MIRT020359 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT020360 NUMB numb homolog (Drosophila) 1 1
MIRT020361 ZNF45 zinc finger protein 45 1 1
MIRT020362 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT020363 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT020364 WSB2 WD repeat and SOCS box-containing 2 1 1
MIRT020365 PURG purine-rich element binding protein G 1 1
MIRT020366 CDV3 CDV3 homolog (mouse) 1 1
MIRT020367 JUN jun oncogene 1 1
MIRT020368 TIPRL TIP41, TOR signaling pathway regulator-like (S. cerevisiae) 1 1
MIRT020369 OIP5 Opa interacting protein 5 1 1
MIRT020370 SCAF11 splicing factor, arginine/serine-rich 2, interacting protein 1 1
MIRT020371 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT020372 R3HDM4 chromosome 19 open reading frame 22 1 1
MIRT020373 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT020374 FAM102B family with sequence similarity 102, member B 1 1
MIRT020375 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT020376 U2SURP U2-associated SR140 protein 1 1
MIRT020377 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT020378 BFAR bifunctional apoptosis regulator 1 1
MIRT020379 CDC42SE1 CDC42 small effector 1 1 1
MIRT020380 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT020381 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 1
MIRT020382 SOWAHC ankyrin repeat domain 57 1 1
MIRT020383 TXNDC16 thioredoxin domain containing 16 1 1
MIRT020384 ELMSAN1 chromosome 14 open reading frame 43 1 1
MIRT020385 IRGQ immunity-related GTPase family, Q 1 1
MIRT020386 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT020387 CEP68 centrosomal protein 68kDa 1 1
MIRT020388 NKIRAS2 NFKB inhibitor interacting Ras-like 2 1 1
MIRT020389 VEGFA vascular endothelial growth factor A 1 1
MIRT020390 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT020391 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1
MIRT020392 SPIN4 spindlin family, member 4 1 1
MIRT020393 KIAA0895 KIAA0895 1 1
MIRT020394 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT020395 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT020396 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT020397 CCNT2 cyclin T2 1 1
MIRT020398 DICER1 dicer 1, ribonuclease type III 1 1
MIRT020399 FREM2 FRAS1 related extracellular matrix protein 2 1 1
MIRT020400 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT020401 AMER1 family with sequence similarity 123B 1 1
MIRT020402 KIAA1549 KIAA1549 1 1
MIRT020403 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT020404 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT020405 HDGF hepatoma-derived growth factor 1 1
MIRT020406 MORF4L1 mortality factor 4 like 1 1 1
MIRT020407 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT020408 RAB30 RAB30, member RAS oncogene family 1 1
MIRT020409 SUV420H2 suppressor of variegation 4-20 homolog 2 (Drosophila) 1 1
MIRT020410 FAM105B family with sequence similarity 105, member B 1 1
MIRT020411 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT020412 KDM5B lysine (K)-specific demethylase 5B 1 1
MIRT020413 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 1 1
MIRT020414 RNF19A ring finger protein 19A 1 1
MIRT020415 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT020416 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT044232 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT044233 C15orf52 chromosome 15 open reading frame 52 1 1
MIRT044234 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT044235 CTC1 chromosome 17 open reading frame 68 1 1
MIRT044236 XK X-linked Kx blood group (McLeod syndrome) 1 1
MIRT044237 TIMM44 translocase of inner mitochondrial membrane 44 homolog (yeast) 1 1
MIRT044238 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT044239 CHIC2 cysteine-rich hydrophobic domain 2 1 1
MIRT044240 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT044241 STK19 serine/threonine kinase 19 1 1
MIRT044242 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT044243 BCKDHA branched chain keto acid dehydrogenase E1, alpha polypeptide 1 1
MIRT044244 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT044245 FAM126B family with sequence similarity 126, member B 1 1