Accession ID: MIRT001061 [miRNA, hsa-miR-218-5p :: EBP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-218-1LinkOut: [miRBase ]
Synonyms MIRN218-1, mir-218-1, MIR218-1
Description Homo sapiens miR-218-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-218-5p
Mature Sequence 25| UUGUGCUUGAUCUAACCAUGU |45
Evidence Experimental
Experiments Cloned
Putative hsa-miR-218-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EBP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDPX2, CHO2, CPX, CPXD
Description emopamil binding protein (sterol isomerase)
Transcript NM_0065    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EBP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EBP
(miRNA target sites are highlighted)
>EBP|NM_0065|3'UTR
   1 TGAGGAGTGGTGGACCAGGCTCGAACACTGGCCGAGGAGGAGCTCTCTGCCTGCCAGAAGAGTCTAGTCCTGCTCCCACA
  81 GTTTGGAGGGACAAAGCTAATTGATCTGTCACACTCAGGCTCATGGGCAGGCACAAGAAGGGGAATAAAGGGGCTGTGTG
 161 AAGGCACTGCTGGGAGCCATTAGAACACAGATACAAGAGAAGCCAGGAGGTCTATGATGGTGACGATTTTTAAAATCAGG
 241 AAATAAAAGATCTTGACTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUACCAAU-CUAGUUCGUGUu 5'
            | | | | |: ||:||||| 
Target 5' tcAGGCTCATGGGCAGGCACAa 3'
115 - 136 135.00 -17.30
2
miRNA  3' uguaCCAAUCUA-GUUCGUGuu 5'
              || |: :|  |:||||  
Target 5' aaggGGCTGTGTGAAGGCACtg 3'
148 - 169 109.00 -7.10
3
miRNA  3' ugUACCAAUCUAGUUCGUGUu 5'
            :||| |:|| ||:|| |: 
Target 5' gaGTGG-TGGACCAGGCTCGa 3'
5 - 24 102.00 -14.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-218-5p :: EBP    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions SiHa
Tools used in this research RNA22 , miRBase Target Database
Original Description (Extracted from the article) ... After confirming the expression of mature miR-218 (Figure 4A),we found that only the LAMB3 transcript was significantly underexpressed in miR-218 expressing cells (Figure 4B and data not shown). Furthermore, Western blot analysis showed that miR-218 expression also greatly reduced the levels of the LAMB3 protein in SiHa cells ...

- Martinez, I. Gardiner, A. S. Board, K. F. et al., 2008, Oncogene.

Article - Martinez, I. Gardiner, A. S. Board, K. F. et al.
- Oncogene, 2008
Human papillomaviruses (HPVs) are involved in the pathogenesis of cancer of the cervix (CaCx). MicroRNA (miRNA) expression analysis using Ambion (Austin, TX, USA) arrays showed that three miRNAs were overexpressed and 24 underexpressed in cervical cell lines containing integrated HPV-16 DNA compared to the normal cervix. Furthermore, nine miRNAs were overexpressed and one underexpressed in integrated HPV-16 cell lines compared to the HPV-negative CaCx cell line C-33A. Based on microarray and/or quantitative real-time PCR and northern blot analyses, microRNA-218 (miR-218) was specifically underexpressed in HPV-positive cell lines, cervical lesions and cancer tissues containing HPV-16 DNA compared to both C-33A and the normal cervix. Expression of the E6 oncogene of high-risk HPV-16, but not that of low-risk HPV-6, reduced miR-218 expression, and conversely, RNA interference of E6/E7 oncogenes in an HPV-16-positive cell line increased miR-218 expression. We also demonstrate that the epithelial cell-specific marker LAMB3 is a target of miR-218. We also show that LAMB3 expression is increased in the presence of the HPV-16 E6 oncogene and this effect is mediated through miR-218. These findings may contribute to a better understanding of the molecular mechanisms involved in cervical carcinogenesis.
LinkOut: [PMID: 17998940]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
90 hsa-miR-218-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001057 MBNL2 muscleblind-like 2 (Drosophila) 3 1
MIRT001058 EFNA1 ephrin-A1 3 1
MIRT001059 NUP93 nucleoporin 93kDa 3 1
MIRT001060 MRPS27 mitochondrial ribosomal protein S27 3 1
MIRT001061 EBP emopamil binding protein (sterol isomerase) 3 1
MIRT001062 LAMB3 laminin, beta 3 4 1
MIRT003707 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 3 1
MIRT003708 LASP1 LIM and SH3 protein 1 5 2
MIRT003711 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 3 1
MIRT004030 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 4 1
MIRT004246 SP1 Sp1 transcription factor 3 1
MIRT004541 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 4 2
MIRT004542 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 3 1
MIRT005001 BIRC6 baculoviral IAP repeat-containing 6 3 1
MIRT005004 ACTN1 actinin, alpha 1 3 1
MIRT005005 STAM2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 3 1
MIRT005067 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 2 1
MIRT006046 BIRC5 baculoviral IAP repeat-containing 5 3 1
MIRT006047 GJA1 gap junction protein, alpha 1, 43kDa 3 1
MIRT006048 ROBO1 roundabout, axon guidance receptor, homolog 1 (Drosophila) 3 1
MIRT006105 RICTOR RPTOR independent companion of MTOR, complex 2 4 3
MIRT006748 SOST sclerostin 1 2
MIRT006749 SFRP2 secreted frizzled-related protein 2 1 2
MIRT006839 HOXB3 homeobox B3 1 1
MIRT007048 DKK2 dickkopf homolog 2 (Xenopus laevis) 1 1
MIRT007049 TOB1 transducer of ERBB2, 1 1 1
MIRT007145 CDK6 cyclin-dependent kinase 6 3 1
MIRT007258 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT024210 COL1A1 collagen, type I, alpha 1 1 1
MIRT024211 EFNB2 ephrin-B2 1 1
MIRT024212 AHI1 Abelson helper integration site 1 1 1
MIRT024213 SLC38A1 solute carrier family 38, member 1 1 1
MIRT024214 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT024215 TPD52 tumor protein D52 1 1
MIRT024216 BLCAP bladder cancer associated protein 1 1
MIRT024217 SSH1 slingshot homolog 1 (Drosophila) 1 1
MIRT024218 RNF38 ring finger protein 38 1 1
MIRT024219 KLF9 Kruppel-like factor 9 1 1
MIRT024220 OLIG2 oligodendrocyte lineage transcription factor 2 1 1
MIRT024221 SERINC3 serine incorporator 3 1 1
MIRT024222 CNTNAP2 contactin associated protein-like 2 1 1
MIRT024223 FOXN2 forkhead box N2 1 1
MIRT024224 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT024225 KLHL13 kelch-like 13 (Drosophila) 1 1
MIRT024226 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT024227 AKAP8 A kinase (PRKA) anchor protein 8 1 1
MIRT024228 RIT1 Ras-like without CAAX 1 1 1
MIRT024229 CENPO centromere protein O 1 1
MIRT024230 KIAA1462 KIAA1462 1 1
MIRT024231 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT024232 SREK1 splicing factor, arginine/serine-rich 12 1 1
MIRT024233 GLCE glucuronic acid epimerase 1 1
MIRT024234 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT024235 RNF219 ring finger protein 219 1 1
MIRT024236 BTF3L4 basic transcription factor 3-like 4 1 1
MIRT024237 RARA retinoic acid receptor, alpha 1 1
MIRT024238 FAM13B family with sequence similarity 13, member B 1 1
MIRT024239 GPM6A glycoprotein M6A 1 1
MIRT024240 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT024241 RHBDD1 rhomboid domain containing 1 1 1
MIRT024242 COL4A1 collagen, type IV, alpha 1 1 1
MIRT024243 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT024244 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT024245 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT024246 POGK pogo transposable element with KRAB domain 1 1
MIRT024247 TNIP2 TNFAIP3 interacting protein 2 1 1
MIRT024248 TTC33 tetratricopeptide repeat domain 33 1 1
MIRT024249 DUSP18 dual specificity phosphatase 18 1 1
MIRT024250 THOC2 THO complex 2 1 1
MIRT024251 PUM2 pumilio homolog 2 (Drosophila) 1 1
MIRT024252 HECTD2 HECT domain containing 2 1 1
MIRT046980 ARL6 ADP-ribosylation factor-like 6 1 1
MIRT046981 ZNF711 zinc finger protein 711 1 1
MIRT046982 TTC21B tetratricopeptide repeat domain 21B 1 1
MIRT046983 SSR1 signal sequence receptor, alpha 1 1
MIRT046984 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT046985 MLX MAX-like protein X 1 1
MIRT046986 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT046987 KLHL31 kelch-like 31 (Drosophila) 1 1
MIRT046988 RPL12 ribosomal protein L12 1 1
MIRT046989 ARSG arylsulfatase G 1 1
MIRT046990 ZNF407 zinc finger protein 407 1 1
MIRT046991 RPS25 ribosomal protein S25 1 1
MIRT046992 RPS13 ribosomal protein S13 1 1
MIRT046993 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT046994 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT046995 DST dystonin 1 1
MIRT046996 EARS2 glutamyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT046997 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT046998 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1