Accession ID: MIRT001175 [miRNA, hsa-miR-200a-3p :: CTNNB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200aLinkOut: [miRBase ]
Description Homo sapiens miR-200a stem-loop
Comment miR-200a was cloned from mouse kidney tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200a-3p
Mature Sequence 54| UAACACUGUCUGGUAACGAUGU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-200a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_001904    LinkOut: [ RefSeq ]
Other Transcripts NM_001098210 , NM_001098209   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_001904|3'UTR
   1 ATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAGACT
  81 TGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGTCTT
 161 GGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCCACA
 241 GCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAGCTG
 321 TATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAGTGC
 401 CTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGGAGT
 481 AACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCAAAC
 561 CCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAAGTA
 641 GCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATACTG
 721 CTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAATCTG
 801 AATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAATAT
 881 GCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCAGTA
 961 AGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGATAC
1041 GATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uguAGCAAU----GGUCUGUCACAAu 5'
             |: |||    :|  ::|||||| 
Target 5' tgtTTTTTAAGTCTCTCGTAGTGTTa 3'
678 - 703 129.00 -7.80
2
miRNA  3' uguAGCAAUGGUCUGUCACAau 5'
             |:||| :::|||||| |  
Target 5' accTTGTT-TTGGACAGTTTac 3'
977 - 997 114.00 -11.20
3
miRNA  3' ugUAGCAAUGGUCU-GU-CACAau 5'
            :|:||||:  || || ||||  
Target 5' tgGTTGTTATGTGATCATGTGTgg 3'
187 - 210 112.00 -9.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: CTNNB1    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... miR-200a directly targets beta-catenin mRNA and inhibits beta-catenin/Wnt signaling ...

- Saydam, O. Shen, Y. Wurdinger, T. Senol, O. et al., 2009, Mol Cell Biol.

Article - Saydam, O. Shen, Y. Wurdinger, T. Senol, O. et al.
- Mol Cell Biol, 2009
Meningiomas, one of the most common human brain tumors, are derived from arachnoidal cells associated with brain meninges, are usually benign, and are frequently associated with neurofibromatosis type 2. Here, we define a typical human meningioma microRNA (miRNA) profile and characterize the effects of one downregulated miRNA, miR-200a, on tumor growth. Elevated levels of miR-200a inhibited meningioma cell growth in culture and in a tumor model in vivo. Upregulation of miR-200a decreased the expression of transcription factors ZEB1 and SIP1, with consequent increased expression of E-cadherin, an adhesion protein associated with cell differentiation. Downregulation of miR-200a in meningiomas and arachnoidal cells resulted in increased expression of beta-catenin and cyclin D1 involved in cell proliferation. miR-200a was found to directly target beta-catenin mRNA, thereby inhibiting its translation and blocking Wnt/beta-catenin signaling, which is frequently involved in cancer. A direct correlation was found between the downregulation of miR-200a and the upregulation of beta-catenin in human meningioma samples. Thus, miR-200a appears to act as a multifunctional tumor suppressor miRNA in meningiomas through effects on the E-cadherin and Wnt/beta-catenin signaling pathways. This reveals a previously unrecognized signaling cascade involved in meningioma tumor development and highlights a novel molecular interaction between miR-200a and Wnt signaling, thereby providing insights into novel therapies for meningiomas.
LinkOut: [PMID: 19703993]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: CTNNB1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Reporter assay;Western blot;qRT-PCR
Conditions C666-1 , CNE-1 , CNE-2 , HNE1
Location of target site 3'UTR
Tools used in this research Literature survey , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... Over-expression of miR-200a significantly downregulated, whereas knock-down of miR-200a upregulated, the protein expressions of both ZEB2 and CTNNB1.//In this study, we used a combined bioinformatics and experimental approach to identify that ZEB2 and CTNNB1 are the two functional downstream targets of miR-200a.//miR-200a inhibits NPC cell growth, migration and invasion by targeting different mRNAs, ZEB2 and CTNNB1 ...

- Xia, H. Ng, S. S. Jiang, S. Cheung, W. K. et al., 2010, Biochem Biophys Res Commun.

Article - Xia, H. Ng, S. S. Jiang, S. Cheung, W. K. et al.
- Biochem Biophys Res Commun, 2010
Nasopharyngeal carcinoma (NPC), a highly metastatic and invasive malignant tumor originating from the nasopharynx, is widely prevalent in Southeast Asia, the Middle East and North Africa. Although viral, dietary and genetic factors have been implicated in NPC, the molecular basis of its pathogenesis is not well defined. Based on a recent microRNA (miRNA) microarray study showing miR-200 downregulation in NPC, we further investigated the role of miR-200a in NPC carcinogenesis. We found that the endogenous miR-200a expression level increases with the degree of differentiation in a panel of NPC cell lines, namely undifferentiated C666-1, high-differentiated CNE-1, and low-differentiated CNE-2 and HNE1 cells. By a series of gain-of-function and loss-of-function studies, we showed that over-expression of miR-200a inhibits C666-1 cell growth, migration and invasion, whereas its knock-down stimulates these processes in CNE-1 cells. In addition, we further identified ZEB2 and CTNNB1 as the functional downstream targets of miR-200a. Interestingly, knock-down of ZEB2 solely impeded NPC cell migration and invasion, whereas CTNNB1 suppression only inhibited NPC cell growth, suggesting that the inhibitory effects of miR-200a on NPC cell growth, migration and invasion are mediated by distinct targets and pathways. Our results reveal the important role of miR-200a as a regulatory factor of NPC carcinogenesis and a potential candidate for miRNA-based therapy against NPC.
LinkOut: [PMID: 19931509]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: CTNNB1    [ Functional MTI ]
Validation Method
Article - Su, J. Zhang, A. Shi, Z. Ma, F. Pu, P. et al.
- Int J Oncol, 2012
The Wnt/beta-catenin signaling pathway is crucial for human organ development and is involved in tumor progression of many cancers. Accumulating evidence suggests that the expression of beta-catenin is, in part, regulated by specific microRNAs (miRNAs). The purpose of this study was to determine the expression of a recently identified epithelial to mesenchymal transition (EMT)-associated tumor suppressor microRNA (miR)-200a, in cancer cells. We also aimed to identify specific miR-200a target genes and to investigate the antitumor effects of miR-200a on the Wnt/beta-catenin signaling pathway. We employed TOP/FOP flash luciferase assays to identify the effect of miR-200a on the Wnt/beta-catenin pathway and we confirmed our observations using fluorescence microscopy. To determine target genes of miR-200a, a 3' untranslated region (3' UTR) luciferase assay was performed. Cell viability, invasion and wound healing assays were carried out for functional analysis after miRNA transfection. We further investigated the role of miR-200a in EMT by Western blot analysis. accompanied by changes in the expression of members of the Wnt/beta-catenin signaling pathway. We also determined that miR-200a can directly interact with the 3' UTR of CTNNB1 (the gene that encodes beta-catenin) to suppress Wnt/beta-catenin signaling. MiR-200a could also influence the biological activities of SGC790 and U251 cells. Our results demonstrate that miR-200a is a new tumor suppressor that can regulate the activity of the Wnt/beta-catenin signaling pathway via two mechanisms. MiR-200a is a candidate target for tumor treatment via its regulation of the Wnt/beta-catenin signaling pathway.
LinkOut: [PMID: 22211245]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
128 hsa-miR-200a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000204 DLX5 distal-less homeobox 5 2 1
MIRT000730 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT000772 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 2 1
MIRT000773 PCDH8 protocadherin 8 2 1
MIRT000774 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001035 ZEB2 zinc finger E-box binding homeobox 2 5 20
MIRT001175 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 4 3
MIRT002480 ZEB1 zinc finger E-box binding homeobox 1 5 13
MIRT002481 SIP1 gem (nuclear organelle) associated protein 2 2 2
MIRT003140 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003141 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT004005 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT004006 GATA6 GATA binding protein 6 3 2
MIRT004007 VCAM1 vascular cell adhesion molecule 1 2 1
MIRT004400 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 2 1
MIRT004524 WASF3 WAS protein family, member 3 2 1
MIRT004549 TFRC transferrin receptor (p90, CD71) 1 1
MIRT004622 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004867 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005752 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT006423 MAPK14 mitogen-activated protein kinase 14 4 2
MIRT006665 CCNE2 cyclin E2 1 1
MIRT006704 KEAP1 kelch-like ECH-associated protein 1 3 1
MIRT006834 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT007290 SMAD2 SMAD family member 2 1 1
MIRT007291 SMAD3 SMAD family member 3 1 1
MIRT007299 YAP1 Yes-associated protein 1 1 1
MIRT020343 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT020345 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT020346 ELMO2 engulfment and cell motility 2 2 1
MIRT020347 ERBB2IP erbb2 interacting protein 2 1
MIRT020348 WDR37 WD repeat domain 37 2 1
MIRT020349 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT020350 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT020351 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT020352 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT020353 RIN2 Ras and Rab interactor 2 1 1
MIRT020354 HOXB5 homeobox B5 1 1
MIRT020355 SEPT7 septin 7 1 1
MIRT020356 KLF11 Kruppel-like factor 11 1 1
MIRT052922 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 1
MIRT053166 TFAM transcription factor A, mitochondrial 2 1
MIRT053353 UBASH3B ubiquitin associated and SH3 domain containing B 4 1
MIRT053604 TP53 tumor protein p53 2 1
MIRT054264 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT054265 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT054371 PTEN phosphatase and tensin homolog 3 2
MIRT054542 HFE hemochromatosis 2 1
MIRT054545 DLC1 deleted in liver cancer 1 2 1
MIRT054553 ATRX alpha thalassemia/mental retardation syndrome X-linked 2 1
MIRT061758 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT072481 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT078341 MED13 mediator complex subunit 13 1 1
MIRT099340 QKI QKI, KH domain containing, RNA binding 1 1
MIRT117486 ADNP2 ADNP homeobox 2 1 1
MIRT126445 ARL5B ADP-ribosylation factor-like 5B 1 5
MIRT127537 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT135564 SPRYD4 SPRY domain containing 4 1 1
MIRT176071 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT176153 PGK1 phosphoglycerate kinase 1 1 1
MIRT227601 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT313184 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT368862 IPO5 importin 5 1 1
MIRT437873 AREG amphiregulin 4 1
MIRT438100 GRB2 growth factor receptor-bound protein 2 1 1
MIRT438675 CDK6 cyclin-dependent kinase 6 3 1
MIRT441429 STXBP2 syntaxin binding protein 2 1 1
MIRT441732 SEPT8 septin 8 1 1
MIRT442158 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT443389 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT447629 NDST4 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4 1 1
MIRT452254 TRAM1 translocation associated membrane protein 1 1 1
MIRT455748 YRDC yrdC domain containing (E. coli) 1 6
MIRT470195 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT473463 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT478508 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT488715 BICD2 bicaudal D homolog 2 (Drosophila) 1 2
MIRT498345 PRELID2 PRELI domain containing 2 1 1
MIRT500583 USP53 ubiquitin specific peptidase 53 1 1
MIRT502259 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 2
MIRT502310 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT502449 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 2
MIRT502530 EPHA2 EPH receptor A2 1 2
MIRT503111 BRD3 bromodomain containing 3 1 1
MIRT505323 TMOD3 tropomodulin 3 (ubiquitous) 1 2
MIRT506628 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506861 KIAA1147 KIAA1147 1 1
MIRT519589 ZNF805 zinc finger protein 805 1 2
MIRT519813 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT529418 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT536478 KIAA1549 KIAA1549 1 1
MIRT537735 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT539039 ATXN7L1 ataxin 7-like 1 1 1
MIRT547112 PIGW phosphatidylinositol glycan anchor biosynthesis, class W 1 1
MIRT548308 EPHA7 EPH receptor A7 1 1
MIRT549102 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT554194 SLC35D1 solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 1 1
MIRT555677 PGAM4 phosphoglycerate mutase family member 4 1 1
MIRT557413 H2AFZ H2A histone family, member Z 1 2
MIRT559958 TRMT112 tRNA methyltransferase 11-2 homolog (S. cerevisiae) 1 1
MIRT564938 XPOT exportin, tRNA 1 1
MIRT568097 CDV3 CDV3 homolog (mouse) 1 1
MIRT573383 KIAA1549L KIAA1549-like 1 1
MIRT614582 LHX1 LIM homeobox 1 1 1
MIRT632224 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT634842 APOOL apolipoprotein O-like 1 1
MIRT639525 ZNF621 zinc finger protein 621 1 1
MIRT645300 ANGPTL7 angiopoietin-like 7 1 1
MIRT654775 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT656541 MACC1 metastasis associated in colon cancer 1 1 1
MIRT663684 CCDC18 coiled-coil domain containing 18 1 1
MIRT682853 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT682940 ZNF292 zinc finger protein 292 1 1
MIRT682959 RPL12 ribosomal protein L12 1 1
MIRT683087 A1BG alpha-1-B glycoprotein 1 1
MIRT692251 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT696502 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT696748 RBM28 RNA binding motif protein 28 1 1
MIRT702209 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT708614 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT709036 TROVE2 TROVE domain family, member 2 1 1
MIRT710918 GLTSCR1L KIAA0240 1 1
MIRT713191 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT714497 HSPA4 heat shock 70kDa protein 4 1 1
MIRT718596 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT723110 CLDND1 claudin domain containing 1 1 1
MIRT723914 PEX11A peroxisomal biogenesis factor 11 alpha 1 1
MIRT725579 CELF1 CUGBP, Elav-like family member 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*