Accession ID: MIRT001175 [miRNA, hsa-miR-200a-3p :: CTNNB1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200aLinkOut: [miRBase ]
Description Homo sapiens miR-200a stem-loop
Comment miR-200a was cloned from mouse kidney tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200a-3p
Mature Sequence 54| UAACACUGUCUGGUAACGAUGU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-200a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTNNB1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CTNNB, DKFZp686D02253, FLJ25606, FLJ37923
Description catenin (cadherin-associated protein), beta 1, 88kDa
Transcript NM_0019    LinkOut: [ RefSeq ]
Other Transcripts NM_0010982 , NM_0010982   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTNNB1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTNNB1
(miRNA target sites are highlighted)
>CTNNB1|NM_0019|3'UTR
   1 TAAATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAG
  81 ACTTGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGT
 161 CTTGGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCC
 241 ACAGCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAG
 321 CTGTATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAG
 401 TGCCTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGG
 481 AGTAACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCA
 561 AACCCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAA
 641 GTAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATA
 721 CTGCTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAAT
 801 CTGAATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAA
 881 TATGCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCA
 961 GTAAGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGA
1041 TACGATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: CTNNB1    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... miR-200a directly targets beta-catenin mRNA and inhibits beta-catenin/Wnt signaling ...

- Saydam, O. Shen, Y. Wurdinger, T. Senol, O. et al., 2009, Mol Cell Biol.

Article - Saydam, O. Shen, Y. Wurdinger, T. Senol, O. et al.
- Mol Cell Biol, 2009
Meningiomas, one of the most common human brain tumors, are derived from arachnoidal cells associated with brain meninges, are usually benign, and are frequently associated with neurofibromatosis type 2. Here, we define a typical human meningioma microRNA (miRNA) profile and characterize the effects of one downregulated miRNA, miR-200a, on tumor growth. Elevated levels of miR-200a inhibited meningioma cell growth in culture and in a tumor model in vivo. Upregulation of miR-200a decreased the expression of transcription factors ZEB1 and SIP1, with consequent increased expression of E-cadherin, an adhesion protein associated with cell differentiation. Downregulation of miR-200a in meningiomas and arachnoidal cells resulted in increased expression of beta-catenin and cyclin D1 involved in cell proliferation. miR-200a was found to directly target beta-catenin mRNA, thereby inhibiting its translation and blocking Wnt/beta-catenin signaling, which is frequently involved in cancer. A direct correlation was found between the downregulation of miR-200a and the upregulation of beta-catenin in human meningioma samples. Thus, miR-200a appears to act as a multifunctional tumor suppressor miRNA in meningiomas through effects on the E-cadherin and Wnt/beta-catenin signaling pathways. This reveals a previously unrecognized signaling cascade involved in meningioma tumor development and highlights a novel molecular interaction between miR-200a and Wnt signaling, thereby providing insights into novel therapies for meningiomas.
LinkOut: [PMID: 19703993]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200a-3p :: CTNNB1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Reporter assay;Western blot;qRT-PCR
Conditions C666-1 , CNE-1 , CNE-2 , HNE1
Location of target site 3'UTR
Tools used in this research Literature survey , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... Over-expression of miR-200a significantly downregulated, whereas knock-down of miR-200a upregulated, the protein expressions of both ZEB2 and CTNNB1.//In this study, we used a combined bioinformatics and experimental approach to identify that ZEB2 and CTNNB1 are the two functional downstream targets of miR-200a.//miR-200a inhibits NPC cell growth, migration and invasion by targeting different mRNAs, ZEB2 and CTNNB1 ...

- Xia, H. Ng, S. S. Jiang, S. Cheung, W. K. et al., 2010, Biochem Biophys Res Commun.

Article - Xia, H. Ng, S. S. Jiang, S. Cheung, W. K. et al.
- Biochem Biophys Res Commun, 2010
Nasopharyngeal carcinoma (NPC), a highly metastatic and invasive malignant tumor originating from the nasopharynx, is widely prevalent in Southeast Asia, the Middle East and North Africa. Although viral, dietary and genetic factors have been implicated in NPC, the molecular basis of its pathogenesis is not well defined. Based on a recent microRNA (miRNA) microarray study showing miR-200 downregulation in NPC, we further investigated the role of miR-200a in NPC carcinogenesis. We found that the endogenous miR-200a expression level increases with the degree of differentiation in a panel of NPC cell lines, namely undifferentiated C666-1, high-differentiated CNE-1, and low-differentiated CNE-2 and HNE1 cells. By a series of gain-of-function and loss-of-function studies, we showed that over-expression of miR-200a inhibits C666-1 cell growth, migration and invasion, whereas its knock-down stimulates these processes in CNE-1 cells. In addition, we further identified ZEB2 and CTNNB1 as the functional downstream targets of miR-200a. Interestingly, knock-down of ZEB2 solely impeded NPC cell migration and invasion, whereas CTNNB1 suppression only inhibited NPC cell growth, suggesting that the inhibitory effects of miR-200a on NPC cell growth, migration and invasion are mediated by distinct targets and pathways. Our results reveal the important role of miR-200a as a regulatory factor of NPC carcinogenesis and a potential candidate for miRNA-based therapy against NPC.
LinkOut: [PMID: 19931509]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
40 hsa-miR-200a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000204 DLX5 distal-less homeobox 5 2 1
MIRT000730 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT000772 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 2 1
MIRT000773 PCDH8 protocadherin 8 2 1
MIRT000774 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001035 ZEB2 zinc finger E-box binding homeobox 2 5 14
MIRT001175 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 4 2
MIRT002480 ZEB1 zinc finger E-box binding homeobox 1 5 11
MIRT002481 SIP1 survival of motor neuron protein interacting protein 1 2 2
MIRT003140 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003141 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT004005 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT004006 GATA6 GATA binding protein 6 2 1
MIRT004007 VCAM1 vascular cell adhesion molecule 1 2 1
MIRT004400 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 2 1
MIRT004524 WASF3 WAS protein family, member 3 2 1
MIRT004549 TFRC transferrin receptor (p90, CD71) 1 1
MIRT004622 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT004867 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005752 GDAP1 ganglioside-induced differentiation-associated protein 1 3 1
MIRT006423 MAPK14 mitogen-activated protein kinase 14 3 1
MIRT006665 CCNE2 cyclin E2 1 1
MIRT006704 KEAP1 kelch-like ECH-associated protein 1 3 1
MIRT006834 SRF serum response factor (c-fos serum response element-binding transcription factor) 2 1
MIRT007290 SMAD2 SMAD family member 2 1 1
MIRT007291 SMAD3 SMAD family member 3 1 1
MIRT007299 YAP1 Yes-associated protein 1 1 1
MIRT020343 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT020345 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT020346 ELMO2 engulfment and cell motility 2 2 1
MIRT020347 ERBB2IP erbb2 interacting protein 2 1
MIRT020348 WDR37 WD repeat domain 37 2 1
MIRT020349 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT020350 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT020351 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT020352 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT020353 RIN2 Ras and Rab interactor 2 1 1
MIRT020354 HOXB5 homeobox B5 1 1
MIRT020355 SEPT7 septin 7 1 1
MIRT020356 KLF11 Kruppel-like factor 11 1 1