Accession ID: MIRT000978 [miRNA, hsa-miR-15b-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15bLinkOut: [miRBase ]
Synonyms MIRN15B, hsa-mir-15b, miR-15b, MIR15B
Description Homo sapiens miR-15b stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15b-5p
Mature Sequence 20| UAGCAGCACAUCAUGGUUUACA |41
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' acAUUUGGUACUACACGACGAu 5'
            ||  | ||  ||||||||| 
Target 5' aaTATCCAATCCTGTGCTGCTa 3'
2518 - 2539 160.00 -16.80
2
miRNA  3' acAUUUGGUACUACACGACGAu 5'
            |:||  |||  ||| |||| 
Target 5' ccTGAA--ATGCAGTGGTGCTt 3'
2345 - 2364 128.00 -9.00
3
miRNA  3' acAUUUGGUA-CUACACGACGAu 5'
            ||||| ||  |||||| |:| 
Target 5' ttTAAACAATAAATGTGCAGTTt 3'
4290 - 4312 128.00 -9.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15b-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , , Other , Reporter assay
Conditions SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... As expected, this suppression was abolished by deleting part of the perfectly complementary sequences in the BCL2 3`-UTR (pGL3-mutBcl2-30UTR) which disrupts the interaction between miR-15b/miR-16 and BCL2 (Fig. 3d). Taken together, these results demonstrate that miR-15b and miR-16 directly inhibit BCL2 expression at posttranscriptional level through its 3`UTR. ...

- Xia, L. Zhang, D. Du, R. Pan, Y. Zhao, L. et al., 2008, Int J Cancer.

Article - Xia, L. Zhang, D. Du, R. Pan, Y. Zhao, L. et al.
- Int J Cancer, 2008
microRNAs are endogenous small noncoding RNAs that regulate gene expression negatively at posttranscriptional level. This latest addition to the complex gene regulatory circuitry revolutionizes our way to understanding physiological and pathological processes in the human body. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in gastric cancer cells. microRNA expression profiling revealed a limited set of microRNAs with altered expression in multidrug- resistant gastric cancer cell line SGC7901/VCR compared to its parental SGC7901 cell line. Among the downregulated microRNAs are miR-15b and miR-16, members of miR-15/16 family, whose expression was further validated by qRT-PCR. In vitro drug sensitivity assay demonstrated that overexpression of miR-15b or miR-16 sensitized SGC7901/VCR cells to anticancer drugs whereas inhibition of them using antisense oligonucleotides conferred SGC7901 cells MDR. The downregulation of miR-15b and miR-16 in SGC7901/VCR cells was concurrent with the upregulation of Bcl-2 protein. Enforced mir-15b or miR-16 expression reduced Bcl-2 protein level and the luciferase activity of a BCL2 3' untranslated region-based reporter construct in SGC7901/VCR cells, suggesting that BCL2 is a direct target of miR-15b and miR-16. Moreover, overexpression of miR-15b or miR-16 could sensitize SGC7901/VCR cells to VCR-induced apoptosis. Taken together, our findings suggest that miR-15b and miR-16 could play a role in the development of MDR in gastric cancer cells at least in part by modulation of apoptosis via targeting BCL2.
LinkOut: [PMID: 18449891]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15b-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Guo, C. J. Pan, Q. Li, D. G. Sun, H. Liu, B. W.
- J Hepatol, 2009
BACKGROUND/AIMS: To reveal the microRNA (miRNA) expression profile and related roles in rat HSCs during activation. METHODS: miRNA expression profiling was analyzed in quiescent and in culture-activated HSCs by microarray. The differentially expressed miRNAs, as verified by RT-PCR, were subjected to gene ontology (GO) analysis. Furthermore, the effects of miR-16 and miR-15b on the apoptosis of activated HSCs were investigated by Hoechst 33258, TUNEL staining and annexin-V/PI labeling flow cytometry. The underlying mechanism related to Bcl-2 and caspases was assessed. RESULTS: The upregulated and downregulated miRNAs in activated HSCs were 12 miRNAs and 9 miRNAs, respectively. The differential expression of miR-16, -15b, -122, -138, -143, and -140 was validated. High-enrichment GOs containing apoptosis-related targeted genes and miRNA-gene networks characterized by Bcl-2, which was targeted by the miR-15/16 family, uncovered the critical role of miR-16 and miR-15b in apoptosis. Restoring the intracellular miRNAs by miR-16 and miR-15b administration greatly reduced Bcl-2, and increased the expression of caspases 3, 8, and 9. Significantly elevated rates of apoptosis were then induced in activated HSCs. CONCLUSIONS: The activation of HSCs relate to 21 miRNAs. Among these, mir-15b and miR-16 may be essential for apoptosis by targeting Bcl-2 and the caspase signaling pathway.
LinkOut: [PMID: 19232449]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
172 hsa-miR-15b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000276 CCNE1 cyclin E1 4 2
MIRT000607 RECK reversion-inducing-cysteine-rich protein with kazal motifs 4 1
MIRT000978 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT003913 CCND1 cyclin D1 3 1
MIRT004274 VEGFA vascular endothelial growth factor A 2 1
MIRT004526 EIF4A1 eukaryotic translation initiation factor 4A1 2 1
MIRT006750 AXIN2 axin 2 1 1
MIRT006914 IFNG interferon, gamma 2 1
MIRT007001 PURA purine-rich element binding protein A 1 1
MIRT023483 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT046381 C5orf15 chromosome 5 open reading frame 15 1 1
MIRT046382 MTMR6 myotubularin related protein 6 1 1
MIRT046383 AP5S1 chromosome 20 open reading frame 29 1 1
MIRT046384 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT046385 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT046386 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 1 1
MIRT046387 CD44 CD44 molecule (Indian blood group) 1 1
MIRT046388 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT046389 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT046390 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT046391 AIG1 androgen-induced 1 1 1
MIRT046392 POU2F1 POU class 2 homeobox 1 1 1
MIRT046393 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT046394 RPS3A ribosomal protein S3A 1 1
MIRT046395 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT046396 SYNJ1 synaptojanin 1 1 1
MIRT046397 FAXC chromosome 6 open reading frame 168 1 1
MIRT046398 PLSCR4 phospholipid scramblase 4 1 1
MIRT046399 NUP210 nucleoporin 210kDa 1 1
MIRT046400 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT046401 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046402 PXMP2 peroxisomal membrane protein 2, 22kDa 1 1
MIRT046403 RLIM ring finger protein, LIM domain interacting 1 1
MIRT046404 TMC7 transmembrane channel-like 7 1 1
MIRT046405 FAM214A KIAA1370 1 1
MIRT046406 TMEM63B transmembrane protein 63B 1 1
MIRT046407 UACA uveal autoantigen with coiled-coil domains and ankyrin repeats 1 1
MIRT046408 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT046409 RPL27A ribosomal protein L27a 1 1
MIRT046410 WAC WW domain containing adaptor with coiled-coil 1 1
MIRT046411 CHMP7 CHMP family, member 7 1 1
MIRT046412 CDK4 cyclin-dependent kinase 4 1 1
MIRT046413 VDAC2 voltage-dependent anion channel 2 1 1
MIRT046414 PGD phosphogluconate dehydrogenase 1 1
MIRT046415 PIK3C2B phosphoinositide-3-kinase, class 2, beta polypeptide 1 1
MIRT046416 MPHOSPH9 M-phase phosphoprotein 9 1 1
MIRT046417 MPP1 membrane protein, palmitoylated 1, 55kDa 1 1
MIRT046418 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT046419 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT046420 MESDC2 mesoderm development candidate 2 1 1
MIRT046421 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT046422 RPS6 ribosomal protein S6 1 1
MIRT046423 TPD52 tumor protein D52 1 1
MIRT046424 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT046425 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT046426 TARDBP TAR DNA binding protein 1 1
MIRT046427 PHLDB3 pleckstrin homology-like domain, family B, member 3 1 1
MIRT046428 TNPO3 transportin 3 1 1
MIRT046429 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT046430 VPS13A vacuolar protein sorting 13 homolog A (S. cerevisiae) 1 1
MIRT046431 QRICH1 glutamine-rich 1 1 1
MIRT046432 SCCPDH saccharopine dehydrogenase (putative) 1 1
MIRT046433 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT046434 TCP1 t-complex 1 1 1
MIRT046435 DHFR dihydrofolate reductase 1 1
MIRT046436 DSG2 desmoglein 2 1 1
MIRT046437 EDC4 enhancer of mRNA decapping 4 1 1
MIRT046438 ECHS1 enoyl CoA hydratase, short chain, 1, mitochondrial 1 1
MIRT046439 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT046440 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT046441 TANGO6 transmembrane and coiled-coil domains 7 1 1
MIRT046442 FOXK1 forkhead box K1 1 1
MIRT046443 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT046444 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT046445 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT046446 CYBA cytochrome b-245, alpha polypeptide 1 1
MIRT046447 BEX1 brain expressed, X-linked 1 1 1
MIRT046448 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT046449 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT046450 CLCN6 chloride channel 6 1 1
MIRT046451 SEPT2 septin 2 1 1
MIRT046452 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT046453 HSPA8 heat shock 70kDa protein 8 1 1
MIRT046454 TSPAN3 tetraspanin 3 1 1
MIRT046455 CHEK1 CHK1 checkpoint homolog (S. pombe) 1 1
MIRT046456 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT046457 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT046458 ITGA6 integrin, alpha 6 1 1
MIRT046459 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 1 1
MIRT046460 MYCBP2 MYC binding protein 2 1 1
MIRT046461 LRRC41 leucine rich repeat containing 41 1 1
MIRT046462 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT046463 TERF2 telomeric repeat binding factor 2 1 1
MIRT046464 RPLP0 ribosomal protein, large, P0 1 1
MIRT046465 NUP214 nucleoporin 214kDa 1 1
MIRT046466 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) 1 1
MIRT046467 TXLNA taxilin alpha 1 1
MIRT046468 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT046469 SFT2D1 SFT2 domain containing 1 1 1
MIRT046470 FBXO30 F-box protein 30 1 1
MIRT046471 JAK1 Janus kinase 1 1 1
MIRT046472 TMEM43 transmembrane protein 43 1 1
MIRT046473 CKAP5 cytoskeleton associated protein 5 1 1
MIRT046474 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT046475 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT046476 TGOLN2 trans-golgi network protein 2 1 1
MIRT046477 HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) 1 1
MIRT046478 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT046479 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT046480 UVSSA KIAA1530 1 1
MIRT046481 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT046482 INADL InaD-like (Drosophila) 1 1
MIRT046483 ZNF217 zinc finger protein 217 1 1
MIRT046484 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT046485 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT046486 COIL coilin 1 1
MIRT046487 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT046488 UBE3B ubiquitin protein ligase E3B 1 1
MIRT046489 PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2 1 1
MIRT046490 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT046491 ZNRF1 zinc and ring finger 1 1 1
MIRT046492 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046493 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT046494 CHPF chondroitin polymerizing factor 1 1
MIRT046495 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT046496 NUP160 nucleoporin 160kDa 1 1
MIRT046497 MDH1 malate dehydrogenase 1, NAD (soluble) 1 1
MIRT046498 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT046499 SMAD7 SMAD family member 7 1 1
MIRT046500 RANBP10 RAN binding protein 10 1 1
MIRT046501 THRA thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) 1 1
MIRT046502 APRT adenine phosphoribosyltransferase 1 1
MIRT046503 QARS glutaminyl-tRNA synthetase 1 1
MIRT046504 MLLT4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 1 1
MIRT046505 STXBP1 syntaxin binding protein 1 1 1
MIRT046506 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 1 1
MIRT046507 MCPH1 microcephalin 1 1 1
MIRT046508 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT046509 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 1
MIRT046510 SUPT3H suppressor of Ty 3 homolog (S. cerevisiae) 1 1
MIRT046511 DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 1
MIRT046512 DENR density-regulated protein 1 1
MIRT046513 FAM115C family with sequence similarity 115, member C 1 1
MIRT046514 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT046515 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT046516 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT046517 LZTR1 leucine-zipper-like transcription regulator 1 1 1
MIRT046518 TRAPPC1 trafficking protein particle complex 1 1 1
MIRT046519 CPOX coproporphyrinogen oxidase 1 1
MIRT046520 RBM27 RNA binding motif protein 27 1 1
MIRT046521 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 1 1
MIRT046522 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT046523 EIF5B eukaryotic translation initiation factor 5B 1 1
MIRT046524 PRDX3 peroxiredoxin 3 1 1
MIRT046525 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT046526 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT046527 HIST2H3A histone cluster 2, H3a 1 1
MIRT046528 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT046529 FGF5 fibroblast growth factor 5 1 1
MIRT046530 XKR9 XK, Kell blood group complex subunit-related family, member 9 1 1
MIRT046531 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT046532 FANCC Fanconi anemia, complementation group C 1 1
MIRT046533 RNF149 ring finger protein 149 1 1
MIRT046534 IFNGR2 interferon gamma receptor 2 (interferon gamma transducer 1) 1 1
MIRT046535 TBRG4 transforming growth factor beta regulator 4 1 1
MIRT046536 AP4S1 adaptor-related protein complex 4, sigma 1 subunit 1 1
MIRT046537 ETNK1 ethanolamine kinase 1 1 1
MIRT046538 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT046539 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT046540 RPS3 ribosomal protein S3 1 1
MIRT046541 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT046542 PPT1 palmitoyl-protein thioesterase 1 1 1