Accession ID: MIRT001367 [miRNA, hsa-miR-1 :: GAK, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1-2LinkOut: [miRBase ]
Synonyms MIRN1-2, hsa-mir-1-2, miRNA1-2, MIR1-2
Description Homo sapiens miR-1-2 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1
Mature Sequence 53| UGGAAUGUAAAGAAGUAUGUAU |74
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-1 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GAK LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ16629, FLJ40395, MGC99654
Description cyclin G associated kinase
Transcript NM_0052    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GAK LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GAK
(miRNA target sites are highlighted)
>GAK|NM_0052|3'UTR
   1 TGAGGCCGCAGTGGTGGTGGCTGCGCACACAGCTCCACAGGTTGGGAGCCGTCGTGGGACCTGGGTCCCCACCGTGAGGA
  81 CCCCGTGGGCGACAGCAGGTGTGGCCAGGGTGGGGCTCCGAGCCCCGGGTCACCGCCCGCCCAGCGTTCCAGGCACATGA
 161 AGAGAAAGCATTCCAAAGCCTCTGATTGTTGTTTCCTTTTTCTCCTCCCGAAGGAACAGCTGATTCATGCTCCTCCCGCA
 241 ATTGTCACGTCTGTGATTTATTTGGTGTTTCGGGCGTGGCCTCTGGAGCCCCGGCACGTGGTGGGCCACGCTGCTGGCGC
 321 TCATGGGCCCTGGTGTTTGCACCGCACTTTGTAATCAGTCCCGTGGTTGTCTGTACAGAATTAAACTATTTTCCGATGAA
 401 AAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uauguaugaagaaaUGUAAGGu 5'
                        :|||||| 
Target 5' cacatgaagagaaaGCATTCCa 3'
154 - 175 124.00 -11.76
2
miRNA  3' uauguaugaagaaaUGUAAGGu 5'
                        :|:|||| 
Target 5' tcaccgcccgcccaGCGTTCCa 3'
130 - 151 108.00 -8.80
3
miRNA  3' uaUGUAUGAA-GAAAUGUAAGGu 5'
            ||| | ||    ||: |||| 
Target 5' gtACAGAATTAAACTATTTTCCg 3'
373 - 395 104.00 -6.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1 :: GAK    [ Functional MTI ]
Validation Method pSILAC , Proteomics;Other
Conditions HeLa
Original Description (Extracted from the article) ... Provided by pSILAC database (http://psilac.mdc-berlin.de/) ...

- Selbach, M. Schwanhausser, B. Thierfelder, et al., 2008, Nature.

Article - Selbach, M. Schwanhausser, B. Thierfelder, et al.
- Nature, 2008
Animal microRNAs (miRNAs) regulate gene expression by inhibiting translation and/or by inducing degradation of target messenger RNAs. It is unknown how much translational control is exerted by miRNAs on a genome-wide scale. We used a new proteomic approach to measure changes in synthesis of several thousand proteins in response to miRNA transfection or endogenous miRNA knockdown. In parallel, we quantified mRNA levels using microarrays. Here we show that a single miRNA can repress the production of hundreds of proteins, but that this repression is typically relatively mild. A number of known features of the miRNA-binding site such as the seed sequence also govern repression of human protein synthesis, and we report additional target sequence characteristics. We demonstrate that, in addition to downregulating mRNA levels, miRNAs also directly repress translation of hundreds of genes. Finally, our data suggest that a miRNA can, by direct or indirect effects, tune protein synthesis from thousands of genes.
LinkOut: [PMID: 18668040]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
846 hsa-miR-1 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000384 CHRNA4 cholinergic receptor, nicotinic, alpha 4 1 1
MIRT000385 MYEF2 myelin expression factor 2 1 1
MIRT000386 RHEB Ras homolog enriched in brain 1 1
MIRT000387 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT000389 CDK9 cyclin-dependent kinase 9 1 2
MIRT000390 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT000391 MEF2A myocyte enhancer factor 2A 3 4
MIRT000392 BCL2 B-cell CLL/lymphoma 2 1 2
MIRT000393 GATA4 GATA binding protein 4 2 2
MIRT000933 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 5 2
MIRT001053 HDAC4 histone deacetylase 4 3 4
MIRT001054 FOXP1 forkhead box P1 4 2
MIRT001205 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 4 2
MIRT001321 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 2 1
MIRT001322 WDFY1 WD repeat and FYVE domain containing 1 3 2
MIRT001323 UNC93B1 unc-93 homolog B1 (C. elegans) 2 1
MIRT001324 UHRF1 ubiquitin-like with PHD and ring finger domains 1 2 1
MIRT001325 TPM3 tropomyosin 3 3 2
MIRT001326 TPM2 tropomyosin 2 (beta) 3 2
MIRT001327 TPM1 tropomyosin 1 (alpha) 3 2
MIRT001328 THBS1 thrombospondin 1 2 1
MIRT001329 SYNE1 spectrin repeat containing, nuclear envelope 1 2 1
MIRT001330 SSNA1 Sjogren syndrome nuclear autoantigen 1 2 1
MIRT001331 SNX6 sorting nexin 6 2 1
MIRT001332 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 2 1
MIRT001333 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 3 2
MIRT001334 SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3 2 1
MIRT001335 SFXN1 sideroflexin 1 3 2
MIRT001336 SEC23IP SEC23 interacting protein 2 1
MIRT001337 SAC3D1 SAC3 domain containing 1 2 1
MIRT001338 RFT1 RFT1 homolog (S. cerevisiae) 2 1
MIRT001339 PWP1 PWP1 homolog (S. cerevisiae) 2 1
MIRT001340 PTPRF protein tyrosine phosphatase, receptor type, F 2 1
MIRT001341 PTPLB protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b 2 1
MIRT001342 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 2 1
MIRT001343 PTMA prothymosin, alpha 6 3
MIRT001344 PTBP2 polypyrimidine tract binding protein 2 2 1
MIRT001345 PTBP1 polypyrimidine tract binding protein 1 2 1
MIRT001346 PRSS21 protease, serine, 21 (testisin) 2 1
MIRT001347 PPIB peptidylprolyl isomerase B (cyclophilin B) 2 1
MIRT001348 POLA2 polymerase (DNA directed), alpha 2 (70kD subunit) 2 1
MIRT001350 PICALM phosphatidylinositol binding clathrin assembly protein 3 2
MIRT001351 PDLIM7 PDZ and LIM domain 7 (enigma) 3 2
MIRT001352 NRP1 neuropilin 1 2 1
MIRT001353 NOTCH2 Notch homolog 2 (Drosophila) 3 2
MIRT001354 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 1
MIRT001355 MRC2 mannose receptor, C type 2 2 1
MIRT001356 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 3 2
MIRT001357 MET met proto-oncogene (hepatocyte growth factor receptor) 6 6
MIRT001358 LRRC8A leucine rich repeat containing 8 family, member A 3 3
MIRT001359 LRP1 low density lipoprotein receptor-related protein 1 2 1
MIRT001360 F2 coagulation factor II (thrombin) 1 1
MIRT001362 ITGB4 integrin, beta 4 2 1
MIRT001363 IQGAP3 IQ motif containing GTPase activating protein 3 2 1
MIRT001364 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 3 2
MIRT001365 GOLGA7 golgin A7 2 1
MIRT001366 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 1
MIRT001367 GAK cyclin G associated kinase 2 1
MIRT001368 EHMT2 euchromatic histone-lysine N-methyltransferase 2 2 1
MIRT001369 EHMT1 euchromatic histone-lysine N-methyltransferase 1 2 1
MIRT001370 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 2 1
MIRT001371 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 2 1
MIRT001372 CTSC cathepsin C 2 1
MIRT001373 CSRP1 cysteine and glycine-rich protein 1 3 2
MIRT001374 CPOX coproporphyrinogen oxidase 2 1
MIRT001375 CORO1C coronin, actin binding protein, 1C 2 1
MIRT001376 COIL coilin 2 1
MIRT001377 CDCP1 CUB domain containing protein 1 3 2
MIRT001378 CAND1 cullin-associated and neddylation-dissociated 1 4 3
MIRT001380 BRI3BP BRI3 binding protein 3 2
MIRT001381 BCKDHB branched chain keto acid dehydrogenase E1, beta polypeptide 2 1
MIRT001382 ATP6V0A1 ATPase, H+ transporting, lysosomal V0 subunit a1 2 1
MIRT001383 ASH2L ash2 (absent, small, or homeotic)-like (Drosophila) 2 1
MIRT001384 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 2 1
MIRT001385 ARID1A AT rich interactive domain 1A (SWI-like) 2 1
MIRT001386 AP3D1 adaptor-related protein complex 3, delta 1 subunit 2 1
MIRT001387 AP3B1 adaptor-related protein complex 3, beta 1 subunit 2 1
MIRT001388 ANXA2 annexin A2 3 2
MIRT001389 ANPEP alanyl (membrane) aminopeptidase 2 1
MIRT001390 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 2 1
MIRT001391 AGRN agrin 2 1
MIRT001392 AGMAT agmatine ureohydrolase (agmatinase) 2 1
MIRT001393 ADPGK ADP-dependent glucokinase 2 1
MIRT001394 ABHD11 abhydrolase domain containing 11 2 1
MIRT001843 HAND2 heart and neural crest derivatives expressed 2 3 2
MIRT001844 IGF1 insulin-like growth factor 1 (somatomedin C) 1 1
MIRT001845 TMSB4X thymosin beta 4, X-linked 2 1
MIRT001847 SH3PXD2B SH3 and PX domains 2B 1 2
MIRT001983 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 3 3
MIRT001984 GJA1 gap junction protein, alpha 1, 43kDa 2 4
MIRT002733 ZNF264 zinc finger protein 264 2 2
MIRT002735 GCFC2 chromosome 2 open reading frame 3 2 1
MIRT002736 OAT ornithine aminotransferase 3 2
MIRT002737 CLCN3 chloride channel 3 2 1
MIRT002738 POLR2K polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa 2 1
MIRT002739 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT002740 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 3 2
MIRT002741 LZTFL1 leucine zipper transcription factor-like 1 2 1
MIRT002742 ARF3 ADP-ribosylation factor 3 2 1
MIRT002743 OSBPL7 oxysterol binding protein-like 7 2 1
MIRT002746 HIST1H3B histone cluster 1, H3b 2 1
MIRT002747 SH2D4A SH2 domain containing 4A 2 1
MIRT002748 TRIM2 tripartite motif-containing 2 2 1
MIRT002749 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT002750 RABL2B RAB, member of RAS oncogene family-like 2B 2 1
MIRT002751 XPO6 exportin 6 5 3
MIRT002752 ARCN1 archain 1 3 3
MIRT002753 FBLN2 fibulin 2 2 1
MIRT002754 CERS2 LAG1 homolog, ceramide synthase 2 2 2
MIRT002755 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 2 2
MIRT002756 POM121 POM121 membrane glycoprotein (rat) 3 2
MIRT002758 AXL AXL receptor tyrosine kinase 3 2
MIRT002759 POGK pogo transposable element with KRAB domain 3 1
MIRT002760 BLCAP bladder cancer associated protein 2 2
MIRT002761 MXD4 MAX dimerization protein 4 2 1
MIRT002762 KIAA1598 KIAA1598 2 1
MIRT002765 EML4 echinoderm microtubule associated protein like 4 2 1
MIRT002766 PGM2 phosphoglucomutase 2 3 1
MIRT002767 TRAPPC3 trafficking protein particle complex 3 2 1
MIRT002768 CHSY1 chondroitin sulfate synthase 1 2 1
MIRT002769 MGC27345 hypothetical protein MGC27345 1 1
MIRT002771 HIST1H3I histone cluster 1, H3i 1 1
MIRT002772 GCH1 GTP cyclohydrolase 1 2 1
MIRT002776 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 2 2
MIRT002777 SLC25A30 solute carrier family 25, member 30 2 2
MIRT002779 ANKRD29 ankyrin repeat domain 29 2 1
MIRT002780 TDP1 tyrosyl-DNA phosphodiesterase 1 2 1
MIRT002782 TPM4 tropomyosin 4 3 3
MIRT002783 PREX1 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 2 1
MIRT002785 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 2
MIRT002787 RNF138 ring finger protein 138 2 2
MIRT002788 TAGLN2 transgelin 2 6 7
MIRT002789 CHST11 carbohydrate (chondroitin 4) sulfotransferase 11 2 1
MIRT002792 RABL2A RAB, member of RAS oncogene family-like 2A 2 1
MIRT002793 LIN7C lin-7 homolog C (C. elegans) 2 2
MIRT002794 H3F3B H3 histone, family 3B (H3.3B) 2 2
MIRT002795 SDC4 syndecan 4 2 2
MIRT002797 RABGAP1L RAB GTPase activating protein 1-like 2 1
MIRT002798 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 3 2
MIRT002799 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 3 2
MIRT002800 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 2 2
MIRT002801 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 2 2
MIRT002802 INPP5F inositol polyphosphate-5-phosphatase F 2 2
MIRT002804 TH1L TH1-like (Drosophila) 3 3
MIRT002805 ANKIB1 ankyrin repeat and IBR domain containing 1 2 2
MIRT002806 SERP1 stress-associated endoplasmic reticulum protein 1 3 2
MIRT002807 TIMP3 TIMP metallopeptidase inhibitor 3 2 2
MIRT002808 LASP1 LIM and SH3 protein 1 5 3
MIRT002809 HPS4 Hermansky-Pudlak syndrome 4 2 2
MIRT002811 UST uronyl-2-sulfotransferase 2 2
MIRT002812 RAB11FIP2 RAB11 family interacting protein 2 (class I) 2 1
MIRT002813 PTMAP7 prothymosin, alpha pseudogene 7 1 1
MIRT002814 MMD monocyte to macrophage differentiation-associated 2 2
MIRT002815 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 3 2
MIRT002816 GNPDA2 glucosamine-6-phosphate deaminase 2 2 2
MIRT002817 ACPL2 acid phosphatase-like 2 2 2
MIRT002819 MTX1 metaxin 1 3 2
MIRT002820 ADAR adenosine deaminase, RNA-specific 4 3
MIRT002823 ARF4 ADP-ribosylation factor 4 3 2
MIRT002824 UHMK1 U2AF homology motif (UHM) kinase 1 2 2
MIRT002924 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 4 2
MIRT002955 BDNF brain-derived neurotrophic factor 2 1
MIRT002956 G6PD glucose-6-phosphate dehydrogenase 4 3
MIRT003203 SOX6 SRY (sex determining region Y)-box 6 2 1
MIRT003524 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 3 3
MIRT003525 LARP4 La ribonucleoprotein domain family, member 4 2 1
MIRT003526 CNN3 calponin 3, acidic 3 2
MIRT003762 ARHGAP29 Rho GTPase activating protein 29 2 1
MIRT003763 CDK14 cyclin-dependent kinase 14 2 1
MIRT003764 MTMR12 myotubularin related protein 12 2 2
MIRT003765 PNP purine nucleoside phosphorylase 5 5
MIRT003766 CCSAP chromosome 1 open reading frame 96 2 1
MIRT003767 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 2 1
MIRT003768 FAM57A family with sequence similarity 57, member A 2 2
MIRT003769 TNS4 tensin 4 2 1
MIRT003770 SLC44A1 solute carrier family 44, member 1 2 3
MIRT003771 IFT52 intraflagellar transport 52 homolog (Chlamydomonas) 2 1
MIRT003772 SRXN1 sulfiredoxin 1 homolog (S. cerevisiae) 3 2
MIRT003847 RBM47 RNA binding motif protein 47 2 2
MIRT003848 C1orf56 chromosome 1 open reading frame 56 2 1
MIRT003849 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT003850 IP6K2 inositol hexakisphosphate kinase 2 2 2
MIRT003851 CNOT6 CCR4-NOT transcription complex, subunit 6 2 1
MIRT003852 KLHDC5 kelch domain containing 5 2 2
MIRT003853 KIF2A kinesin heavy chain member 2A 4 3
MIRT003976 HSPD1 heat shock 60kDa protein 1 (chaperonin) 2 5
MIRT003977 HSPA4 heat shock 70kDa protein 4 2 3
MIRT004322 PIM1 pim-1 oncogene 4 2
MIRT004467 CALM3 calmodulin 3 (phosphorylase kinase, delta) 2 2
MIRT004602 PPP2R5A protein phosphatase 2, regulatory subunit B', alpha 3 1
MIRT004670 PAX3 paired box 3 6 2
MIRT004983 TSPAN4 tetraspanin 4 2 1
MIRT005072 SRSF9 splicing factor, arginine/serine-rich 9 4 4
MIRT005089 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 6 3
MIRT005273 ZNF384 zinc finger protein 384 2 1
MIRT005274 SNAPIN SNAP-associated protein 2 1
MIRT005275 NSUN4 NOP2/Sun domain family, member 4 2 1
MIRT005277 WDR11 WD repeat domain 11 2 1
MIRT005278 MON2 MON2 homolog (S. cerevisiae) 2 1
MIRT005279 TMX1 thioredoxin-related transmembrane protein 1 2 1
MIRT005280 RNF213 ring finger protein 213 2 1
MIRT005281 FERMT2 fermitin family homolog 2 (Drosophila) 2 1
MIRT005282 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 2 1
MIRT005283 ARMC10 armadillo repeat containing 10 2 1
MIRT005284 PSMG1 proteasome (prosome, macropain) assembly chaperone 1 2 1
MIRT005285 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 2 1
MIRT005439 IRF2BPL chromosome 14 open reading frame 4 2 1
MIRT005539 TWF2 twinfilin, actin-binding protein, homolog 2 (Drosophila) 4 1
MIRT005904 CALM2 calmodulin 2 (phosphorylase kinase, delta) 2 2
MIRT005905 GATA6 GATA binding protein 6 1 1
MIRT006132 FN1 fibronectin 1 4 2
MIRT006550 NOTCH3 Notch homolog 3 (Drosophila) 4 1
MIRT006819 SLC8A1 solute carrier family 8 (sodium/calcium exchanger), member 1 2 1
MIRT006855 EDN1 endothelin 1 2 2
MIRT007205 PRKCE protein kinase C, epsilon 1 1
MIRT007213 FABP3 fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) 3 1
MIRT007214 SNAI2 snail homolog 2 (Drosophila) 2 1
MIRT007222 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT023484 CDC42BPB CDC42 binding protein kinase beta (DMPK-like) 1 1
MIRT023485 SRRM1 serine/arginine repetitive matrix 1 1 1
MIRT023486 CD44 CD44 molecule (Indian blood group) 1 1
MIRT023487 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT023488 MECR mitochondrial trans-2-enoyl-CoA reductase 1 1
MIRT023489 CUL4B cullin 4B 1 1
MIRT023490 RAB34 RAB34, member RAS oncogene family 1 1
MIRT023491 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT023492 YTHDC1 YTH domain containing 1 1 1
MIRT023493 DGKH diacylglycerol kinase, eta 1 1
MIRT023494 FGFR2 fibroblast growth factor receptor 2 1 1
MIRT023495 OCIAD2 OCIA domain containing 2 1 1
MIRT023496 SYMPK symplekin 1 1
MIRT023497 LIPC lipase, hepatic 1 1
MIRT023498 CBR4 carbonyl reductase 4 1 1
MIRT023499 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT023500 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 1 1
MIRT023501 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT023502 RCC2 regulator of chromosome condensation 2 1 1
MIRT023503 WLS wntless homolog (Drosophila) 1 1
MIRT023504 CRELD2 cysteine-rich with EGF-like domains 2 1 1
MIRT023505 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT023506 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT023507 HEATR2 HEAT repeat containing 2 1 1
MIRT023508 UGT8 UDP glycosyltransferase 8 1 1
MIRT023509 ABCB5 ATP-binding cassette, sub-family B (MDR/TAP), member 5 1 1
MIRT023510 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT023511 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT023512 HIST2H3A histone cluster 2, H3a 1 1
MIRT023513 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT023514 SAMD15 chromosome 14 open reading frame 174 1 1
MIRT023515 DRAP1 DR1-associated protein 1 (negative cofactor 2 alpha) 1 1
MIRT023516 MDC1 mediator of DNA-damage checkpoint 1 1 1
MIRT023517 CD63 CD63 molecule 1 1
MIRT023518 KNCN kinocilin 1 1
MIRT023519 FANCI Fanconi anemia, complementation group I 1 1
MIRT023520 GJB3 gap junction protein, beta 3, 31kDa 1 1
MIRT023521 STK24 serine/threonine kinase 24 (STE20 homolog, yeast) 1 1
MIRT023522 MCM3 minichromosome maintenance complex component 3 1 1
MIRT023523 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT023524 SIN3A SIN3 homolog A, transcription regulator (yeast) 1 1
MIRT023525 ZNF561 zinc finger protein 561 1 1
MIRT023526 C1orf173 chromosome 1 open reading frame 173 1 1
MIRT023527 BMP7 bone morphogenetic protein 7 1 1
MIRT023528 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT023529 MOBP myelin-associated oligodendrocyte basic protein 1 1
MIRT023530 H1FX H1 histone family, member X 1 1
MIRT023531 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 1 1
MIRT023532 ATL3 atlastin GTPase 3 1 1
MIRT023533 BAG5 BCL2-associated athanogene 5 1 1
MIRT023534 CPSF3 cleavage and polyadenylation specific factor 3, 73kDa 1 1
MIRT023535 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT023536 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT023537 USP33 ubiquitin specific peptidase 33 1 1
MIRT023538 RIMS2 regulating synaptic membrane exocytosis 2 1 1
MIRT023539 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT023540 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT023541 GOLPH3 golgi phosphoprotein 3 (coat-protein) 1 1
MIRT023542 PGD phosphogluconate dehydrogenase 1 1
MIRT023543 UTRN utrophin 1 1
MIRT023544 GPR137C G protein-coupled receptor 137C 1 1
MIRT023545 FBXO33 F-box protein 33 1 1
MIRT023546 ITGA6 integrin, alpha 6 2 2
MIRT023547 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT023548 MRPL19 mitochondrial ribosomal protein L19 2 1
MIRT023549 JUP junction plakoglobin 2 1
MIRT023550 KIF5B kinesin family member 5B 2 1
MIRT023551 SLC27A4 solute carrier family 27 (fatty acid transporter), member 4 2 1
MIRT023552 GNAI1 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 2 1
MIRT023553 PLS3 plastin 3 2 1
MIRT023554 MYO1A myosin IA 2 1
MIRT023555 AP1B1 adaptor-related protein complex 1, beta 1 subunit 2 2
MIRT023556 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT023557 FLOT2 flotillin 2 2 2
MIRT023558 PSIP1 PC4 and SFRS1 interacting protein 1 2 2
MIRT023559 MYO1B myosin IB 2 2
MIRT023560 CAPN1 calpain 1, (mu/I) large subunit 1 1
MIRT023561 TAT tyrosine aminotransferase 1 1
MIRT023562 PCDH7 protocadherin 7 1 1
MIRT023563 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT023564 PYGB phosphorylase, glycogen; brain 1 1
MIRT023565 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023566 RBM42 RNA binding motif protein 42 1 1
MIRT023567 ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 1 1
MIRT023568 UNC13D unc-13 homolog D (C. elegans) 1 1
MIRT023569 DTX1 deltex homolog 1 (Drosophila) 1 1
MIRT023570 LGALS1 lectin, galactoside-binding, soluble, 1 1 1
MIRT023571 LEPREL2 leprecan-like 2 1 1
MIRT023572 KLHDC4 kelch domain containing 4 1 1
MIRT023573 SLBP stem-loop binding protein 1 1
MIRT023574 PI16 peptidase inhibitor 16 1 1
MIRT023575 RBM12B RNA binding motif protein 12B 1 1
MIRT023576 CALR calreticulin 1 1
MIRT023577 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT023578 SLC25A19 solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 1 1
MIRT023579 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT023580 ABHD12 abhydrolase domain containing 12 1 1
MIRT023581 MCAM melanoma cell adhesion molecule 1 1
MIRT023582 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT023583 COQ6 coenzyme Q6 homolog, monooxygenase (S. cerevisiae) 1 1
MIRT023584 RFC5 replication factor C (activator 1) 5, 36.5kDa 1 1
MIRT023585 ZNF579 zinc finger protein 579 1 1
MIRT023586 TRIM26 tripartite motif-containing 26 1 1
MIRT023587 SPC24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT023588 SEC11C SEC11 homolog C (S. cerevisiae) 1 1
MIRT023589 SEMG2 semenogelin II 1 1
MIRT023590 RASSF1 Ras association (RalGDS/AF-6) domain family member 1 1 1
MIRT023591 C11orf31 chromosome 11 open reading frame 31 1 1
MIRT023592 MACROD1 MACRO domain containing 1 1 1
MIRT023593 HIST1H1B histone cluster 1, H1b 1 1
MIRT023594 PLXDC2 plexin domain containing 2 1 1
MIRT023595 NXPH2 neurexophilin 2 1 1
MIRT023596 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT023597 TRPM6 transient receptor potential cation channel, subfamily M, member 6 1 1
MIRT023598 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT023599 SH3TC2 SH3 domain and tetratricopeptide repeats 2 1 1
MIRT023600 VASP vasodilator-stimulated phosphoprotein 1 1
MIRT023601 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT023602 AKAP12 A kinase (PRKA) anchor protein 12 1 1
MIRT023603 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT023604 CLDN12 claudin 12 1 1
MIRT023605 CHAMP1 zinc finger protein 828 1 1
MIRT023606 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT023607 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT023608 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT023609 IPO8 importin 8 1 1
MIRT023610 AKAP4 A kinase (PRKA) anchor protein 4 1 1
MIRT023611 VMP1 transmembrane protein 49 1 1
MIRT023612 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT023613 DKK1 dickkopf homolog 1 (Xenopus laevis) 1 1
MIRT023614 ZNF326 zinc finger protein 326 1 1
MIRT023615 FAM102A family with sequence similarity 102, member A 1 1
MIRT023616 PLXNA4 plexin A4 1 1
MIRT023617 RABEPK Rab9 effector protein with kelch motifs 1 1
MIRT023618 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT023619 MATR3 matrin 3 1 1
MIRT023620 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 2 1
MIRT023621 CCDC124 coiled-coil domain containing 124 2 1
MIRT023622 RALB v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) 2 1
MIRT023623 GTF3C6 general transcription factor IIIC, polypeptide 6, alpha 35kDa 2 1
MIRT023624 EMD emerin 2 1
MIRT023625 ECHS1 enoyl CoA hydratase, short chain, 1, mitochondrial 2 1
MIRT023626 SEPT6 septin 6 2 1
MIRT023627 CACNA2D1 calcium channel, voltage-dependent, alpha 2/delta subunit 1 2 1
MIRT023628 PXDN peroxidasin homolog (Drosophila) 2 2
MIRT023629 AMDHD1 amidohydrolase domain containing 1 1 1
MIRT023630 THAP2 THAP domain containing, apoptosis associated protein 2 1 1
MIRT023631 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT023632 NAT14 N-acetyltransferase 14 (GCN5-related, putative) 1 1
MIRT023633 DDTL D-dopachrome tautomerase-like 1 1
MIRT023634 PLCXD2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1 1
MIRT023635 BTC betacellulin 1 1
MIRT023636 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT023637 RRM1 ribonucleotide reductase M1 1 1
MIRT023638 GPR83 G protein-coupled receptor 83 1 1
MIRT023639 PPA2 pyrophosphatase (inorganic) 2 1 1
MIRT023640 DYNC1LI1 dynein, cytoplasmic 1, light intermediate chain 1 1 1
MIRT023641 NPTN neuroplastin 1 1
MIRT023642 MAGEB3 melanoma antigen family B, 3 1 1
MIRT023643 PSG6 pregnancy specific beta-1-glycoprotein 6 1 1
MIRT023644 ORC3 origin recognition complex, subunit 3-like (yeast) 1 1
MIRT023645 SFI1 Sfi1 homolog, spindle assembly associated (yeast) 1 1
MIRT023646 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT023647 HSPA1A heat shock 70kDa protein 1A 1 1
MIRT023648 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT023649 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT023650 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT023651 PRIMA1 proline rich membrane anchor 1 1 1
MIRT023652 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT023653 IL11 interleukin 11 1 1
MIRT023654 EXOC2 exocyst complex component 2 1 1
MIRT023655 C12orf57 chromosome 12 open reading frame 57 1 1
MIRT023656 CDH4 cadherin 4, type 1, R-cadherin (retinal) 1 1
MIRT023657 KLHL3 kelch-like 3 (Drosophila) 1 1
MIRT023658 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT023659 SPERT spermatid associated 1 1
MIRT023660 TRPM4 transient receptor potential cation channel, subfamily M, member 4 1 1
MIRT023661 CAST calpastatin 1 1
MIRT023662 SCAF11 splicing factor, arginine/serine-rich 2, interacting protein 1 1
MIRT023663 KCND1 potassium voltage-gated channel, Shal-related subfamily, member 1 1 1
MIRT023664 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 1
MIRT023665 SYTL2 synaptotagmin-like 2 1 1
MIRT023666 UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 1 1
MIRT023667 SRSF4 splicing factor, arginine/serine-rich 4 1 1
MIRT023668 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT023669 TMEM106C transmembrane protein 106C 1 1
MIRT023670 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT023671 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT023672 KLK12 kallikrein-related peptidase 12 1 1
MIRT023673 INTS6 integrator complex subunit 6 1 1
MIRT023674 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT023675 NUP50 nucleoporin 50kDa 1 1
MIRT023676 SHE Src homology 2 domain containing E 1 1
MIRT023677 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT023678 PPARG peroxisome proliferator-activated receptor gamma 1 1
MIRT023679 MAD2L1 MAD2 mitotic arrest deficient-like 1 (yeast) 2 1
MIRT023680 MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein 2 1
MIRT023681 ACTN4 actinin, alpha 4 2 1
MIRT023682 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 2 1
MIRT023683 PIGT phosphatidylinositol glycan anchor biosynthesis, class T 2 1
MIRT023684 PGRMC2 progesterone receptor membrane component 2 2 1
MIRT023685 COMMD2 COMM domain containing 2 2 1
MIRT023686 CD109 CD109 molecule 2 2
MIRT023687 COPG1 coatomer protein complex, subunit gamma 2 2
MIRT023688 DSG2 desmoglein 2 2 2
MIRT023689 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 2 2
MIRT023690 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT023691 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 1 1
MIRT023692 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT023693 DHRS1 dehydrogenase/reductase (SDR family) member 1 1 1
MIRT023694 CCL14 chemokine (C-C motif) ligand 14 1 1
MIRT023695 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT023696 ETV7 ets variant 7 1 1
MIRT023697 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT023698 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT023699 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT023700 SYNPO2L synaptopodin 2-like 1 1
MIRT023701 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT023702 NCAPD3 non-SMC condensin II complex, subunit D3 1 1
MIRT023703 PAFAH1B3 platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) 1 1
MIRT023704 ADAMTSL4 ADAMTS-like 4 1 1
MIRT023705 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT023706 SREK1 splicing factor, arginine/serine-rich 12 1 1
MIRT023707 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT023708 EMP3 epithelial membrane protein 3 1 1
MIRT023709 FAM81A family with sequence similarity 81, member A 2 2
MIRT023710 SPINK1 serine peptidase inhibitor, Kazal type 1 1 1
MIRT023711 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT023712 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT023713 OXTR oxytocin receptor 1 1
MIRT023714 DPP7 dipeptidyl-peptidase 7 1 1
MIRT023715 FAM208A chromosome 3 open reading frame 63 1 1
MIRT023716 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT023717 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT023718 FHDC1 FH2 domain containing 1 1 1
MIRT023719 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT023720 NR5A2 nuclear receptor subfamily 5, group A, member 2 1 1
MIRT023721 NXN nucleoredoxin 1 1
MIRT023722 RBBP5 retinoblastoma binding protein 5 1 1
MIRT023723 H3F3C H3 histone, family 3C 1 1
MIRT023724 HDAC2 histone deacetylase 2 1 1
MIRT023725 LHX4 LIM homeobox 4 1 1
MIRT023726 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT023727 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT023728 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT023729 AP1S3 adaptor-related protein complex 1, sigma 3 subunit 1 1
MIRT023730 BCAP29 B-cell receptor-associated protein 29 1 1
MIRT023731 TSHR thyroid stimulating hormone receptor 1 1
MIRT023732 PDE12 phosphodiesterase 12 1 1
MIRT023733 ADAM12 ADAM metallopeptidase domain 12 1 1
MIRT023734 ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 1 1
MIRT023735 HOOK1 hook homolog 1 (Drosophila) 1 1
MIRT023736 PFDN1 prefoldin subunit 1 1 1
MIRT023737 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT023738 SUSD1 sushi domain containing 1 1 1
MIRT023739 SEC62 SEC62 homolog (S. cerevisiae) 1 1
MIRT023740 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT023741 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT023742 NXT2 nuclear transport factor 2-like export factor 2 1 1
MIRT023743 ACTN1 actinin, alpha 1 2 1
MIRT023744 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 2 1
MIRT023745 COPZ1 coatomer protein complex, subunit zeta 1 2 1
MIRT023746 MOB4 MOB1, Mps One Binder kinase activator-like 3 (yeast) 2 1
MIRT023747 RSRC2 arginine/serine-rich coiled-coil 2 2 1
MIRT023748 MYO3B myosin IIIB 2 1
MIRT023749 PDIA3 protein disulfide isomerase family A, member 3 2 1
MIRT023750 FLNB filamin B, beta 2 1
MIRT023751 CHRAC1 chromatin accessibility complex 1 2 1
MIRT023752 PLS1 plastin 1 2 1
MIRT023753 POM121C POM121 membrane glycoprotein C 2 2
MIRT023754 LRRC8C leucine rich repeat containing 8 family, member C 2 2
MIRT023755 OXCT1 3-oxoacid CoA transferase 1 2 1
MIRT023756 WASF2 WAS protein family, member 2 2 1
MIRT023757 FLNA filamin A, alpha 2 2
MIRT023758 IGFBP7 insulin-like growth factor binding protein 7 1 1
MIRT023759 FBN1 fibrillin 1 1 1
MIRT023760 PNN pinin, desmosome associated protein 1 1
MIRT023761 NCS1 neuronal calcium sensor 1 1 1
MIRT023762 WDR33 WD repeat domain 33 1 1
MIRT023763 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT023764 RAB27B RAB27B, member RAS oncogene family 1 1
MIRT023765 MAN1B1 mannosidase, alpha, class 1B, member 1 1 1
MIRT023766 OASL 2'-5'-oligoadenylate synthetase-like 1 1
MIRT023767 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT023768 TMEM87A transmembrane protein 87A 1 1
MIRT023769 TUBB2B tubulin, beta 2B 1 1
MIRT023770 SNRNP35 small nuclear ribonucleoprotein 35kDa (U11/U12) 1 1
MIRT023771 ZNF799 zinc finger protein 799 1 1
MIRT023772 C6orf118 chromosome 6 open reading frame 118 1 1
MIRT023773 HERC2 hect domain and RLD 2 1 1
MIRT023774 HINT2 histidine triad nucleotide binding protein 2 1 1
MIRT023775 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 1
MIRT023776 DPY30 dpy-30 homolog (C. elegans) 1 1
MIRT023777 RGN regucalcin (senescence marker protein-30) 1 1
MIRT023778 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT023779 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit 1 1
MIRT023780 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT023781 SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 1 1
MIRT023782 PLK2 polo-like kinase 2 (Drosophila) 1 1
MIRT023783 IQCD IQ motif containing D 1 1
MIRT023784 CCDC134 coiled-coil domain containing 134 1 1
MIRT023785 ORMDL2 ORM1-like 2 (S. cerevisiae) 1 1
MIRT023786 TRIM9 tripartite motif-containing 9 1 1
MIRT023787 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT023788 AIM2 absent in melanoma 2 1 1
MIRT023789 PHLDB2 pleckstrin homology-like domain, family B, member 2 1 1
MIRT023790 TPD52L2 tumor protein D52-like 2 1 1
MIRT023791 LNPEP leucyl/cystinyl aminopeptidase 1 1
MIRT023792 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT023793 KIF4A kinesin family member 4A 1 1
MIRT023794 MIA2 melanoma inhibitory activity 2 1 1
MIRT023795 PARVA parvin, alpha 1 1
MIRT023796 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT023797 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT023798 FMNL3 formin-like 3 1 1
MIRT023799 EFR3A EFR3 homolog A (S. cerevisiae) 1 1
MIRT023800 CCND1 cyclin D1 1 1
MIRT023801 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT023802 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT023803 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 1 1
MIRT023804 SRSF6 splicing factor, arginine/serine-rich 6 1 1
MIRT023805 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT023806 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT023807 SRI sorcin 1 1
MIRT023808 E2F5 E2F transcription factor 5, p130-binding 1 1
MIRT023809 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT023810 SIGMAR1 sigma non-opioid intracellular receptor 1 2 1
MIRT023811 GPC1 glypican 1 2 1
MIRT023812 LEPREL4 synaptonemal complex protein SC65 2 1
MIRT023813 CCDC22 coiled-coil domain containing 22 2 1
MIRT023814 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT023815 PDCD10 programmed cell death 10 2 2
MIRT023816 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT023817 BRDT bromodomain, testis-specific 1 1
MIRT023818 PROCR protein C receptor, endothelial 1 1
MIRT023819 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT023820 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT023821 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT023822 BCL6B B-cell CLL/lymphoma 6, member B 1 1
MIRT023823 HSD17B8 hydroxysteroid (17-beta) dehydrogenase 8 1 1
MIRT023824 CXCL3 chemokine (C-X-C motif) ligand 3 1 1
MIRT023825 AMZ1 archaelysin family metallopeptidase 1 1 1
MIRT023826 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT023827 CLEC1A C-type lectin domain family 1, member A 1 1
MIRT023828 ANGPTL4 angiopoietin-like 4 1 1
MIRT023829 FRG1 FSHD region gene 1 1 1
MIRT023830 IL27RA interleukin 27 receptor, alpha 1 1
MIRT023831 CA3 carbonic anhydrase III, muscle specific 1 1
MIRT023832 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT023833 MME membrane metallo-endopeptidase 1 1
MIRT023834 ETNK1 ethanolamine kinase 1 1 1
MIRT023835 IFIT2 interferon-induced protein with tetratricopeptide repeats 2 1 1
MIRT023836 CRYGS crystallin, gamma S 1 1
MIRT023837 MCM2 minichromosome maintenance complex component 2 1 1
MIRT023838 GIMAP4 GTPase, IMAP family member 4 1 1
MIRT023839 ACTC1 actin, alpha, cardiac muscle 1 1 1
MIRT023840 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT023841 SMC4 structural maintenance of chromosomes 4 1 1
MIRT023842 YTHDF2 YTH domain family, member 2 1 1
MIRT023843 ERMN ermin, ERM-like protein 1 1
MIRT023844 RBM39 RNA binding motif protein 39 1 1
MIRT023845 IFI44 interferon-induced protein 44 1 1
MIRT023846 TPSD1 tryptase delta 1 1 1
MIRT023847 DROSHA ribonuclease type III, nuclear 1 1
MIRT023848 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT023849 NUAK1 NUAK family, SNF1-like kinase, 1 1 1
MIRT023850 ZNF207 zinc finger protein 207 1 1
MIRT023851 GNRHR gonadotropin-releasing hormone receptor 1 1
MIRT023852 LEMD3 LEM domain containing 3 1 1
MIRT023853 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT023854 RHOC ras homolog gene family, member C 1 1
MIRT023855 RAB30 RAB30, member RAS oncogene family 1 1
MIRT023856 SCN3A sodium channel, voltage-gated, type III, alpha subunit 1 1
MIRT023857 PRKG2 protein kinase, cGMP-dependent, type II 1 1
MIRT023858 PLCB3 phospholipase C, beta 3 (phosphatidylinositol-specific) 1 1
MIRT023859 PIR pirin (iron-binding nuclear protein) 1 1
MIRT023860 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT023861 FUBP3 far upstream element (FUSE) binding protein 3 1 1
MIRT023862 HSD17B11 hydroxysteroid (17-beta) dehydrogenase 11 1 1
MIRT023863 FMNL2 formin-like 2 1 1
MIRT023864 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT023865 MRFAP1 Mof4 family associated protein 1 2 1
MIRT023866 CETN3 centrin, EF-hand protein, 3 (CDC31 homolog, yeast) 2 1
MIRT023867 SDPR serum deprivation response 1 1
MIRT023868 LIMS1 LIM and senescent cell antigen-like domains 1 2 1
MIRT023869 SUGP1 splicing factor 4 2 1
MIRT023870 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 2 1
MIRT023871 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 2 1
MIRT023872 CTTN cortactin 2 2
MIRT023873 ZNF48 zinc finger protein 48 1 1
MIRT023874 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 1 1
MIRT023875 POLR2I polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa 1 1
MIRT023876 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT023877 MFN2 mitofusin 2 1 1
MIRT023878 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT023879 MTHFS 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) 1 1
MIRT023880 RPP40 ribonuclease P/MRP 40kDa subunit 1 1
MIRT023881 MINPP1 multiple inositol-polyphosphate phosphatase 1 1 1
MIRT023882 RRP36 chromosome 6 open reading frame 153 1 1
MIRT023883 ITGA1 integrin, alpha 1 1 1
MIRT023884 LCA5L Leber congenital amaurosis 5-like 1 1
MIRT023885 UBE2I ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 1 1
MIRT023886 DEFB125 defensin, beta 125 1 1
MIRT023887 TSPAN19 tetraspanin 19 1 1
MIRT023888 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT023889 S100A11 S100 calcium binding protein A11 1 1
MIRT023890 MCM7 minichromosome maintenance complex component 7 1 1
MIRT023891 AP1M1 adaptor-related protein complex 1, mu 1 subunit 1 1
MIRT023892 GSTO1 glutathione S-transferase omega 1 1 1
MIRT023893 CXCL2 chemokine (C-X-C motif) ligand 2 1 1
MIRT023894 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT023895 LRWD1 leucine-rich repeats and WD repeat domain containing 1 1 1
MIRT023896 STXBP3 syntaxin binding protein 3 1 1
MIRT023897 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT023898 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 1 1
MIRT023899 TAGLN transgelin 1 1
MIRT023900 EXOC3 exocyst complex component 3 1 1
MIRT023901 DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 1 1
MIRT023902 FADS1 fatty acid desaturase 1 1 1
MIRT023903 SLC26A7 solute carrier family 26, member 7 1 1
MIRT023904 TRPA1 transient receptor potential cation channel, subfamily A, member 1 1 1
MIRT023905 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT023906 CAPG capping protein (actin filament), gelsolin-like 1 1
MIRT023907 TLR4 toll-like receptor 4 1 1
MIRT023908 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 1
MIRT023909 TMEM68 transmembrane protein 68 1 1
MIRT023910 SLC35A5 solute carrier family 35, member A5 1 1
MIRT023911 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT023912 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT023913 PLEKHH2 pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 1 1
MIRT023914 DOK6 docking protein 6 1 1
MIRT023915 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT023916 SRSF7 splicing factor, arginine/serine-rich 7, 35kDa 1 1
MIRT023917 ZNF280C zinc finger protein 280C 1 1
MIRT023918 CAPRIN1 cell cycle associated protein 1 1 1
MIRT023919 CLTC clathrin, heavy chain (Hc) 1 1
MIRT023920 SMIM14 chromosome 4 open reading frame 34 1 1
MIRT023921 CHMP2A chromatin modifying protein 2A 2 1
MIRT023922 NUP160 nucleoporin 160kDa 2 1
MIRT023923 CTDNEP1 dullard homolog (Xenopus laevis) 2 1
MIRT023924 CNIH4 cornichon homolog 4 (Drosophila) 2 1
MIRT023925 EDF1 endothelial differentiation-related factor 1 2 1
MIRT023926 GNAI3 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 2 1
MIRT023927 MYOCD myocardin 1 1
MIRT023928 ZNF622 zinc finger protein 622 2 1
MIRT023929 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 2 1
MIRT023930 CD2AP CD2-associated protein 2 1
MIRT023931 COPB1 coatomer protein complex, subunit beta 1 2 2
MIRT023932 HADH hydroxyacyl-CoA dehydrogenase 2 2
MIRT023933 GPAA1 glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) 1 1
MIRT023934 S100G S100 calcium binding protein G 1 1
MIRT023935 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT023936 NDUFS4 NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) 1 1
MIRT023937 HYI hydroxypyruvate isomerase homolog (E. coli) 1 1
MIRT023938 ELMOD2 ELMO/CED-12 domain containing 2 1 1
MIRT023939 NUP210 nucleoporin 210kDa 1 1
MIRT023940 GLI2 GLI family zinc finger 2 1 1
MIRT023941 HIF3A hypoxia inducible factor 3, alpha subunit 1 1
MIRT023942 RCOR2 REST corepressor 2 1 1
MIRT023943 SYPL1 synaptophysin-like 1 1 1
MIRT023944 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT023945 GPX1P1 glutathione peroxidase 1 pseudogene 1 1
MIRT023946 MCM4 minichromosome maintenance complex component 4 1 1
MIRT023947 HIST2H3D histone cluster 2, H3d 1 1
MIRT023948 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT023949 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT023950 PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 1 1
MIRT023951 FTSJ1 FtsJ homolog 1 (E. coli) 1 1
MIRT023952 REM2 RAS (RAD and GEM)-like GTP binding 2 1 1
MIRT023953 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 1
MIRT023954 ISG15 ISG15 ubiquitin-like modifier 1 1
MIRT023955 NT5E 5'-nucleotidase, ecto (CD73) 1 1
MIRT023956 PLGRKT chromosome 9 open reading frame 46 1 1
MIRT023957 PKD1L1 polycystic kidney disease 1 like 1 1 1
MIRT023958 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT023959 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT023960 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT023961 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT023962 MCM5 minichromosome maintenance complex component 5 1 1
MIRT023963 HIST2H3C histone cluster 2, H3c 1 1
MIRT023964 EFCAB1 EF-hand calcium binding domain 1 1 1
MIRT023965 LMNB1 lamin B1 1 1
MIRT023966 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT023967 FBXO45 F-box protein 45 1 1
MIRT023968 MYO18A myosin XVIIIA 1 1
MIRT023969 SMEK1 SMEK homolog 1, suppressor of mek1 (Dictyostelium) 1 1
MIRT023970 HERC5 hect domain and RLD 5 1 1
MIRT023971 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT023972 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT023973 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT023974 DDX42 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 1 1
MIRT023975 TTC17 tetratricopeptide repeat domain 17 1 1
MIRT023976 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT023977 AFAP1 actin filament associated protein 1 1 1
MIRT023978 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT023979 EML3 echinoderm microtubule associated protein like 3 1 1
MIRT023980 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023981 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT023982 XPOT exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT023983 ALG2 asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT023984 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT023985 OSTF1 osteoclast stimulating factor 1 1 1
MIRT023986 IST1 KIAA0174 2 1
MIRT023987 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT023988 PQBP1 polyglutamine binding protein 1 2 1
MIRT023989 BAX BCL2-associated X protein 2 1
MIRT023990 GNA13 guanine nucleotide binding protein (G protein), alpha 13 2 1
MIRT023991 FOLR1 folate receptor 1 (adult) 2 1
MIRT023992 PRDX2 peroxiredoxin 2 2 1
MIRT023993 AHNAK2 AHNAK nucleoprotein 2 2 1
MIRT023994 GNAT2 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 2 1
MIRT023995 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 1
MIRT023996 KRT75 keratin 75 2 1
MIRT023997 CTBP2 C-terminal binding protein 2 2 1
MIRT023998 DOLPP1 dolichyl pyrophosphate phosphatase 1 2 2
MIRT023999 CXCL1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) 1 1
MIRT024000 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT024001 FILIP1 filamin A interacting protein 1 1 1
MIRT024002 PPP1R16A protein phosphatase 1, regulatory (inhibitor) subunit 16A 1 1
MIRT024003 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT024004 ISG20 interferon stimulated exonuclease gene 20kDa 1 1
MIRT024005 PPAP2C phosphatidic acid phosphatase type 2C 1 1
MIRT024006 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT024007 RAB39B RAB39B, member RAS oncogene family 1 1
MIRT024008 HSD3B7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 1 1
MIRT024009 HIST3H3 histone cluster 3, H3 1 1
MIRT024010 MMS22L chromosome 6 open reading frame 167 1 1
MIRT024011 COTL1 coactosin-like 1 (Dictyostelium) 1 1
MIRT024012 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT024013 C12orf40 chromosome 12 open reading frame 40 1 1
MIRT024014 BRPF3 bromodomain and PHD finger containing, 3 1 1
MIRT024015 TRIM24 tripartite motif-containing 24 1 1
MIRT024016 GATA3 GATA binding protein 3 1 1
MIRT024017 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT024018 POLRMT polymerase (RNA) mitochondrial (DNA directed) 1 1
MIRT024019 TIGD4 tigger transposable element derived 4 1 1
MIRT024020 SRSF5 splicing factor, arginine/serine-rich 5 1 1
MIRT024021 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT024022 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 1 1
MIRT024023 RBM28 RNA binding motif protein 28 1 1
MIRT024024 CCDC102A coiled-coil domain containing 102A 1 1
MIRT024025 KIF2C kinesin family member 2C 1 1
MIRT024026 CTBP1 C-terminal binding protein 1 1 1
MIRT024027 MCM6 minichromosome maintenance complex component 6 1 1
MIRT024028 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT024029 FRMD7 FERM domain containing 7 1 1
MIRT024030 CBX2 chromobox homolog 2 (Pc class homolog, Drosophila) 1 1
MIRT024031 TKT transketolase 1 1
MIRT024032 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT024034 RSF1 remodeling and spacing factor 1 1 1
MIRT024035 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT024036 IPO9 importin 9 1 1
MIRT024037 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT024038 KIAA1522 KIAA1522 1 1
MIRT024039 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT024040 KDM2B lysine (K)-specific demethylase 2B 1 1
MIRT024041 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT024042 CDC42SE1 CDC42 small effector 1 1 1
MIRT024043 UNC119B unc-119 homolog B (C. elegans) 1 1
MIRT024044 CEBPZ CCAAT/enhancer binding protein (C/EBP), zeta 1 1
MIRT024045 CCDC170 chromosome 6 open reading frame 97 1 1
MIRT024046 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT024047 UBAC2 UBA domain containing 2 2 1
MIRT024048 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 2 1
MIRT024049 DCAKD dephospho-CoA kinase domain containing 2 1
MIRT024050 COL12A1 collagen, type XII, alpha 1 2 1
MIRT024051 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 2 1
MIRT024052 CAMK2G calcium/calmodulin-dependent protein kinase II gamma 2 1
MIRT024053 DBN1 drebrin 1 2 2
MIRT024054 CALM1 calmodulin 1 (phosphorylase kinase, delta) 2 2
MIRT024055 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT024056 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT024057 RGS17 regulator of G-protein signaling 17 1 1
MIRT024058 CCL2 chemokine (C-C motif) ligand 2 1 1
MIRT024059 SLC39A3 solute carrier family 39 (zinc transporter), member 3 1 1
MIRT024060 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT024061 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT024062 ISY1 ISY1 splicing factor homolog (S. cerevisiae) 1 1
MIRT024063 TBCD tubulin folding cofactor D 1 1
MIRT024064 NBL1 neuroblastoma, suppression of tumorigenicity 1 1 1
MIRT024065 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT024066 ATP13A1 ATPase type 13A1 1 1
MIRT024067 PLXNB2 plexin B2 1 1
MIRT024068 ZNF638 zinc finger protein 638 1 1
MIRT024069 ZNF568 zinc finger protein 568 1 1
MIRT024070 CDH13 cadherin 13, H-cadherin (heart) 1 1
MIRT024071 FAM167A family with sequence similarity 167, member A 1 1
MIRT024072 F11R F11 receptor 1 1
MIRT024073 KIAA1731 KIAA1731 1 1
MIRT024074 S100A16 S100 calcium binding protein A16 1 1
MIRT024075 TROVE2 TROVE domain family, member 2 1 1
MIRT024076 SDR39U1 short chain dehydrogenase/reductase family 39U, member 1 1 1
MIRT024077 VAMP7 vesicle-associated membrane protein 7 1 1
MIRT024078 RIN1 Ras and Rab interactor 1 1 1
MIRT024079 ARG1 arginase, liver 1 1
MIRT024080 DDT D-dopachrome tautomerase 1 1
MIRT024081 FOXN4 forkhead box N4 1 1
MIRT024082 SFN stratifin 1 1
MIRT024083 AKR1D1 aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase) 1 1
MIRT024084 RIPK2 receptor-interacting serine-threonine kinase 2 1 1
MIRT024085 L1CAM L1 cell adhesion molecule 1 1
MIRT024086 IL8 interleukin 8 1 1
MIRT024087 FIG4 FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) 1 1
MIRT024088 OARD1 chromosome 6 open reading frame 130 1 1
MIRT024089 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 1 1
MIRT024090 C2orf48 chromosome 2 open reading frame 48 1 1
MIRT024091 ARGLU1 arginine and glutamate rich 1 1 1
MIRT024092 C10orf137 chromosome 10 open reading frame 137 1 1
MIRT024093 DFNA5 deafness, autosomal dominant 5 1 1
MIRT024094 RXFP1 relaxin/insulin-like family peptide receptor 1 1 1
MIRT024095 SSR1 signal sequence receptor, alpha 1 1
MIRT024096 MIER1 mesoderm induction early response 1 homolog (Xenopus laevis) 1 1
MIRT024097 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT024098 ACTB actin, beta 1 1
MIRT024099 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT024100 CSNK2A2 casein kinase 2, alpha prime polypeptide 1 1
MIRT024101 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT024102 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT024103 THY1 Thy-1 cell surface antigen 2 1
MIRT024104 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 2 1
MIRT024105 C1orf27 chromosome 1 open reading frame 27 2 1
MIRT024106 FLNC filamin C, gamma 2 1
MIRT024107 CDK4 cyclin-dependent kinase 4 2 1
MIRT024108 CRIP2 cysteine-rich protein 2 2 2
MIRT024109 EPB41L2 erythrocyte membrane protein band 4.1-like 2 2 2
MIRT035536 SP1 Sp1 transcription factor 1 1
MIRT046543 FBXO22 F-box protein 22 1 1
MIRT046544 SOS2 son of sevenless homolog 2 (Drosophila) 1 1