Accession ID: MIRT001347 [miRNA, hsa-miR-1 ::
PPIB, target gene]
| pre-miRNA ID | hsa-mir-1-2 LinkOut: [miRBase ] |
|---|---|
| Synonyms | MIRN1-2, hsa-mir-1-2, miRNA1-2, MIR1-2 |
| Description | Homo sapiens miR-1-2 stem-loop |
| Comment | Lagos-Quintana et al. . |
| 2nd Structure of pre-miRNA | ![]() |
| Mature miRNA | hsa-miR-1 |
|---|---|
| Mature Sequence | 53| UGGAAUGUAAAGAAGUAUGUAU |74 |
| Evidence | Experimental |
| Experiments | Cloned |
| Expression Profile | ![]() |
| Putative hsa-miR-1 Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
![]() |
| Gene Symbol | PPIB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Synonyms | CYP-S1, CYPB, MGC14109, MGC2224, OI9, SCYLP | ||||||||||||||||||||
| Description | peptidylprolyl isomerase B (cyclophilin B) | ||||||||||||||||||||
| Transcript | NM_000942 LinkOut: [ RefSeq ] | ||||||||||||||||||||
| Expression | LinkOut: [ BioGPS ] | ||||||||||||||||||||
| Putative miRNA Targets on PPIB | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] | ||||||||||||||||||||
| 3'UTR of PPIB (miRNA target sites are highlighted) |
>PPIB|NM_000942|3'UTR 1 TAGGGCACAGGGACATCTTTCTTTGAGTGACCGTCTGTGCAGGCCCTGTAGTCCGCCACAGGGCTCTGAGCTGCACTGGC 81 CCCGGTGCTGGCATCTGGTGGAGCGGACCCACTCCCCTCACATTCCACAGGCCCATGGACTCACTTTTGTAACAAACTCC 161 TACCAACACTGACCAATAAAAAAAAATGTGGGTTTTTTTTTTTTTAATATAAAAAAAAAAAAAAAAAA Target sites Provided by authors Predicted by miRanda |
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
| miRNA:Target | hsa-miR-1 :: PPIB [ Functional MTI ] |
|---|---|
| Validation Method | pSILAC |
| Conditions | HeLa |
| Original Description (Extracted from the article) | ... Provided by pSILAC database (http://psilac.mdc-berlin.de/) ... - Selbach, M. Schwanhausser, B. Thierfelder, et al., 2008, Nature. |
| Article |
- Selbach, M.
Schwanhausser, B.
Thierfelder, et al. - Nature, 2008
Animal microRNAs (miRNAs) regulate gene expression by inhibiting translation and/or by inducing degradation of target messenger RNAs. It is unknown how much translational control is exerted by miRNAs on a genome-wide scale. We used a new proteomic approach to measure changes in synthesis of several thousand proteins in response to miRNA transfection or endogenous miRNA knockdown. In parallel, we quantified mRNA levels using microarrays. Here we show that a single miRNA can repress the production of hundreds of proteins, but that this repression is typically relatively mild. A number of known features of the miRNA-binding site such as the seed sequence also govern repression of human protein synthesis, and we report additional target sequence characteristics. We demonstrate that, in addition to downregulating mRNA levels, miRNAs also directly repress translation of hundreds of genes. Finally, our data suggest that a miRNA can, by direct or indirect effects, tune protein synthesis from thousands of genes.
LinkOut: [PMID: 18668040]
|


