Accession ID: MIRT001061 [miRNA, hsa-miR-218-5p :: EBP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-218-1LinkOut: [miRBase ]
Synonyms MIRN218-1, mir-218-1, MIR218-1
Description Homo sapiens miR-218-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-218-5p
Mature Sequence 25| UUGUGCUUGAUCUAACCAUGU |45
Evidence Experimental
Experiments Cloned
Putative hsa-miR-218-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EBP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDPX2, CHO2, CPX, CPXD
Description emopamil binding protein (sterol isomerase)
Transcript NM_006579    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EBP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EBP
(miRNA target sites are highlighted)
>EBP|NM_006579|3'UTR
   1 GGAGTGGTGGACCAGGCTCGAACACTGGCCGAGGAGGAGCTCTCTGCCTGCCAGAAGAGTCTAGTCCTGCTCCCACAGTT
  81 TGGAGGGACAAAGCTAATTGATCTGTCACACTCAGGCTCATGGGCAGGCACAAGAAGGGGAATAAAGGGGCTGTGTGAAG
 161 GCACTGCTGGGAGCCATTAGAACACAGATACAAGAGAAGCCAGGAGGTCTATGATGGTGACGATTTTTAAAATCAGGAAA
 241 TAAAAGATCTTGACTCTAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUACCAAU-CUAGUUCGUGUu 5'
            | | | | |: ||:||||| 
Target 5' tcAGGCTCATGGGCAGGCACAa 3'
112 - 133 135.00 -17.30
2
miRNA  3' uguaCCAAUCUA-GUUCGUGuu 5'
              || |: :|  |:||||  
Target 5' aaggGGCTGTGTGAAGGCACtg 3'
145 - 166 109.00 -7.10
3
miRNA  3' ugUACCAAUCUAGUUCGUGUu 5'
            :||| |:|| ||:|| |: 
Target 5' gaGTGG-TGGACCAGGCTCGa 3'
2 - 21 102.00 -14.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-218-5p :: EBP    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions SiHa
Tools used in this research RNA22 , miRBase Target Database
Original Description (Extracted from the article) ... After confirming the expression of mature miR-218 (Figure 4A),we found that only the LAMB3 transcript was significantly underexpressed in miR-218 expressing cells (Figure 4B and data not shown). Furthermore, Western blot analysis showed that miR-218 expression also greatly reduced the levels of the LAMB3 protein in SiHa cells ...

- Martinez, I. Gardiner, A. S. Board, K. F. et al., 2008, Oncogene.

Article - Martinez, I. Gardiner, A. S. Board, K. F. et al.
- Oncogene, 2008
Human papillomaviruses (HPVs) are involved in the pathogenesis of cancer of the cervix (CaCx). MicroRNA (miRNA) expression analysis using Ambion (Austin, TX, USA) arrays showed that three miRNAs were overexpressed and 24 underexpressed in cervical cell lines containing integrated HPV-16 DNA compared to the normal cervix. Furthermore, nine miRNAs were overexpressed and one underexpressed in integrated HPV-16 cell lines compared to the HPV-negative CaCx cell line C-33A. Based on microarray and/or quantitative real-time PCR and northern blot analyses, microRNA-218 (miR-218) was specifically underexpressed in HPV-positive cell lines, cervical lesions and cancer tissues containing HPV-16 DNA compared to both C-33A and the normal cervix. Expression of the E6 oncogene of high-risk HPV-16, but not that of low-risk HPV-6, reduced miR-218 expression, and conversely, RNA interference of E6/E7 oncogenes in an HPV-16-positive cell line increased miR-218 expression. We also demonstrate that the epithelial cell-specific marker LAMB3 is a target of miR-218. We also show that LAMB3 expression is increased in the presence of the HPV-16 E6 oncogene and this effect is mediated through miR-218. These findings may contribute to a better understanding of the molecular mechanisms involved in cervical carcinogenesis.
LinkOut: [PMID: 17998940]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
800 hsa-miR-218-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001057 MBNL2 muscleblind-like splicing regulator 2 3 1
MIRT001058 EFNA1 ephrin-A1 3 1
MIRT001059 NUP93 nucleoporin 93kDa 3 1
MIRT001060 MRPS27 mitochondrial ribosomal protein S27 3 1
MIRT001061 EBP emopamil binding protein (sterol isomerase) 3 1
MIRT001062 LAMB3 laminin, beta 3 4 3
MIRT003707 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 4 2
MIRT003708 LASP1 LIM and SH3 protein 1 6 4
MIRT003711 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 3 1
MIRT004030 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 4 1
MIRT004246 SP1 Sp1 transcription factor 3 1
MIRT004541 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 5 3
MIRT004542 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 3 1
MIRT005001 BIRC6 baculoviral IAP repeat containing 6 3 1
MIRT005004 ACTN1 actinin, alpha 1 4 2
MIRT005005 STAM2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 3 1
MIRT005067 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 2 1
MIRT006046 BIRC5 baculoviral IAP repeat containing 5 4 5
MIRT006047 GJA1 gap junction protein, alpha 1, 43kDa 4 2
MIRT006048 ROBO1 roundabout, axon guidance receptor, homolog 1 (Drosophila) 5 4
MIRT006105 RICTOR RPTOR independent companion of MTOR, complex 2 4 3
MIRT006748 SOST sclerostin 1 2
MIRT006749 SFRP2 secreted frizzled-related protein 2 3 3
MIRT006839 HOXB3 homeobox B3 1 1
MIRT007048 DKK2 dickkopf 2 homolog (Xenopus laevis) 3 2
MIRT007049 TOB1 transducer of ERBB2, 1 2 2
MIRT007145 CDK6 cyclin-dependent kinase 6 3 1
MIRT007258 BMI1 BMI1 polycomb ring finger oncogene 3 2
MIRT024210 COL1A1 collagen, type I, alpha 1 1 1
MIRT024211 EFNB2 ephrin-B2 1 1
MIRT024212 AHI1 Abelson helper integration site 1 1 2
MIRT024213 SLC38A1 solute carrier family 38, member 1 1 4
MIRT024214 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT024215 TPD52 tumor protein D52 1 2
MIRT024216 BLCAP bladder cancer associated protein 1 2
MIRT024217 SSH1 slingshot homolog 1 (Drosophila) 1 1
MIRT024218 RNF38 ring finger protein 38 1 1
MIRT024219 KLF9 Kruppel-like factor 9 1 1
MIRT024220 OLIG2 oligodendrocyte lineage transcription factor 2 1 1
MIRT024221 SERINC3 serine incorporator 3 1 1
MIRT024222 CNTNAP2 contactin associated protein-like 2 1 2
MIRT024223 FOXN2 forkhead box N2 1 3
MIRT024224 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT024225 KLHL13 kelch-like 13 (Drosophila) 1 1
MIRT024226 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT024227 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT024228 RIT1 Ras-like without CAAX 1 1 1
MIRT024229 CENPO centromere protein O 1 1
MIRT024230 KIAA1462 KIAA1462 1 1
MIRT024231 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT024232 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT024233 GLCE glucuronic acid epimerase 1 1
MIRT024234 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT024235 RNF219 ring finger protein 219 1 2
MIRT024236 BTF3L4 basic transcription factor 3-like 4 1 2
MIRT024237 RARA retinoic acid receptor, alpha 1 1
MIRT024238 FAM13B family with sequence similarity 13, member B 1 1
MIRT024239 GPM6A glycoprotein M6A 1 1
MIRT024240 BTBD7 BTB (POZ) domain containing 7 1 2
MIRT024241 RHBDD1 rhomboid domain containing 1 1 1
MIRT024242 COL4A1 collagen, type IV, alpha 1 1 2
MIRT024243 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT024244 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT024245 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT024246 POGK pogo transposable element with KRAB domain 1 1
MIRT024247 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT024248 TTC33 tetratricopeptide repeat domain 33 1 1
MIRT024249 DUSP18 dual specificity phosphatase 18 1 1
MIRT024250 THOC2 THO complex 2 1 1
MIRT024251 PUM2 pumilio homolog 2 (Drosophila) 1 3
MIRT024252 HECTD2 HECT domain containing E3 ubiquitin protein ligase 2 1 2
MIRT046980 ARL6 ADP-ribosylation factor-like 6 1 1
MIRT046981 ZNF711 zinc finger protein 711 1 1
MIRT046982 TTC21B tetratricopeptide repeat domain 21B 1 1
MIRT046983 SSR1 signal sequence receptor, alpha 1 1
MIRT046984 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT046985 MLX MAX-like protein X 1 1
MIRT046986 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT046987 KLHL31 kelch-like 31 (Drosophila) 1 1
MIRT046988 RPL12 ribosomal protein L12 1 1
MIRT046989 ARSG arylsulfatase G 1 1
MIRT046990 ZNF407 zinc finger protein 407 1 1
MIRT046991 RPS25 ribosomal protein S25 1 1
MIRT046992 RPS13 ribosomal protein S13 1 1
MIRT046993 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT046994 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT046995 DST dystonin 1 1
MIRT046996 EARS2 glutamyl-tRNA synthetase 2, mitochondrial 1 1
MIRT046997 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT046998 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT052918 HMGB1 high mobility group box 1 3 1
MIRT053004 LEF1 lymphoid enhancer-binding factor 1 2 1
MIRT053171 MITF microphthalmia-associated transcription factor 2 1
MIRT054127 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 3 1
MIRT054280 GLI2 GLI family zinc finger 2 3 1
MIRT054406 OTUD7B OTU domain containing 7B 3 1
MIRT054479 RUNX2 runt-related transcription factor 2 3 1
MIRT057227 GHITM growth hormone inducible transmembrane protein 1 1
MIRT075503 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT085093 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 3
MIRT090512 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 1 3
MIRT093078 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT112192 BTG2 BTG family, member 2 1 2
MIRT121011 FOXP1 forkhead box P1 1 1
MIRT125965 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 2
MIRT133542 GOLGA3 golgin A3 1 1
MIRT153185 MANBAL mannosidase, beta A, lysosomal-like 1 1
MIRT162929 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT191721 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT192837 BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 1 1
MIRT196099 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT256053 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 1 1
MIRT281712 ZNF609 zinc finger protein 609 1 1
MIRT286390 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT296591 FAM217B family with sequence similarity 217, member B 1 2
MIRT299659 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 2
MIRT303063 UGP2 UDP-glucose pyrophosphorylase 2 1 1
MIRT305607 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT312642 MFAP3 microfibrillar-associated protein 3 1 2
MIRT327205 ZFX zinc finger protein, X-linked 1 1
MIRT404930 TPM3 tropomyosin 3 1 1
MIRT409697 ANKRD27 ankyrin repeat domain 27 (VPS9 domain) 1 1
MIRT437967 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 3 1
MIRT437974 TFF1 trefoil factor 1 3 1
MIRT438024 EGFR epidermal growth factor receptor 2 2
MIRT438613 RET ret proto-oncogene 1 1
MIRT438682 SH3GL1 SH3-domain GRB2-like 1 4 2
MIRT439172 ZZEF1 zinc finger, ZZ-type with EF-hand domain 1 1 1
MIRT439173 ZXDC ZXD family zinc finger C 1 1
MIRT439174 ZSCAN5A zinc finger and SCAN domain containing 5A 1 1
MIRT439179 ZNF827 zinc finger protein 827 1 1
MIRT439184 ZNF776 zinc finger protein 776 1 1
MIRT439191 ZNF652 zinc finger protein 652 1 1
MIRT439193 ZNF608 zinc finger protein 608 1 1
MIRT439197 ZNF500 zinc finger protein 500 1 1
MIRT439198 ZNF496 zinc finger protein 496 1 1
MIRT439204 ZNF41 zinc finger protein 41 1 1
MIRT439205 ZNF3 zinc finger protein 3 1 1
MIRT439208 ZNF317 zinc finger protein 317 1 1
MIRT439232 ZFYVE26 zinc finger, FYVE domain containing 26 1 1
MIRT439237 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT439238 ZFAT zinc finger and AT hook domain containing 1 1
MIRT439250 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT439251 ZC3H8 zinc finger CCCH-type containing 8 1 1
MIRT439252 ZC3H13 zinc finger CCCH-type containing 13 1 1
MIRT439253 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT439254 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT439260 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT439267 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT439268 YTHDF1 YTH domain family, member 1 1 1
MIRT439279 XKR6 XK, Kell blood group complex subunit-related family, member 6 1 1
MIRT439283 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT439285 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT439290 WDR1 WD repeat domain 1 1 1
MIRT439292 WDHD1 WD repeat and HMG-box DNA binding protein 1 1 1
MIRT439296 WARS tryptophanyl-tRNA synthetase 1 2
MIRT439298 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT439304 VEZF1 vascular endothelial zinc finger 1 1 1
MIRT439305 VEGFC vascular endothelial growth factor C 1 1
MIRT439309 VCAN versican 1 1
MIRT439310 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT439322 USP47 ubiquitin specific peptidase 47 1 1
MIRT439326 USP34 ubiquitin specific peptidase 34 1 1
MIRT439336 USP22 ubiquitin specific peptidase 22 1 1
MIRT439340 UNC5B unc-5 homolog B (C. elegans) 1 1
MIRT439346 UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 1 1
MIRT439347 UCK2 uridine-cytidine kinase 2 1 1
MIRT439348 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT439354 UBP1 upstream binding protein 1 (LBP-1a) 1 1
MIRT439355 UBN2 ubinuclein 2 1 1
MIRT439357 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT439360 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT439363 UBE2G2 ubiquitin-conjugating enzyme E2G 2 1 1
MIRT439364 UBE2D3 ubiquitin-conjugating enzyme E2D 3 1 1
MIRT439368 UBAP2 ubiquitin associated protein 2 1 1
MIRT439376 TTYH3 tweety homolog 3 (Drosophila) 1 1
MIRT439377 TTI1 TELO2 interacting protein 1 1 1
MIRT439384 TSPAN18 tetraspanin 18 1 1
MIRT439385 TSPAN14 tetraspanin 14 1 1
MIRT439388 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT439389 TRIM65 tripartite motif containing 65 1 1
MIRT439390 TRIM5 tripartite motif containing 5 1 1
MIRT439391 TRIM39 tripartite motif containing 39 1 1
MIRT439393 TRAPPC1 trafficking protein particle complex 1 1 1
MIRT439394 TRAK2 trafficking protein, kinesin binding 2 1 1
MIRT439398 TPR translocated promoter region, nuclear basket protein 1 1
MIRT439402 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT439405 TNRC18 trinucleotide repeat containing 18 1 1
MIRT439417 TMPRSS3 transmembrane protease, serine 3 1 1
MIRT439432 TMEM222 transmembrane protein 222 1 1
MIRT439437 TMEM14A transmembrane protein 14A 1 1
MIRT439448 TMEM101 transmembrane protein 101 1 1
MIRT439451 TMCO6 transmembrane and coiled-coil domains 6 1 1
MIRT439453 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT439454 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT439455 TLN1 talin 1 1 1
MIRT439456 THUMPD1 THUMP domain containing 1 1 1
MIRT439459 THTPA thiamine triphosphatase 1 1
MIRT439464 TGFBRAP1 transforming growth factor, beta receptor associated protein 1 1 1
MIRT439467 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT439470 TFIP11 tuftelin interacting protein 11 1 1
MIRT439473 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT439475 TERF2 telomeric repeat binding factor 2 1 1
MIRT439476 TCP11L2 t-complex 11, testis-specific-like 2 1 1
MIRT439477 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT439482 TBC1D3G TBC1 domain family, member 3G 1 1
MIRT439483 TBC1D3C TBC1 domain family, member 3C 1 1
MIRT439487 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT439495 SYT11 synaptotagmin XI 1 1
MIRT439504 SUSD4 sushi domain containing 4 1 1
MIRT439507 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT439509 SULF2 sulfatase 2 1 1
MIRT439510 SUMF2 sulfatase modifying factor 2 1 1
MIRT439518 STRN4 striatin, calmodulin binding protein 4 1 1
MIRT439520 STK24 serine/threonine kinase 24 1 1
MIRT439523 STIP1 stress-induced-phosphoprotein 1 1 1
MIRT439527 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT439529 STARD4 StAR-related lipid transfer (START) domain containing 4 1 1
MIRT439531 ST6GAL1 ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 1 1
MIRT439533 ST3GAL2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 1 1
MIRT439541 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT439542 SRSF9 serine/arginine-rich splicing factor 9 1 1
MIRT439543 SRSF10 serine/arginine-rich splicing factor 10 1 1
MIRT439544 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT439546 SREBF2 sterol regulatory element binding transcription factor 2 1 1
MIRT439547 SRA1 steroid receptor RNA activator 1 1 1
MIRT439548 SQSTM1 sequestosome 1 1 1
MIRT439552 SPOPL speckle-type POZ protein-like 1 1
MIRT439553 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT439555 SPAG9 sperm associated antigen 9 1 1
MIRT439556 SP3 Sp3 transcription factor 1 1
MIRT439557 SP100 SP100 nuclear antigen 1 1
MIRT439561 SORT1 sortilin 1 1 1
MIRT439571 SNX4 sorting nexin 4 1 1
MIRT439573 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 1
MIRT439574 SNAPIN SNAP-associated protein 1 1
MIRT439575 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT439577 SNAI2 snail homolog 2 (Drosophila) 1 1
MIRT439578 SMYD3 SET and MYND domain containing 3 1 1
MIRT439585 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT439597 SLC45A3 solute carrier family 45, member 3 1 1
MIRT439601 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT439604 SLC39A10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT439607 SLC35F5 solute carrier family 35, member F5 1 1
MIRT439609 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT439610 SLC30A5 solute carrier family 30 (zinc transporter), member 5 1 1
MIRT439617 SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 1 1
MIRT439618 SLC20A2 solute carrier family 20 (phosphate transporter), member 2 1 1
MIRT439619 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT439622 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT439624 SLAIN2 SLAIN motif family, member 2 1 1
MIRT439627 SIRT6 sirtuin 6 1 1
MIRT439630 SIN3A SIN3 transcription regulator homolog A (yeast) 1 1
MIRT439635 SIKE1 suppressor of IKBKE 1 1 1
MIRT439637 SIK2 salt-inducible kinase 2 1 1
MIRT439639 SIAH2 siah E3 ubiquitin protein ligase 2 1 1
MIRT439640 SHROOM2 shroom family member 2 1 1
MIRT439641 SH3KBP1 SH3-domain kinase binding protein 1 1 1
MIRT439642 SH3BP1 SH3-domain binding protein 1 1 1
MIRT439647 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT439650 SFT2D2 SFT2 domain containing 2 1 1
MIRT439651 SFSWAP splicing factor, suppressor of white-apricot homolog (Drosophila) 1 1
MIRT439658 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT439668 SETD8 SET domain containing (lysine methyltransferase) 8 1 1
MIRT439672 SETBP1 SET binding protein 1 1 1
MIRT439676 SERPINB6 serpin peptidase inhibitor, clade B (ovalbumin), member 6 1 1
MIRT439679 SEPHS1 selenophosphate synthetase 1 1 1
MIRT439682 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT439683 SEMA5A sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A 1 1
MIRT439685 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT439687 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT439691 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT439694 SDC3 syndecan 3 1 1
MIRT439695 SDF4 stromal cell derived factor 4 1 1
MIRT439696 SCRN1 secernin 1 1 1
MIRT439702 SCAPER S-phase cyclin A-associated protein in the ER 1 1
MIRT439706 SARM1 sterile alpha and TIR motif containing 1 1 1
MIRT439707 SATB2 SATB homeobox 2 1 1
MIRT439712 SAP130 Sin3A-associated protein, 130kDa 1 1
MIRT439716 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT439718 S100A11 S100 calcium binding protein A11 1 1
MIRT439719 RUNX3 runt-related transcription factor 3 1 1
MIRT439721 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT439722 RSF1 remodeling and spacing factor 1 1 1
MIRT439723 RSBN1 round spermatid basic protein 1 1 1
MIRT439724 RREB1 ras responsive element binding protein 1 1 1
MIRT439726 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT439735 RPS18 ribosomal protein S18 1 1
MIRT439737 RPL8 ribosomal protein L8 1 1
MIRT439739 RPL3 ribosomal protein L3 1 1
MIRT439741 RPL21 ribosomal protein L21 1 1
MIRT439743 RPL15 ribosomal protein L15 1 1
MIRT439748 RORA RAR-related orphan receptor A 1 1
MIRT439752 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT439753 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT439756 RNF4 ring finger protein 4 1 1
MIRT439761 RNF170 ring finger protein 170 1 1
MIRT439764 RNF10 ring finger protein 10 1 1
MIRT439771 RHOB ras homolog family member B 1 1
MIRT439772 RHOA ras homolog family member A 1 1
MIRT439775 RFXAP regulatory factor X-associated protein 1 1
MIRT439779 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT439780 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT439781 RFC1 replication factor C (activator 1) 1, 145kDa 1 1
MIRT439782 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT439783 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT439785 REEP5 receptor accessory protein 5 1 1
MIRT439795 RCHY1 ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT439796 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 1
MIRT439797 RC3H1 ring finger and CCCH-type domains 1 1 1
MIRT439798 RBM6 RNA binding motif protein 6 1 1
MIRT439799 RBM5 RNA binding motif protein 5 1 1
MIRT439800 RBM4 RNA binding motif protein 4 1 1
MIRT439805 RBM18 RNA binding motif protein 18 1 1
MIRT439807 RBBP9 retinoblastoma binding protein 9 1 1
MIRT439814 RASEF RAS and EF-hand domain containing 1 1
MIRT439815 RASA4 RAS p21 protein activator 4 1 1
MIRT439816 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT439825 RANBP3 RAN binding protein 3 1 1
MIRT439827 RAI14 retinoic acid induced 14 1 1
MIRT439849 QRICH1 glutamine-rich 1 1 1
MIRT439851 PVRL2 poliovirus receptor-related 2 (herpesvirus entry mediator B) 1 1
MIRT439852 PURB purine-rich element binding protein B 1 1
MIRT439856 PUF60 poly-U binding splicing factor 60KDa 1 1
MIRT439860 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT439862 PTPRG protein tyrosine phosphatase, receptor type, G 1 1
MIRT439866 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT439868 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT439869 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT439870 PTK7 PTK7 protein tyrosine kinase 7 1 1
MIRT439872 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT439879 PTCH1 patched 1 1 1
MIRT439882 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT439884 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT439887 PRUNE prune homolog (Drosophila) 1 1
MIRT439890 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT439893 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT439895 PRKG1 protein kinase, cGMP-dependent, type I 1 1
MIRT439897 PRKDC protein kinase, DNA-activated, catalytic polypeptide 1 1
MIRT439901 PRKCA protein kinase C, alpha 1 1
MIRT439902 PRKAR1B protein kinase, cAMP-dependent, regulatory, type I, beta 1 1
MIRT439903 PRELID1 PRELI domain containing 1 1 1
MIRT439904 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit 1 1
MIRT439912 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT439914 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT439916 PPP2CB protein phosphatase 2, catalytic subunit, beta isozyme 1 1
MIRT439926 PPARD peroxisome proliferator-activated receptor delta 1 1
MIRT439927 PPARG peroxisome proliferator-activated receptor gamma 1 1
MIRT439930 POM121 POM121 transmembrane nucleoporin 1 1
MIRT439932 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT439934 POLR1A polymerase (RNA) I polypeptide A, 194kDa 1 1
MIRT439936 POLM polymerase (DNA directed), mu 1 1
MIRT439939 PNPLA8 patatin-like phospholipase domain containing 8 1 1
MIRT439943 PMPCB peptidase (mitochondrial processing) beta 1 1
MIRT439945 PLS3 plastin 3 1 1
MIRT439951 PLEKHA5 pleckstrin homology domain containing, family A member 5 1 1
MIRT439956 PKP4 plakophilin 4 1 1
MIRT439960 PKM pyruvate kinase, muscle 1 1
MIRT439966 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT439968 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT439969 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT439974 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 1
MIRT439980 PI4KA phosphatidylinositol 4-kinase, catalytic, alpha 1 1
MIRT439986 PHIP pleckstrin homology domain interacting protein 1 1
MIRT439987 PHF19 PHD finger protein 19 1 1
MIRT439988 PHC2 polyhomeotic homolog 2 (Drosophila) 1 1
MIRT439993 PGAP2 post-GPI attachment to proteins 2 1 1
MIRT439995 PFN2 profilin 2 1 1
MIRT440007 PDZD8 PDZ domain containing 8 1 1
MIRT440011 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT440012 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT440013 PDIA4 protein disulfide isomerase family A, member 4 1 1
MIRT440014 PDE6D phosphodiesterase 6D, cGMP-specific, rod, delta 1 1
MIRT440016 PDCD6 programmed cell death 6 1 1
MIRT440034 PCBP2 poly(rC) binding protein 2 1 1
MIRT440037 PARP4 poly (ADP-ribose) polymerase family, member 4 1 1
MIRT440039 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT440043 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT440044 PAPD7 PAP associated domain containing 7 1 1
MIRT440045 PANK3 pantothenate kinase 3 1 1
MIRT440051 PAM peptidylglycine alpha-amidating monooxygenase 1 1
MIRT440053 PALLD palladin, cytoskeletal associated protein 1 1
MIRT440057 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT440058 PACS1 phosphofurin acidic cluster sorting protein 1 1 1
MIRT440059 OXNAD1 oxidoreductase NAD-binding domain containing 1 1 1
MIRT440066 ODC1 ornithine decarboxylase 1 1 1
MIRT440073 NUP214 nucleoporin 214kDa 1 1
MIRT440078 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT440084 NUAK2 NUAK family, SNF1-like kinase, 2 1 1
MIRT440087 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT440088 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT440089 NRP1 neuropilin 1 1 1
MIRT440090 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT440097 NPTN neuroplastin 1 1
MIRT440098 NPLOC4 nuclear protein localization 4 homolog (S. cerevisiae) 1 1
MIRT440102 NOSIP nitric oxide synthase interacting protein 1 1
MIRT440104 NMRAL1 NmrA-like family domain containing 1 1 1
MIRT440105 NLRC5 NLR family, CARD domain containing 5 1 1
MIRT440110 NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 1 1
MIRT440114 NHP2 NHP2 ribonucleoprotein homolog (yeast) 1 1
MIRT440115 NHSL1 NHS-like 1 1 1
MIRT440120 NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 1 1
MIRT440124 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 1 1
MIRT440126 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 1 1
MIRT440130 NCOA4 nuclear receptor coactivator 4 1 1
MIRT440144 NAV1 neuron navigator 1 1 1
MIRT440152 NAPRT1 nicotinate phosphoribosyltransferase domain containing 1 1 1
MIRT440154 NANP N-acetylneuraminic acid phosphatase 1 1
MIRT440155 NAMPTL nicotinamide phosphoribosyltransferase-like 1 1
MIRT440156 NAMPT nicotinamide phosphoribosyltransferase 1 1
MIRT440162 MYO5B myosin VB 1 1
MIRT440163 MYO1D myosin ID 1 1
MIRT440165 MYO10 myosin X 1 1
MIRT440171 BLOC1S5 biogenesis of lysosomal organelles complex-1, subunit 5, muted 1 1
MIRT440197 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT440200 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT440204 MTMR4 myotubularin related protein 4 1 1
MIRT440205 MTMR3 myotubularin related protein 3 1 1
MIRT440206 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT440207 MTMR10 myotubularin related protein 10 1 1
MIRT440210 MSL1 male-specific lethal 1 homolog (Drosophila) 1 1
MIRT440211 MSC musculin 1 1
MIRT440212 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT440213 MRPS18A mitochondrial ribosomal protein S18A 1 1
MIRT440214 MRPL43 mitochondrial ribosomal protein L43 1 1
MIRT440216 MRPL13 mitochondrial ribosomal protein L13 1 1
MIRT440220 MORC2 MORC family CW-type zinc finger 2 1 1
MIRT440223 MNT MAX binding protein 1 1
MIRT440224 MMP16 matrix metallopeptidase 16 (membrane-inserted) 1 1
MIRT440229 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT440232 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT440239 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT440242 MID1 midline 1 (Opitz/BBB syndrome) 1 1
MIRT440249 MFN2 mitofusin 2 1 1
MIRT440251 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT440252 METTL8 methyltransferase like 8 1 1
MIRT440253 MEIS2 Meis homeobox 2 1 1
MIRT440263 MEA1 male-enhanced antigen 1 1 1
MIRT440264 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 1
MIRT440266 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT440270 MBOAT2 membrane bound O-acyltransferase domain containing 2 1 1
MIRT440271 MB21D2 Mab-21 domain containing 2 1 1
MIRT440274 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT440281 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT440282 MAP3K5 mitogen-activated protein kinase kinase kinase 5 1 1
MIRT440288 MAP3K11 mitogen-activated protein kinase kinase kinase 11 1 1
MIRT440289 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT440290 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT440293 MAML2 mastermind-like 2 (Drosophila) 1 1
MIRT440294 MAGED4B melanoma antigen family D, 4B 1 1
MIRT440299 LYRM2 LYR motif containing 2 1 1
MIRT440301 LYPD6B LY6/PLAUR domain containing 6B 1 1
MIRT440306 LTBP4 latent transforming growth factor beta binding protein 4 1 1
MIRT440307 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT440314 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT440322 LOXL2 lysyl oxidase-like 2 1 1
MIRT440328 LGR4 leucine-rich repeat containing G protein-coupled receptor 4 1 1
MIRT440336 LARS leucyl-tRNA synthetase 1 1
MIRT440337 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT440341 LANCL2 LanC lantibiotic synthetase component C-like 2 (bacterial) 1 1
MIRT440343 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT440348 KSR1 kinase suppressor of ras 1 1 1
MIRT440349 L3MBTL1 l(3)mbt-like 1 (Drosophila) 1 1
MIRT440353 PPP1R21 protein phosphatase 1, regulatory subunit 21 1 1
MIRT440359 KLHL21 kelch-like 21 (Drosophila) 1 1
MIRT440361 KLF12 Kruppel-like factor 12 1 1
MIRT440362 KLF10 Kruppel-like factor 10 1 1
MIRT440363 KIRREL3 kin of IRRE like 3 (Drosophila) 1 1
MIRT440370 KIF21B kinesin family member 21B 1 1
MIRT440373 KIF15 kinesin family member 15 1 1
MIRT440378 KIAA1644 KIAA1644 1 1
MIRT440379 KIAA1522 KIAA1522 1 1
MIRT440380 KIAA1549 KIAA1549 1 1
MIRT440381 KIAA1430 KIAA1430 1 1
MIRT440382 FAM214A family with sequence similarity 214, member A 1 1
MIRT440384 KIAA1161 KIAA1161 1 3
MIRT440385 KIAA1147 KIAA1147 1 1
MIRT440395 KIAA0319L KIAA0319-like 1 1
MIRT440399 KDM6A lysine (K)-specific demethylase 6A 1 1
MIRT440404 KCNMA1 potassium large conductance calcium-activated channel, subfamily M, alpha member 1 1 1
MIRT440405 KCNK6 potassium channel, subfamily K, member 6 1 2
MIRT440409 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 1 1
MIRT440415 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT440416 IWS1 IWS1 homolog (S. cerevisiae) 1 1
MIRT440419 ITPK1 inositol-tetrakisphosphate 1-kinase 1 1
MIRT440421 ITM2C integral membrane protein 2C 1 1
MIRT440422 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT440423 ITGAV integrin, alpha V 1 1
MIRT440435 IPO8 importin 8 1 1
MIRT440438 IPO5 importin 5 1 1
MIRT440446 INTS1 integrator complex subunit 1 1 1
MIRT440456 INHBA inhibin, beta A 1 1
MIRT440458 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT440459 IMMP2L IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) 1 1
MIRT440463 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT440464 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT440466 IFFO2 intermediate filament family orphan 2 1 1
MIRT440467 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT440471 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT440473 ICA1L islet cell autoantigen 1,69kDa-like 1 1
MIRT440478 HSPG2 heparan sulfate proteoglycan 2 1 1
MIRT440482 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT440485 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT440486 HPS4 Hermansky-Pudlak syndrome 4 1 1
MIRT440487 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT440490 HMGXB4 HMG box domain containing 4 1 1
MIRT440493 HMGA1 high mobility group AT-hook 1 1 1
MIRT440494 HMGB2 high mobility group box 2 1 1
MIRT440495 HLCS holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) 1 1
MIRT440496 HLA-E major histocompatibility complex, class I, E 1 1
MIRT440499 HLA-A major histocompatibility complex, class I, A 1 1
MIRT440500 HJURP Holliday junction recognition protein 1 1
MIRT440501 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT440505 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT440510 HFM1 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1 1
MIRT440518 HEATR1 HEAT repeat containing 1 1 1
MIRT440519 HDGF hepatoma-derived growth factor 1 1
MIRT440521 HDAC8 histone deacetylase 8 1 1
MIRT440525 HARBI1 harbinger transposase derived 1 1 1
MIRT440531 GSPT1 G1 to S phase transition 1 1 1
MIRT440535 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT440536 GPR157 G protein-coupled receptor 157 1 1
MIRT440539 GOLPH3L golgi phosphoprotein 3-like 1 1
MIRT440541 GOLGB1 golgin B1 1 1
MIRT440548 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT440550 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT440556 GNAS GNAS complex locus 1 1
MIRT440559 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT440560 GMDS GDP-mannose 4,6-dehydratase 1 1
MIRT440563 GLMN glomulin, FKBP associated protein 1 1
MIRT440564 GLIS3 GLIS family zinc finger 3 1 1
MIRT440566 GLG1 golgi glycoprotein 1 1 1
MIRT440568 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT440587 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT440589 GALNT18 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 1 1
MIRT440597 GAB2 GRB2-associated binding protein 2 1 1
MIRT440600 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT440605 TIMM10B fracture callus 1 homolog (rat) 1 1
MIRT440607 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT440611 FSHR follicle stimulating hormone receptor 1 1
MIRT440612 FRMD4A FERM domain containing 4A 1 1
MIRT440613 FOXO3 forkhead box O3 1 1
MIRT440615 FOXK1 forkhead box K1 1 1
MIRT440627 FNIP1 folliculin interacting protein 1 1 1
MIRT440628 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT440631 FNBP4 formin binding protein 4 1 1
MIRT440632 FN1 fibronectin 1 1 1
MIRT440639 FLNB filamin B, beta 1 1
MIRT440640 FLNA filamin A, alpha 1 1
MIRT440641 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT440645 FERMT2 fermitin family member 2 1 1
MIRT440650 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT440654 FBXO41 F-box protein 41 1 1
MIRT440661 FBXL5 F-box and leucine-rich repeat protein 5 1 1
MIRT440664 FBXL4 F-box and leucine-rich repeat protein 4 1 1
MIRT440669 FBN2 fibrillin 2 1 1
MIRT440671 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT440672 FAM83E family with sequence similarity 83, member E 1 1
MIRT440676 FAM65A family with sequence similarity 65, member A 1 1
MIRT440683 FAM172A family with sequence similarity 172, member A 1 1
MIRT440689 DENND6A DENN/MADD domain containing 6A 1 1
MIRT440691 FAM104A family with sequence similarity 104, member A 1 1
MIRT440692 FAM102B family with sequence similarity 102, member B 1 1
MIRT440695 FADS2 fatty acid desaturase 2 1 1
MIRT440698 FADS1 fatty acid desaturase 1 1 1
MIRT440702 EXT1 exostosin 1 1 1
MIRT440710 ERMP1 endoplasmic reticulum metallopeptidase 1 1 1
MIRT440711 ERLIN1 ER lipid raft associated 1 1 1
MIRT440718 EPC1 enhancer of polycomb homolog 1 (Drosophila) 1 1
MIRT440719 EPHB2 EPH receptor B2 1 1
MIRT440725 EMB embigin 1 1
MIRT440727 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 1 1
MIRT440733 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT440735 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT440737 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT440738 EIF3E eukaryotic translation initiation factor 3, subunit E 1 1
MIRT440739 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT440740 EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa 1 1
MIRT440741 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT440742 EIF2A eukaryotic translation initiation factor 2A, 65kDa 1 1
MIRT440743 EID2B EP300 interacting inhibitor of differentiation 2B 1 1
MIRT440746 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT440748 EEF1G eukaryotic translation elongation factor 1 gamma 1 1
MIRT440749 EEF1D eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) 1 1
MIRT440753 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT440776 DPYSL3 dihydropyrimidinase-like 3 1 1
MIRT440779 DPM2 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit 1 1
MIRT440784 DOK1 docking protein 1, 62kDa (downstream of tyrosine kinase 1) 1 1
MIRT440785 DOCK10 dedicator of cytokinesis 10 1 1
MIRT440786 DOCK9 dedicator of cytokinesis 9 1 1
MIRT440787 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT440788 DNPEP aspartyl aminopeptidase 1 1
MIRT440790 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT440791 DNHD1 dynein heavy chain domain 1 1 1
MIRT440795 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT440800 DNAJC11 DnaJ (Hsp40) homolog, subfamily C, member 11 1 1
MIRT440805 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 1 1
MIRT440806 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT440810 DLG1 discs, large homolog 1 (Drosophila) 1 1
MIRT440813 DIS3L2 DIS3 mitotic control homolog (S. cerevisiae)-like 2 1 1
MIRT440815 DICER1 dicer 1, ribonuclease type III 1 1
MIRT440818 DIABLO diablo, IAP-binding mitochondrial protein 1 1
MIRT440822 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT440823 DGKZ diacylglycerol kinase, zeta 1 1
MIRT440825 DGAT2 diacylglycerol O-acyltransferase 2 1 1
MIRT440829 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT440831 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 1
MIRT440833 DDX58 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 1 1
MIRT440837 DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 1 1
MIRT440843 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT440844 DCAKD dephospho-CoA kinase domain containing 1 1
MIRT440845 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT440846 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT440847 DCAF5 DDB1 and CUL4 associated factor 5 1 1
MIRT440849 DAPK1 death-associated protein kinase 1 1 1
MIRT440852 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT440853 CUX1 cut-like homeobox 1 1 1
MIRT440856 CUL3 cullin 3 1 1
MIRT440860 CTSB cathepsin B 1 1
MIRT440862 CTNNAL1 catenin (cadherin-associated protein), alpha-like 1 1 1
MIRT440863 CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa 1 1
MIRT440872 CSDC2 cold shock domain containing C2, RNA binding 1 1
MIRT440879 CREBBP CREB binding protein 1 1
MIRT440882 CREB3L1 cAMP responsive element binding protein 3-like 1 1 1
MIRT440884 CPOX coproporphyrinogen oxidase 1 1
MIRT440885 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT440904 COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1 1
MIRT440905 COX15 cytochrome c oxidase assembly homolog 15 (yeast) 1 1
MIRT440906 CORO1C coronin, actin binding protein, 1C 1 1
MIRT440908 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT440910 COPS2 COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) 1 1
MIRT440920 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT440921 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1 1
MIRT440932 CLSTN1 calsyntenin 1 1 1
MIRT440934 CLIP2 CAP-GLY domain containing linker protein 2 1 1
MIRT440937 CLEC16A C-type lectin domain family 16, member A 1 1
MIRT440940 CLCF1 cardiotrophin-like cytokine factor 1 1 1
MIRT440945 CHST5 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 1 1
MIRT440947 CHKB choline kinase beta 1 1
MIRT440949 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT440951 CHD2 chromodomain helicase DNA binding protein 2 1 1
MIRT440952 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT440966 CDK11A cyclin-dependent kinase 11A 1 1
MIRT440970 CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 1 1
MIRT440974 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 1 1
MIRT440978 CD163L1 CD163 molecule-like 1 1 1
MIRT440979 CD44 CD44 molecule (Indian blood group) 1 1
MIRT440982 CCNF cyclin F 1 1
MIRT440983 CCNL2 cyclin L2 1 1
MIRT440984 CCND3 cyclin D3 1 1
MIRT440989 CCDC80 coiled-coil domain containing 80 1 1
MIRT440990 CCDC71 coiled-coil domain containing 71 1 1
MIRT440996 CBX8 chromobox homolog 8 1 1
MIRT440999 CBX1 chromobox homolog 1 1 1
MIRT441000 CBL Cbl proto-oncogene, E3 ubiquitin protein ligase 1 1
MIRT441005 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT441006 CARD11 caspase recruitment domain family, member 11 1 1
MIRT441016 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT441032 C9orf3 chromosome 9 open reading frame 3 1 1
MIRT441035 COA1 cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae) 1 1
MIRT441037 SNHG15 small nucleolar RNA host gene 15 (non-protein coding) 1 1
MIRT441039 CCZ1B CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae) 1 1
MIRT441040 PXDC1 PX domain containing 1 1 1
MIRT441047 C3orf52 chromosome 3 open reading frame 52 1 1
MIRT441054 OSER1 chromosome 20 open reading frame 111 1 1
MIRT441064 C1orf159 chromosome 1 open reading frame 159 1 1
MIRT441065 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT441070 TMEM259 chromosome 19 open reading frame 6 1 1
MIRT441072 C19orf12 chromosome 19 open reading frame 12 1 1
MIRT441078 EMC7 ER membrane protein complex subunit 7 1 1
MIRT441085 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT441087 C11orf48 chromosome 11 open reading frame 48 1 1
MIRT441090 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT441091 BUD31 BUD31 homolog (S. cerevisiae) 1 1
MIRT441092 BZRAP1 benzodiazapine receptor (peripheral) associated protein 1 1 1
MIRT441100 BTBD2 BTB (POZ) domain containing 2 1 1
MIRT441104 BRF2 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like 1 1
MIRT441105 BRD7 bromodomain containing 7 1 1
MIRT441109 BMP1 bone morphogenetic protein 1 1 1
MIRT441111 BCL2L1 BCL2-like 1 1 1
MIRT441113 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT441114 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT441115 BCAS2 breast carcinoma amplified sequence 2 1 1
MIRT441127 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 1 1
MIRT441129 BAG6 BCL2-associated athanogene 6 1 1
MIRT441132 AXIN1 axin 1 1 1
MIRT441134 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT441135 AUTS2 autism susceptibility candidate 2 1 1
MIRT441136 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT441137 ATXN7L1 ataxin 7-like 1 1 1
MIRT441139 ATXN1 ataxin 1 1 1
MIRT441142 ATP6V1H ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H 1 1
MIRT441143 ATR ataxia telangiectasia and Rad3 related 1 1
MIRT441146 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT441148 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT441149 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT441154 ATP1B1 ATPase, Na+/K+ transporting, beta 1 polypeptide 1 1
MIRT441160 ATM ataxia telangiectasia mutated 1 1
MIRT441162 ATL2 atlastin GTPase 2 1 1
MIRT441168 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT441169 ATAD1 ATPase family, AAA domain containing 1 1 1
MIRT441170 ASB2 ankyrin repeat and SOCS box containing 2 1 1
MIRT441171 ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 1 1
MIRT441177 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT441178 ARPC1B actin related protein 2/3 complex, subunit 1B, 41kDa 1 1
MIRT441179 ARNT aryl hydrocarbon receptor nuclear translocator 1 1
MIRT441183 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT441191 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT441202 ARHGAP17 Rho GTPase activating protein 17 1 1
MIRT441214 APC adenomatous polyposis coli 1 1
MIRT441215 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT441218 ANXA2 annexin A2 1 1
MIRT441219 ANO6 anoctamin 6 1 1
MIRT441222 ANKRD52 ankyrin repeat domain 52 1 1
MIRT441229 ANKRD10 ankyrin repeat domain 10 1 1
MIRT441231 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT441233 ALMS1 Alstrom syndrome 1 1 1
MIRT441234 ANK3 ankyrin 3, node of Ranvier (ankyrin G) 1 1
MIRT441242 AKNAD1 AKNA domain containing 1 1 1
MIRT441246 AIG1 androgen-induced 1 1 1
MIRT441262 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT441263 ADARB1 adenosine deaminase, RNA-specific, B1 1 1
MIRT441264 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT441266 ADAM12 ADAM metallopeptidase domain 12 1 1
MIRT441268 ACTR8 ARP8 actin-related protein 8 homolog (yeast) 1 1
MIRT441277 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT441284 ACTB actin, beta 1 1
MIRT441292 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT441300 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT441301 ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 1 1
MIRT441305 ABHD2 abhydrolase domain containing 2 1 1
MIRT441307 ABHD11 abhydrolase domain containing 11 1 1
MIRT441308 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT441314 ABCA13 ATP-binding cassette, sub-family A (ABC1), member 13 1 1
MIRT441319 AAAS achalasia, adrenocortical insufficiency, alacrimia 1 1
MIRT441935 RIMKLB ribosomal modification protein rimK-like family member B 1 1
MIRT442989 CCDC74B coiled-coil domain containing 74B 1 1
MIRT443644 CCDC74A coiled-coil domain containing 74A 1 1
MIRT443964 FAM198B family with sequence similarity 198, member B 1 1
MIRT445186 CCDC88C coiled-coil domain containing 88C 1 1
MIRT446276 C17orf102 chromosome 17 open reading frame 102 1 1
MIRT448607 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT449642 CASS4 Cas scaffolding protein family member 4 1 1
MIRT449869 PRLR prolactin receptor 1 1
MIRT450075 ZNF354C zinc finger protein 354C 1 1
MIRT454153 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT464638 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT465843 TMEM64 transmembrane protein 64 1 1
MIRT465901 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT465981 TMEM189 transmembrane protein 189 1 1
MIRT471928 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 1
MIRT477510 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT497631 GLDN gliomedin 1 1
MIRT504295 KIAA1804 mixed lineage kinase 4 1 1
MIRT504743 MTPAP mitochondrial poly(A) polymerase 1 2
MIRT505658 SHMT1 serine hydroxymethyltransferase 1 (soluble) 1 2
MIRT506054 PPP6C protein phosphatase 6, catalytic subunit 1 2
MIRT511824 H2AFX H2A histone family, member X 1 2
MIRT513780 PAWR PRKC, apoptosis, WT1, regulator 1 3
MIRT522379 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 3
MIRT528440 SLC35C2 solute carrier family 35, member C2 1 2
MIRT537696 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT540923 OIP5 Opa interacting protein 5 1 1
MIRT541322 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT542685 SALL3 sal-like 3 (Drosophila) 1 1
MIRT545816 ZNF566 zinc finger protein 566 1 1
MIRT546781 RHOQ ras homolog family member Q 1 1
MIRT548088 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 2
MIRT548639 DAZAP1 DAZ associated protein 1 1 2
MIRT549014 CCDC6 coiled-coil domain containing 6 1 1
MIRT549535 NDUFA6 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa 1 2
MIRT551579 CDKN2AIP CDKN2A interacting protein 1 1
MIRT552986 VAT1 vesicle amine transport protein 1 homolog (T. californica) 1 1
MIRT555388 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 2
MIRT555478 POC1B-GALNT4 POC1B-GALNT4 readthrough 1 1
MIRT556442 LNPEP leucyl/cystinyl aminopeptidase 1 1
MIRT557471 GPRC5B G protein-coupled receptor, family C, group 5, member B 1 1
MIRT557707 GALNT4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) 1 1
MIRT558064 ETNK1 ethanolamine kinase 1 1 1
MIRT558637 CNNM2 cyclin M2 1 1
MIRT563206 ZNF813 zinc finger protein 813 1 1
MIRT566917 LMNB1 lamin B1 1 1
MIRT571835 PAIP2 poly(A) binding protein interacting protein 2 1 1
MIRT572503 KSR2 kinase suppressor of ras 2 1 1
MIRT575859 Rab1 RAB1, member RAS oncogene family 1 1
MIRT609072 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT610194 CD99 CD99 molecule 1 2
MIRT611737 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT611862 SRRM4 serine/arginine repetitive matrix 4 1 1
MIRT627765 RAB30 RAB30, member RAS oncogene family 1 1
MIRT638070 CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 1 1
MIRT642553 TEX9 testis expressed 9 1 1
MIRT648759 WDR66 WD repeat domain 66 1 1
MIRT650643 SEMA3G sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G 1 1
MIRT687000 RPL35 ribosomal protein L35 1 1
MIRT693897 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT698517 TFRC transferrin receptor (p90, CD71) 1 1
MIRT700032 RPP25 ribonuclease P/MRP 25kDa subunit 1 1
MIRT701262 NUP210 nucleoporin 210kDa 1 1
MIRT702881 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*