Accession ID: MIRT001167 [miRNA, hsa-miR-135a-5p :: NR3C2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-135a-1LinkOut: [miRBase ]
Synonyms MIRN135-1, MIRN135A1, MIR135A1
Description Homo sapiens miR-135a-1 stem-loop
Comment miR-135a was first identified by cloning studies in mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-135a-5p
Mature Sequence 17| UAUGGCUUUUUAUUCCUAUGUGA |39
Evidence Experimental
Experiments Cloned
Putative hsa-miR-135a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NR3C2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MCR, MLR, MR, NR3C2VIT
Description nuclear receptor subfamily 3, group C, member 2
Transcript NM_000901    LinkOut: [ RefSeq ]
Other Transcripts NM_001166104   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NR3C2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NR3C2
(miRNA target sites are highlighted)
>NR3C2|NM_000901|3'UTR
   1 CTGCCCGCTGCCCAGAAGAACTTTGCCTTAAGTTTCCCTGTGTTGTTCCACACCCAGAAGGACCCAAGAAAACCTGTTTT
  81 TAACATGTGATGGTTGATTCACACTTGTTCAACAGTTTCTCAAGTTTAAAGTCATGTCAGAGGTTTGGAGCCGGGAAAGC
 161 TGTTTTTCCGTGGATTTGGCGAGACCAGAGCAGTCTGAAGGATTCCCCACCTCCAATCCCCCAGCGCTTAGAAACATGTT
 241 CCTGTTCCTCGGGATGAAAAGCCATATCTAGTCAATAACTCTGATTTTGATATTTTCACAGATGGAAGAAGTTTTAACTA
 321 TGCCGTGTAGTTTCTGGTATCGTTCGCTTGTTTTAAAAGGGTTCAAGGACTAACGAACGTTTTAAAGCTTACCCTTGGTT
 401 TGCACATAAAACGTATAGTCAATATGGGGCATTAATATTCTTTTGTTATTAAAAAAACACAAAAAAATAATAAAAAAATA
 481 TATACAGATTCCTGTTGTGTAATAACAGAACTCGTGGCGTGGGGCAGCAGCTGCCTCTGAGCCCTCGCTCGTCCACGGTC
 561 TTCTGCATCACTGGTATACACACTCGTTAGCGTCCATTTCTTATTTAATTAGAATGGATAAGATGATGTTAAATGCCTTG
 641 GTTTGATTTCTAGTATCTATTGTGTTGGCTTTACAAATAATTTTTTGCAGTCTTTTGCTGTGCTGTACATTACTGTATGT
 721 ATAAATTATGAAGGACCTGAAATAAGGTATAAGGATCTTTTGTAAATGAGACACATACAAAAAAAATCTTTAATGGTTAA
 801 TAGGATGAATGGGAAAGTATTTTTGAAAGAATTCTATTTTGCTGGAGACTATTTAAGTACTATCTTTGTCTAAACAAGGT
 881 AATTTTTTTTTGTAAAGTGCAATGTCCTGCATGCATAATGAACCGTTTACAGTGTATTTAAGAAAGGGAAAGCTGTGCCT
 961 TTTTTAGCTTCATATCTAATTTACCATTATTTTACAGTCTCTGTTGTAAATAACCACACTGAAACCTCTTCGGTTGTCTT
1041 GAAACCTTTCTACTTTTTCTGTACTTTTTGTTTTGTTCTTGGTCTCCCGCTTGGGGCATTTGTGGGACTCCAGCACGTTT
1121 TCTGGCTTCTGCTTCATCCTGCTCCATCGGGGAATGACACACTGCGGTGTCTGCAGCTCCTGGAAGGTGTCATTTGACAA
1201 CACATGTGGGAGAGGAGGTCCTTGGAGTGCTGCAGCTTTGGGAAAGCTGCCTCGTTTCCCTTTTCCTCTAGAAGCAGAAC
1281 CAGCTCTACGAGAGTGAGACTGGGAACTTGATGGCTCAGAGAGCATCTTTTCCTCCCATTTTAGAAAATCAGATTTTCTC
1361 CTGTGGGAAAAAAAAATTCCATGCACTCTCTCTCTGTTAAAGATCAGCTATTCCCTTCTGATCTTGGAAAGAGGTTCTGC
1441 ACTCCTGGAACCGGTCACAGGAACGCACAGATCATGGCAGGATGCGCTGGGACGGCCCATCTTGGCAAGGTTCAGTCTGA
1521 ATGGCATGGAGACCGGGAGATAGAGGGGTTTTAGATTTTTAAAAGGTAGGTTTTAAAAATAAGTTTTATACATAAACAGT
1601 TTTGGAGAAAAATTACAGATCATATAAGCAAGACAGTGGCACTAAAATGTTTAATTCATTAATCTGTTTGTTTGGCACTG
1681 ATGCAATGTATGGCTTTTCTCTTGCCCCAAATCACAAACATATGTATCTTTGGGGAAACTAACAATATGATTGCACTAAA
1761 TAAACTACTTTGAATAGAGGCCAAATTAATCTTTTAAAAATGATGATAATCATCAGGTTTACTCAGTGAAATCATATTAA
1841 TTATTTTCCAAAATCTAAAAGCTGTAGCTGGAGAAGCCCATGGCCACGAGGAAGCAGCAATTAATTAGATCAACACTTTT
1921 CTCCAGGGTTCACCATGCAGGCAACATTACCTTGTCTTTCAAAAGACACCTGCCTTATGCAAGGGGAAACCTGTGAAAGC
2001 TGCACTCAGAGGGAGGAGTTTTTCTTACATAATTTGCAATTTCAGGAATTTAATTTATAGGCAGATCTTTAAATACAGTC
2081 AACTTACGGTGCACAGTAATATGAAAGCCACACTTTGAAGGTAATAAATACACAGCATGCAGACTGGGAGTTGCTAGCAA
2161 ACAAATGGCTTACTTACAAAAGCAGCTTTTAGTTCAGACTTAGTTTTTATAAAATGGGAATTCTGACTTACTTAACCAGG
2241 TTTGGGATGGAGATGGTCTGCATCAGCTTTTTGTATTAACAAAGTTACTGGCTCTTTGTGTGTCTCCAGGTAACTTTGCT
2321 TGATTAAACAGCAAAGCCATATTCTAAATTCACTGTTGAATGCCTGTCCCAGTCCAAATTGTCTGTCTGCTCTTATTTTT
2401 GTACCATATTGCTCTTAAAAATCTTGGTTTGGTACAGTTCATAATTCACCAAAAGTTCATATAATTTAAAGAAACACTAA
2481 ATTAGTTTAAAATGAAGCAATTTATATCTTTATGCAAAAACATATGTCTGTCTTTGCAAAGGACTGTAAGCAGATTACAA
2561 TAAATCCTTTACTTTAATCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguGUAUCCUUAUUUUUCGGUAu 5'
             | | ||:||:||||||||| 
Target 5' gttCCTCGGGATGAAAAGCCATa 3'
244 - 266 176.00 -20.00
2
miRNA  3' agUGUAUCCUUAU-UUUUCGGUau 5'
            :|| || |||| :|||||||  
Target 5' gtGCACAGTAATATGAAAGCCAca 3'
2089 - 2112 153.00 -12.30
3
miRNA  3' agUGUAUC---CUUAUU-----UUUCGGUAu 5'
            || | |   || |||     |||||||| 
Target 5' taACTTTGCTTGATTAAACAGCAAAGCCATa 3'
2311 - 2341 153.00 -10.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-135a-5p :: NR3C2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Other
Conditions HeLa
Disease Hypertension;
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-124 and miR-135a suppress NR3C2// The binding of miR-124 and miR-135a to NR3C2 3'UTR contributes to the translational, not transcriptional regulation of the gene ...

- Sober, S. Laan, M. Annilo, T., 2010, Biochem Biophys Res Commun.

Article - Sober, S. Laan, M. Annilo, T.
- Biochem Biophys Res Commun, 2010
MicroRNAs (miRNAs) comprise a post-transcriptional layer of gene regulation shown to be involved in diverse physiological processes. We aimed to study whether regulatory networks that determine susceptibility to hypertension may involve a miRNA component. Screening of loci, involved in renal water-salt balance regulation, highlighted the mineralocorticoid receptor gene NR3C2 as a potential target for several miRNAs. A luciferase assay demonstrated that miR-124 and miR-135a suppress NR3C2 3'UTR reporter construct activity 1.5- and 2.2-fold, respectively. As the tested miRNAs did not reduce the levels of target mRNA, we suggest that the binding of miR-124 and miR-135a to NR3C2 3'UTR contributes to the translational, not transcriptional regulation of the gene. Co-expression of two different miRNAs did not increase the repression of the reporter gene, indicating no additive or synergistic effects between the tested miRNAs. Our results demonstrate that by repressing the mineralocorticoid receptor gene NR3C2, miR-124 and miR-135a could participate in the regulation of renin-angiotensin-aldosterone system and thereby might be involved in blood pressure regulation.
LinkOut: [PMID: 19944075]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
74 hsa-miR-135a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000707 JAK2 Janus kinase 2 4 2
MIRT001167 NR3C2 nuclear receptor subfamily 3, group C, member 2 3 1
MIRT001941 APC adenomatous polyposis coli 3 1
MIRT006793 HOXA10 homeobox A10 3 2
MIRT007105 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 4
MIRT035578 ALOX5AP arachidonate 5-lipoxygenase-activating protein 1 1
MIRT052972 SMAD5 SMAD family member 5 3 1
MIRT052973 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 3 1
MIRT052974 STAT6 signal transducer and activator of transcription 6, interleukin-4 induced 3 1
MIRT054181 MTSS1 metastasis suppressor 1 3 1
MIRT054402 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 3 1
MIRT054784 VLDLR very low density lipoprotein receptor 3 1
MIRT130082 TXNIP thioredoxin interacting protein 1 4
MIRT181057 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT289437 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT437827 IRS2 insulin receptor substrate 2 1 1
MIRT438099 APC adenomatous polyposis coli 2 1
MIRT438131 HTR1A 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled 1 1
MIRT438132 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT438184 SIAH1 siah E3 ubiquitin protein ligase 1 1 1
MIRT438304 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT445159 VNN3 vanin 3 1 1
MIRT445282 GAGE1 G antigen 1 1 1
MIRT447348 KIF6 kinesin family member 6 1 1
MIRT447762 TTLL7 tubulin tyrosine ligase-like family, member 7 1 1
MIRT448597 PCP4L1 Purkinje cell protein 4 like 1 1 1
MIRT449402 TOX4 TOX high mobility group box family member 4 1 1
MIRT449578 APOA1 apolipoprotein A-I 1 1
MIRT449683 CDR1 cerebellar degeneration-related protein 1, 34kDa 1 1
MIRT450057 IL17RA interleukin 17 receptor A 1 1
MIRT471859 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT497603 KIAA1958 KIAA1958 1 1
MIRT497851 GATA6 GATA binding protein 6 1 2
MIRT500554 XBP1P1 X-box binding protein 1 pseudogene 1 1 4
MIRT503997 NHS Nance-Horan syndrome (congenital cataracts and dental anomalies) 1 1
MIRT511178 MARCKS myristoylated alanine-rich protein kinase C substrate 1 2
MIRT519598 ZNF805 zinc finger protein 805 1 1
MIRT529264 TRIM4 tripartite motif containing 4 1 2
MIRT537137 GNL1 guanine nucleotide binding protein-like 1 1 1
MIRT537983 DPP8 dipeptidyl-peptidase 8 1 1
MIRT544165 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT545421 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT549354 ARC activity-regulated cytoskeleton-associated protein 1 1
MIRT551665 KIAA1143 KIAA1143 1 2
MIRT562212 HMGB2 high mobility group box 2 1 1
MIRT562592 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT563734 ZNF107 zinc finger protein 107 1 2
MIRT570774 ZNF468 zinc finger protein 468 1 1
MIRT571501 ZNF846 zinc finger protein 846 1 1
MIRT613222 CCDC85C coiled-coil domain containing 85C 1 2
MIRT625940 SCYL3 SCY1-like 3 (S. cerevisiae) 1 1
MIRT632355 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 1 1
MIRT636157 TNPO2 transportin 2 1 1
MIRT639987 PIAS4 protein inhibitor of activated STAT, 4 1 1
MIRT641255 CENPN centromere protein N 1 1
MIRT643452 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT654529 RAB3GAP2 RAB3 GTPase activating protein subunit 2 (non-catalytic) 1 1
MIRT656627 LRRC15 leucine rich repeat containing 15 1 1
MIRT657622 GPX8 glutathione peroxidase 8 (putative) 1 1
MIRT674957 PEX2 peroxisomal biogenesis factor 2 1 1
MIRT681951 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682649 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT686789 AZF1 azoospermia factor 1 1 1
MIRT692904 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT695386 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT698011 TSC22D2 TSC22 domain family, member 2 1 1
MIRT699505 SKIL SKI-like oncogene 1 1
MIRT702125 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT704725 CEP135 centrosomal protein 135kDa 1 1
MIRT711158 WDR82P1 WD repeat domain 82 pseudogene 1 1 1
MIRT711839 AMOTL2 angiomotin like 2 1 1
MIRT712664 PCTP phosphatidylcholine transfer protein 1 1
MIRT714431 SNED1 sushi, nidogen and EGF-like domains 1 1 1
MIRT718937 TRIM66 tripartite motif containing 66 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*