Accession ID: MIRT001061 [miRNA, hsa-miR-218 :: EBP, target gene]
miRNA Infomation
miRNA namehsa-miR-218
miRNA-target interaction network
Gene Information
Gene Symbol EBP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDPX2, CHO2, CPX, CPXD
Description emopamil binding protein (sterol isomerase)
Transcript NM_006579   LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa00100    Steroid biosynthesis - Homo sapiens (human)
hsa01100    Metabolic pathways - Homo sapiens (human)
Putative miRNA Targets on EBP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EBP
(miRNA target sites are highlighted)		 
>EBP|NM_006579|3'UTR
   1 TGAGGAGTGGTGGACCAGGCTCGAACACTGGCCGAGGAGGAGCTCTCTGCCTGCCAGAAGAGTCTAGTCCTGCTCCCACA
  81 GTTTGGAGGGACAAAGCTAATTGATCTGTCACACTCAGGCTCATGGGCAGGCACAAGAAGGGGAATAAAGGGGCTGTGTG
 161 AAGGCACTGCTGGGAGCCATTAGAACACAGATACAAGAGAAGCCAGGAGGTCTATGATGGTGACGATTTTTAAAATCAGG
 241 AAATAAAAGATCTTGACTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-218 :: EBP    [ Non-Functional MTI ]
Validation Method qRT-PCR , Western blot
Conditions SiHa
Tools used in this research RNA22, miRBase Target Database
Original Description (Extracted from the article) ... After confirming the expression of mature miR-218 (Figure 4A),we found that only the LAMB3 transcript was significantly underexpressed in miR-218 expressing cells (Figure 4B and data not shown). Furthermore, Western blot analysis showed that miR-218 expression also greatly reduced the levels of the LAMB3 protein in SiHa cells ...

- Martinez, I. Gardiner, A. S. Board, K. F. et al., 2008, Oncogene.
Article - Martinez, I. Gardiner, A. S. Board, K. F. et al.
- Oncogene, 2008
Human papillomaviruses (HPVs) are involved in the pathogenesis of cancer of the cervix (CaCx). MicroRNA (miRNA) expression analysis using Ambion (Austin, TX, USA) arrays showed that three miRNAs were overexpressed and 24 underexpressed in cervical cell lines containing integrated HPV-16 DNA compared to the normal cervix. Furthermore, nine miRNAs were overexpressed and one underexpressed in integrated HPV-16 cell lines compared to the HPV-negative CaCx cell line C-33A. Based on microarray and/or quantitative real-time PCR and northern blot analyses, microRNA-218 (miR-218) was specifically underexpressed in HPV-positive cell lines, cervical lesions and cancer tissues containing HPV-16 DNA compared to both C-33A and the normal cervix. Expression of the E6 oncogene of high-risk HPV-16, but not that of low-risk HPV-6, reduced miR-218 expression, and conversely, RNA interference of E6/E7 oncogenes in an HPV-16-positive cell line increased miR-218 expression. We also demonstrate that the epithelial cell-specific marker LAMB3 is a target of miR-218. We also show that LAMB3 expression is increased in the presence of the HPV-16 E6 oncogene and this effect is mediated through miR-218. These findings may contribute to a better understanding of the molecular mechanisms involved in cervical carcinogenesis.
LinkOut: [PMID: 17998940]