Accession ID: MIRT001768 [miRNA, hsa-miR-27b-3p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-27bLinkOut: [miRBase ]
Description Homo sapiens miR-27b stem-loop
Comment Lagos-Quintana et al. determined the expression of miR-27b in mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-27b-3p
Mature Sequence 61| UUCACAGUGGCUAAGUUCUGC |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-27b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgUCU-UGAAUCGGUGACACUu 5'
            ||| :: |:|  ||||||: 
Target 5' tgAGATGTGTGG--ACTGTGGc 3'
840 - 859 131.00 -9.10
2
miRNA  3' cgucUUGAAUCGGUGACACuu 5'
              :|:||  ::||||||  
Target 5' tgttGATTT--TTACTGTGtt 3'
1484 - 1502 129.00 -8.50
3
miRNA  3' cgUCUU---GAAUCGGUGACACUu 5'
            ||||   :||| |:|:| ||| 
Target 5' gtAGAAACTTTTATCTATTCTGAg 3'
222 - 245 119.00 -10.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-27b-3p :: NOTCH1    [ Functional MTI ]
Validation Method Other , Reporter assay
Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-27b-3p :: NOTCH1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgTC-TTGAATCGGTGACACTt 5'
            || :||  :|||||||||| 
Target 5' tcAGTGAC--GGCCACTGTGAc 3'
5 - 24
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
388 hsa-miR-27b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001768 NOTCH1 notch 1 3 2
MIRT003388 ST14 suppression of tumorigenicity 14 (colon carcinoma) 5 2
MIRT003427 MMP13 matrix metallopeptidase 13 (collagenase 3) 4 1
MIRT004499 ADORA2B adenosine A2b receptor 4 2
MIRT004826 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 5 3
MIRT004863 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005023 PPARG peroxisome proliferator-activated receptor gamma 4 3
MIRT005753 EDNRA endothelin receptor type A 3 1
MIRT005754 EYA4 eyes absent homolog 4 (Drosophila) 3 1
MIRT006101 WEE1 WEE1 homolog (S. pombe) 3 2
MIRT006509 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 3 2
MIRT006510 CYP3A4 cytochrome P450, family 3, subfamily A, polypeptide 4 1 1
MIRT006522 PAX3 paired box 3 3 1
MIRT006547 CCNT1 cyclin T1 4 1
MIRT006988 KHSRP KH-type splicing regulatory protein 2 2
MIRT023463 PAX7 paired box 7 2 1
MIRT046168 RPS15A ribosomal protein S15a 1 1
MIRT046169 UBXN1 UBX domain protein 1 1 1
MIRT046170 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT046171 NPEPPS aminopeptidase puromycin sensitive 1 2
MIRT046172 C1orf74 chromosome 1 open reading frame 74 1 1
MIRT046173 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT046174 SUPV3L1 suppressor of var1, 3-like 1 (S. cerevisiae) 1 1
MIRT046175 HIST2H3A histone cluster 2, H3a 1 1
MIRT046176 RGMB RGM domain family, member B 1 1
MIRT046177 FASN fatty acid synthase 1 1
MIRT046178 KIF1B kinesin family member 1B 1 1
MIRT046179 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT046180 RPL19 ribosomal protein L19 1 1
MIRT046181 SPAG9 sperm associated antigen 9 1 1
MIRT046182 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT046183 ATN1 atrophin 1 1 1
MIRT046184 HIST1H1C histone cluster 1, H1c 1 1
MIRT046185 CEP192 centrosomal protein 192kDa 1 1
MIRT046186 RPTOR regulatory associated protein of MTOR, complex 1 1 1
MIRT046187 CTSB cathepsin B 1 1
MIRT046188 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT046189 EHMT2 euchromatic histone-lysine N-methyltransferase 2 1 1
MIRT046190 NDUFS6 NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) 1 1
MIRT046191 DUSP5 dual specificity phosphatase 5 1 1
MIRT046192 CUL4B cullin 4B 1 1
MIRT046193 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT046194 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT046195 NOTCH2 notch 2 1 1
MIRT046196 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT046197 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT046198 ANKRD52 ankyrin repeat domain 52 1 1
MIRT046199 CUL1 cullin 1 1 1
MIRT046200 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT046201 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT046202 DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 1 1
MIRT046203 SNX19 sorting nexin 19 1 1
MIRT046204 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT046205 INPPL1 inositol polyphosphate phosphatase-like 1 1 1
MIRT046206 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT046207 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT046208 SLC43A1 solute carrier family 43, member 1 1 1
MIRT046209 PRR3 proline rich 3 1 1
MIRT046210 MTMR3 myotubularin related protein 3 1 1
MIRT046211 THOC3 THO complex 3 1 1
MIRT046212 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT046213 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT046214 DPF1 D4, zinc and double PHD fingers family 1 1 1
MIRT046215 ANKRD2 ankyrin repeat domain 2 (stretch responsive muscle) 1 1
MIRT046216 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT046217 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT046218 POGZ pogo transposable element with ZNF domain 1 1
MIRT046219 ZMYND11 zinc finger, MYND-type containing 11 1 1
MIRT046220 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT046221 RPS24 ribosomal protein S24 1 1
MIRT046222 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT046223 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT046224 KIAA1211 KIAA1211 1 1
MIRT046225 GALNT11 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11) 1 1
MIRT046226 ZNF45 zinc finger protein 45 1 1
MIRT046227 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 1
MIRT046228 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT046229 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT046230 BRAT1 BRCA1-associated ATM activator 1 1 1
MIRT046231 LMF2 lipase maturation factor 2 1 1
MIRT046232 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT046233 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT046234 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT046235 TMEM19 transmembrane protein 19 1 1
MIRT046236 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 3
MIRT046237 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT046238 CCND3 cyclin D3 1 1
MIRT046239 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT052940 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 2 2
MIRT054253 VEGFC vascular endothelial growth factor C 4 1
MIRT054313 CREB1 cAMP responsive element binding protein 1 3 1
MIRT054624 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 3 1
MIRT054830 PSAP prosaposin 4 1
MIRT054898 MFF mitochondrial fission factor 1 1
MIRT056718 UBE2D1 ubiquitin-conjugating enzyme E2D 1 1 3
MIRT057009 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT059147 TXNIP thioredoxin interacting protein 1 1
MIRT065417 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 3
MIRT067405 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT071716 CCNK cyclin K 1 2
MIRT078214 DYNLL2 dynein, light chain, LC8-type 2 1 1
MIRT081143 LDLR low density lipoprotein receptor 1 1
MIRT090246 ZNF148 zinc finger protein 148 1 1
MIRT093745 ADD1 adducin 1 (alpha) 1 1
MIRT097060 TNPO1 transportin 1 1 2
MIRT100888 CD2AP CD2-associated protein 1 2
MIRT104479 PEG10 paternally expressed 10 1 3
MIRT118768 FAM217B family with sequence similarity 217, member B 1 3
MIRT120696 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT128955 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT132933 WNK1 WNK lysine deficient protein kinase 1 3 2
MIRT134639 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT141354 ABHD17C family with sequence similarity 108, member C1 1 2
MIRT148813 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT149464 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT155416 CCNT2 cyclin T2 1 1
MIRT155580 TTC3 tetratricopeptide repeat domain 3 1 1
MIRT156102 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT156323 PDK1 pyruvate dehydrogenase kinase, isozyme 1 1 1
MIRT157101 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT157711 CAB39 calcium binding protein 39 1 1
MIRT159512 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 2
MIRT164846 DCUN1D4 DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) 1 1
MIRT172350 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT178137 PPIF peptidylprolyl isomerase F 1 1
MIRT181415 EFHD2 EF-hand domain family, member D2 1 1
MIRT186279 PITHD1 PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1 1 3
MIRT190177 AKIRIN1 akirin 1 1 4
MIRT190743 FOXJ3 forkhead box J3 1 1
MIRT196436 TAOK1 TAO kinase 1 1 1
MIRT197757 MED13 mediator complex subunit 13 1 1
MIRT218358 C6ORF120 chromosome 6 open reading frame 120 1 1
MIRT238584 NLN neurolysin (metallopeptidase M3 family) 1 1
MIRT238651 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT241580 TROVE2 TROVE domain family, member 2 1 1
MIRT247907 KIAA1551 KIAA1551 1 1
MIRT251546 DCAF7 DDB1 and CUL4 associated factor 7 1 3
MIRT297084 RGPD4 RANBP2-like and GRIP domain containing 4 1 1
MIRT303304 SNRNP27 small nuclear ribonucleoprotein 27kDa (U4/U6.U5) 1 1
MIRT315670 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 4
MIRT320052 EN2 engrailed homeobox 2 1 1
MIRT323789 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT352934 C2ORF44 chromosome 2 open reading frame 44 1 1
MIRT353303 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT357684 PAIP2 poly(A) binding protein interacting protein 2 1 1
MIRT382290 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT393593 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT400021 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT401740 HLA-DRA major histocompatibility complex, class II, DR alpha 1 1
MIRT437700 ENDOU endonuclease, polyU-specific 2 1
MIRT437701 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 2 1
MIRT437702 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 2 1
MIRT437703 CRISP2 cysteine-rich secretory protein 2 2 1
MIRT437704 LPIN1 lipin 1 2 1
MIRT437705 CCNYL1 cyclin Y-like 1 2 1
MIRT437706 CAB39L calcium binding protein 39-like 2 1
MIRT437707 CPPED1 calcineurin-like phosphoesterase domain containing 1 2 1
MIRT437708 CNN3 calponin 3, acidic 2 1
MIRT437993 DPYD dihydropyrimidine dehydrogenase 1 1
MIRT438197 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT438198 THBS2 thrombospondin 2 1 1
MIRT438199 THBS1 thrombospondin 1 1 1
MIRT438508 FOXO1 forkhead box O1 2 1
MIRT438611 RET ret proto-oncogene 1 1
MIRT438627 PHB prohibitin 1 1
MIRT438744 CCNA2 cyclin A2 1 1
MIRT442824 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 1 1
MIRT448430 TMEM167A transmembrane protein 167A 1 1
MIRT450250 MED30 mediator complex subunit 30 1 1
MIRT451840 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT452125 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 1 1
MIRT452197 TMEM68 transmembrane protein 68 1 2
MIRT452777 FAM136A family with sequence similarity 136, member A 1 1
MIRT454225 OSBPL10 oxysterol binding protein-like 10 1 7
MIRT454703 HMGN1 high mobility group nucleosome binding domain 1 1 2
MIRT455380 PLA2G2D phospholipase A2, group IID 1 1
MIRT455816 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 3
MIRT456975 MANEA mannosidase, endo-alpha 1 1
MIRT457169 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT457219 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT458041 TSEN54 tRNA splicing endonuclease 54 homolog (S. cerevisiae) 1 1
MIRT459894 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 6
MIRT461308 MRPS27 mitochondrial ribosomal protein S27 1 1
MIRT461486 KIAA1009 KIAA1009 1 1
MIRT462945 ZNF800 zinc finger protein 800 1 7
MIRT463094 ZNF618 zinc finger protein 618 1 1
MIRT463309 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 3
MIRT463323 ZFP1 zinc finger protein 1 homolog (mouse) 1 1
MIRT464027 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT464352 USP46 ubiquitin specific peptidase 46 1 1
MIRT464471 UGCG UDP-glucose ceramide glucosyltransferase 1 2
MIRT465455 TOR2A torsin family 2, member A 1 1
MIRT465812 TMEM91 transmembrane protein 91 1 1
MIRT466195 TMED5 transmembrane emp24 protein transport domain containing 5 1 4
MIRT466393 TGOLN2 trans-golgi network protein 2 1 2
MIRT466401 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT466622 TARDBP TAR DNA binding protein 1 1
MIRT467064 SRSF1 serine/arginine-rich splicing factor 1 1 2
MIRT467333 SPATA13 spermatogenesis associated 13 1 2
MIRT468261 SFXN4 sideroflexin 4 1 1
MIRT468264 SFXN1 sideroflexin 1 1 1
MIRT468549 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT468890 RREB1 ras responsive element binding protein 1 1 1
MIRT469592 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT469832 RAB14 RAB14, member RAS oncogene family 1 2
MIRT470121 PSPC1 paraspeckle component 1 1 2
MIRT470541 COASY CoA synthase 1 1
MIRT471448 PDIA5 protein disulfide isomerase family A, member 5 1 1
MIRT471456 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT471695 OTUD4 OTU domain containing 4 1 2
MIRT471855 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT471925 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 2
MIRT472082 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT472141 NLK nemo-like kinase 1 1
MIRT472427 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT472619 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT473036 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT473922 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 2
MIRT474141 LIN54 lin-54 homolog (C. elegans) 1 2
MIRT474577 KLHDC3 kelch domain containing 3 1 1
MIRT475078 ITSN2 intersectin 2 1 2
MIRT475083 ITCH itchy E3 ubiquitin protein ligase 1 1
MIRT475417 ICK intestinal cell (MAK-like) kinase 1 1
MIRT475852 HAT1 histone acetyltransferase 1 1 1
MIRT476036 GSE1 Gse1 coiled-coil protein homolog (mouse) 1 2
MIRT476155 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 2
MIRT476225 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT476727 FOXN2 forkhead box N2 1 2
MIRT476829 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT476851 FHL2 four and a half LIM domains 2 1 2
MIRT476984 FAM73B family with sequence similarity 73, member B 1 1
MIRT477514 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT477816 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478426 DAZAP2 DAZ associated protein 2 1 1
MIRT478564 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT478693 CSRP2 cysteine and glycine-rich protein 2 1 2
MIRT479387 CELF1 CUGBP, Elav-like family member 1 1 3
MIRT480281 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT480314 C5orf51 chromosome 5 open reading frame 51 1 1
MIRT480583 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT480873 BDNF-AS BDNF antisense RNA 1 1
MIRT481486 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 4
MIRT481721 APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 1 3
MIRT481802 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 3
MIRT481854 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 4
MIRT481919 ANKRD40 ankyrin repeat domain 40 1 1
MIRT482070 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT485067 SUCO SUN domain containing ossification factor 1 2
MIRT485312 NECAP1 NECAP endocytosis associated 1 1 5
MIRT487163 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT489615 ZNF384 zinc finger protein 384 1 1
MIRT493148 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT498024 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT498649 AP3B2 adaptor-related protein complex 3, beta 2 subunit 1 3
MIRT499283 TSPYL1 TSPY-like 1 1 2
MIRT500098 SLC46A3 solute carrier family 46, member 3 1 1
MIRT500342 ZNF460 zinc finger protein 460 1 4
MIRT501601 PLAGL2 pleiomorphic adenoma gene-like 2 1 2
MIRT501627 PISD phosphatidylserine decarboxylase 1 1
MIRT501763 NRBP1 nuclear receptor binding protein 1 1 1
MIRT501803 NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 1 1
MIRT501813 NEURL1B neuralized homolog 1B (Drosophila) 1 1
MIRT502276 H3F3B H3 histone, family 3B (H3.3B) 1 2
MIRT502301 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 3
MIRT502488 FAM84B family with sequence similarity 84, member B 1 1
MIRT502866 CHEK2 checkpoint kinase 2 1 3
MIRT503089 BTG2 BTG family, member 2 1 1
MIRT503149 ARL5B ADP-ribosylation factor-like 5B 1 3
MIRT503223 ACER2 alkaline ceramidase 2 1 1
MIRT503241 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) 1 2
MIRT506966 HOXA10 homeobox A10 1 3
MIRT507195 FZD9 frizzled family receptor 9 1 3
MIRT511581 HIST2H2AA4 histone cluster 2, H2aa4 1 2
MIRT511592 HIST2H2AA3 histone cluster 2, H2aa3 1 2
MIRT513889 GTF2IRD2 GTF2I repeat domain containing 2 1 2
MIRT523918 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT525426 PROX2 prospero homeobox 2 1 1
MIRT527140 GPATCH11 coiled-coil domain containing 75 1 1
MIRT527355 KRTAP13-2 keratin associated protein 13-2 1 1
MIRT528213 METTL8 methyltransferase like 8 1 1
MIRT530184 TIGD2 tigger transposable element derived 2 1 1
MIRT533008 ZFHX3 zinc finger homeobox 3 1 1
MIRT533109 YIPF4 Yip1 domain family, member 4 1 2
MIRT533582 TOMM40L translocase of outer mitochondrial membrane 40 homolog (yeast)-like 1 1
MIRT534673 RNF152 ring finger protein 152 1 1
MIRT535976 MESDC1 mesoderm development candidate 1 1 1
MIRT538140 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT539091 ARNTL aryl hydrocarbon receptor nuclear translocator-like 1 2
MIRT555415 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT556568 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT557016 HOXD11 homeobox D11 1 1
MIRT557040 HOXB3 homeobox B3 1 1
MIRT558180 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT560384 TMEM254 transmembrane protein 254 1 1
MIRT562152 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT562420 EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa 1 1
MIRT564817 ZBTB18 zinc finger protein 238 1 1
MIRT565059 USP25 ubiquitin specific peptidase 25 1 1
MIRT565572 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT565675 SETD1B SET domain containing 1B 1 1
MIRT570042 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570627 MAP1B microtubule-associated protein 1B 1 1
MIRT572019 H3F3C H3 histone, family 3C 1 1
MIRT573426 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT575294 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT611105 MYO1F myosin IF 1 2
MIRT611934 ZNF106 zinc finger protein 106 homolog (mouse) 1 1
MIRT612575 RBBP5 retinoblastoma binding protein 5 1 1
MIRT617070 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT620807 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT623674 HRK harakiri, BCL2 interacting protein (contains only BH3 domain) 1 1
MIRT626144 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT630863 UBXN11 UBX domain protein 11 1 1
MIRT641999 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT645232 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT649698 ZNF175 zinc finger protein 175 1 1
MIRT651504 WNT9B wingless-type MMTV integration site family, member 9B 1 1
MIRT652648 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT653371 SMAD4 SMAD family member 4 1 1
MIRT653454 SLC6A17 solute carrier family 6, member 17 1 1
MIRT660907 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 1 1
MIRT664291 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT666295 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT682415 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT686793 SP1 Sp1 transcription factor 1 1
MIRT686860 SLC25A44 solute carrier family 25, member 44 1 1
MIRT698122 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT699016 SOS1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT699900 RUNX1 runt-related transcription factor 1 1 1
MIRT715444 RGS6 regulator of G-protein signaling 6 1 1
MIRT722065 TP53INP2 tumor protein p53 inducible nuclear protein 2 1 1
MIRT722352 BAG2 BCL2-associated athanogene 2 1 1
MIRT723896 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT725517 FBXO46 F-box protein 46 1 1
MIRT725576 CFDP1 craniofacial development protein 1 1 1
MIRT726026 ZNF627 zinc finger protein 627 1 1
MIRT726063 ZFX zinc finger protein, X-linked 1 1
MIRT726111 WDFY1 WD repeat and FYVE domain containing 1 1 1
MIRT726184 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT726197 UBE2G1 ubiquitin-conjugating enzyme E2G 1 1 1
MIRT726234 TRIM23 tripartite motif containing 23 1 1
MIRT726241 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT726270 TMSB10 thymosin beta 10 1 1
MIRT726476 SNX25 sorting nexin 25 1 1
MIRT726494 SMAD2 SMAD family member 2 1 1
MIRT726600 SGMS1 sphingomyelin synthase 1 1 1
MIRT726622 SERTAD3 SERTA domain containing 3 1 1
MIRT726641 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT726673 RYBP RING1 and YY1 binding protein 1 1
MIRT726721 RNF38 ring finger protein 38 1 1
MIRT726729 RNF139 ring finger protein 139 1 1
MIRT726856 PREX1 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 1 1
MIRT726920 PLXND1 plexin D1 1 1
MIRT726950 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT726954 PHC2 polyhomeotic homolog 2 (Drosophila) 1 1
MIRT726956 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT727023 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT727056 NUP133 nucleoporin 133kDa 1 1
MIRT727063 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT727087 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1
MIRT727088 NF1 neurofibromin 1 1 1
MIRT727182 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT727190 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT727208 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT727218 MED14 mediator complex subunit 14 1 1
MIRT727264 LRRC61 leucine rich repeat containing 61 1 1
MIRT727281 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727294 LMNB2 lamin B2 1 1
MIRT727321 LBR lamin B receptor 1 1
MIRT727468 IER3 immediate early response 3 1 1
MIRT727490 HMGXB4 HMG box domain containing 4 1 1
MIRT727519 GYS1 glycogen synthase 1 (muscle) 1 1
MIRT727573 GLCCI1 glucocorticoid induced transcript 1 1 1
MIRT727597 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727658 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT727659 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT727685 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT727778 ELMO1 engulfment and cell motility 1 1 1
MIRT727817 E2F7 E2F transcription factor 7 1 1
MIRT727878 DERL1 derlin 1 1 1
MIRT727959 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT728027 CCNL2 cyclin L2 1 1
MIRT728103 C2CD2L C2CD2-like 1 1
MIRT728123 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT728250 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT728376 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728385 ADAR adenosine deaminase, RNA-specific 1 1
MIRT728412 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*