Accession ID: MIRT001167 [miRNA, hsa-miR-135a-5p :: NR3C2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-135a-1LinkOut: [miRBase ]
Synonyms MIRN135-1, MIRN135A1, MIR135A1
Description Homo sapiens miR-135a-1 stem-loop
Comment miR-135a was first identified by cloning studies in mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-135a-5p
Mature Sequence 17| UAUGGCUUUUUAUUCCUAUGUGA |39
Evidence Experimental
Experiments Cloned
Putative hsa-miR-135a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NR3C2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MCR, MLR, MR, NR3C2VIT
Description nuclear receptor subfamily 3, group C, member 2
Transcript NM_0009    LinkOut: [ RefSeq ]
Other Transcripts NM_0011661   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NR3C2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NR3C2
(miRNA target sites are highlighted)
>NR3C2|NM_0009|3'UTR
   1 CTGCCCGCTGCCCAGAAGAACTTTGCCTTAAGTTTCCCTGTGTTGTTCCACACCCAGAAGGACCCAAGAAAACCTGTTTT
  81 TAACATGTGATGGTTGATTCACACTTGTTCAACAGTTTCTCAAGTTTAAAGTCATGTCAGAGGTTTGGAGCCGGGAAAGC
 161 TGTTTTTCCGTGGATTTGGCGAGACCAGAGCAGTCTGAAGGATTCCCCACCTCCAATCCCCCAGCGCTTAGAAACATGTT
 241 CCTGTTCCTCGGGATGAAAAGCCATATCTAGTCAATAACTCTGATTTTGATATTTTCACAGATGGAAGAAGTTTTAACTA
 321 TGCCGTGTAGTTTCTGGTATCGTTCGCTTGTTTTAAAAGGGTTCAAGGACTAACGAACGTTTTAAAGCTTACCCTTGGTT
 401 TGCACATAAAACGTATAGTCAATATGGGGCATTAATATTCTTTTGTTATTAAAAAAACACAAAAAAATAATAAAAAAATA
 481 TATACAGATTCCTGTTGTGTAATAACAGAACTCGTGGCGTGGGGCAGCAGCTGCCTCTGAGCCCTCGCTCGTCCACGGTC
 561 TTCTGCATCACTGGTATACACACTCGTTAGCGTCCATTTCTTATTTAATTAGAATGGATAAGATGATGTTAAATGCCTTG
 641 GTTTGATTTCTAGTATCTATTGTGTTGGCTTTACAAATAATTTTTTGCAGTCTTTTGCTGTGCTGTACATTACTGTATGT
 721 ATAAATTATGAAGGACCTGAAATAAGGTATAAGGATCTTTTGTAAATGAGACACATACAAAAAAAATCTTTAATGGTTAA
 801 TAGGATGAATGGGAAAGTATTTTTGAAAGAATTCTATTTTGCTGGAGACTATTTAAGTACTATCTTTGTCTAAACAAGGT
 881 AATTTTTTTTTGTAAAGTGCAATGTCCTGCATGCATAATGAACCGTTTACAGTGTATTTAAGAAAGGGAAAGCTGTGCCT
 961 TTTTTAGCTTCATATCTAATTTACCATTATTTTACAGTCTCTGTTGTAAATAACCACACTGAAACCTCTTCGGTTGTCTT
1041 GAAACCTTTCTACTTTTTCTGTACTTTTTGTTTTGTTCTTGGTCTCCCGCTTGGGGCATTTGTGGGACTCCAGCACGTTT
1121 TCTGGCTTCTGCTTCATCCTGCTCCATCGGGGAATGACACACTGCGGTGTCTGCAGCTCCTGGAAGGTGTCATTTGACAA
1201 CACATGTGGGAGAGGAGGTCCTTGGAGTGCTGCAGCTTTGGGAAAGCTGCCTCGTTTCCCTTTTCCTCTAGAAGCAGAAC
1281 CAGCTCTACGAGAGTGAGACTGGGAACTTGATGGCTCAGAGAGCATCTTTTCCTCCCATTTTAGAAAATCAGATTTTCTC
1361 CTGTGGGAAAAAAAAATTCCATGCACTCTCTCTCTGTTAAAGATCAGCTATTCCCTTCTGATCTTGGAAAGAGGTTCTGC
1441 ACTCCTGGAACCGGTCACAGGAACGCACAGATCATGGCAGGATGCGCTGGGACGGCCCATCTTGGCAAGGTTCAGTCTGA
1521 ATGGCATGGAGACCGGGAGATAGAGGGGTTTTAGATTTTTAAAAGGTAGGTTTTAAAAATAAGTTTTATACATAAACAGT
1601 TTTGGAGAAAAATTACAGATCATATAAGCAAGACAGTGGCACTAAAATGTTTAATTCATTAATCTGTTTGTTTGGCACTG
1681 ATGCAATGTATGGCTTTTCTCTTGCCCCAAATCACAAACATATGTATCTTTGGGGAAACTAACAATATGATTGCACTAAA
1761 TAAACTACTTTGAATAGAGGCCAAATTAATCTTTTAAAAATGATGATAATCATCAGGTTTACTCAGTGAAATCATATTAA
1841 TTATTTTCCAAAATCTAAAAGCTGTAGCTGGAGAAGCCCATGGCCACGAGGAAGCAGCAATTAATTAGATCAACACTTTT
1921 CTCCAGGGTTCACCATGCAGGCAACATTACCTTGTCTTTCAAAAGACACCTGCCTTATGCAAGGGGAAACCTGTGAAAGC
2001 TGCACTCAGAGGGAGGAGTTTTTCTTACATAATTTGCAATTTCAGGAATTTAATTTATAGGCAGATCTTTAAATACAGTC
2081 AACTTACGGTGCACAGTAATATGAAAGCCACACTTTGAAGGTAATAAATACACAGCATGCAGACTGGGAGTTGCTAGCAA
2161 ACAAATGGCTTACTTACAAAAGCAGCTTTTAGTTCAGACTTAGTTTTTATAAAATGGGAATTCTGACTTACTTAACCAGG
2241 TTTGGGATGGAGATGGTCTGCATCAGCTTTTTGTATTAACAAAGTTACTGGCTCTTTGTGTGTCTCCAGGTAACTTTGCT
2321 TGATTAAACAGCAAAGCCATATTCTAAATTCACTGTTGAATGCCTGTCCCAGTCCAAATTGTCTGTCTGCTCTTATTTTT
2401 GTACCATATTGCTCTTAAAAATCTTGGTTTGGTACAGTTCATAATTCACCAAAAGTTCATATAATTTAAAGAAACACTAA
2481 ATTAGTTTAAAATGAAGCAATTTATATCTTTATGCAAAAACATATGTCTGTCTTTGCAAAGGACTGTAAGCAGATTACAA
2561 TAAATCCTTTACTTTAATCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguGUAUCCUUAUUUUUCGGUAu 5'
             | | ||:||:||||||||| 
Target 5' gttCCTCGGGATGAAAAGCCATa 3'
244 - 266 176.00 -20.00
2
miRNA  3' agUGUAUCCUUAU-UUUUCGGUau 5'
            :|| || |||| :|||||||  
Target 5' gtGCACAGTAATATGAAAGCCAca 3'
2089 - 2112 153.00 -12.30
3
miRNA  3' agUGUAUC---CUUAUU-----UUUCGGUAu 5'
            || | |   || |||     |||||||| 
Target 5' taACTTTGCTTGATTAAACAGCAAAGCCATa 3'
2311 - 2341 153.00 -10.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-135a-5p :: NR3C2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Other
Conditions HeLa
Disease Hypertension;
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-124 and miR-135a suppress NR3C2// The binding of miR-124 and miR-135a to NR3C2 3'UTR contributes to the translational, not transcriptional regulation of the gene ...

- Sober, S. Laan, M. Annilo, T., 2010, Biochem Biophys Res Commun.

Article - Sober, S. Laan, M. Annilo, T.
- Biochem Biophys Res Commun, 2010
MicroRNAs (miRNAs) comprise a post-transcriptional layer of gene regulation shown to be involved in diverse physiological processes. We aimed to study whether regulatory networks that determine susceptibility to hypertension may involve a miRNA component. Screening of loci, involved in renal water-salt balance regulation, highlighted the mineralocorticoid receptor gene NR3C2 as a potential target for several miRNAs. A luciferase assay demonstrated that miR-124 and miR-135a suppress NR3C2 3'UTR reporter construct activity 1.5- and 2.2-fold, respectively. As the tested miRNAs did not reduce the levels of target mRNA, we suggest that the binding of miR-124 and miR-135a to NR3C2 3'UTR contributes to the translational, not transcriptional regulation of the gene. Co-expression of two different miRNAs did not increase the repression of the reporter gene, indicating no additive or synergistic effects between the tested miRNAs. Our results demonstrate that by repressing the mineralocorticoid receptor gene NR3C2, miR-124 and miR-135a could participate in the regulation of renin-angiotensin-aldosterone system and thereby might be involved in blood pressure regulation.
LinkOut: [PMID: 19944075]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
6 hsa-miR-135a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000707 JAK2 Janus kinase 2 3 1
MIRT001167 NR3C2 nuclear receptor subfamily 3, group C, member 2 3 1
MIRT001941 APC adenomatous polyposis coli 3 1
MIRT006793 HOXA10 homeobox A10 1 1
MIRT007105 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 1
MIRT035578 ALOX5AP arachidonate 5-lipoxygenase-activating protein 1 1