Accession ID: MIRT001775 [miRNA, hsa-miR-23b-3p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-23bLinkOut: [miRBase ]
Synonyms MIRN23B, hsa-mir-23b, miRNA23B, MIR23B
Description Homo sapiens miR-23b stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-23b-3p
Mature Sequence 58| AUCACAUUGCCAGGGAUUACC |78
Evidence Experimental
Experiments Cloned
Putative hsa-miR-23b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23b-3p :: NOTCH1    [ Functional MTI ]
Validation Method Other , Reporter assay
Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
175 hsa-miR-23b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000125 OPRM1 opioid receptor, mu 1 1 2
MIRT001177 PRAP1 proline-rich acidic protein 1 3 1
MIRT001775 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 2 1
MIRT003424 E2F1 E2F transcription factor 1 2 1
MIRT003425 RB1 retinoblastoma 1 2 1
MIRT004291 PLAU plasminogen activator, urokinase 4 2
MIRT004292 MET met proto-oncogene (hepatocyte growth factor receptor) 4 1
MIRT006806 PRKACB protein kinase, cAMP-dependent, catalytic, beta 2 1
MIRT006963 PTK2B PTK2B protein tyrosine kinase 2 beta 0 1
MIRT007006 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT007039 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT007040 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT007041 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007051 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 1 1
MIRT007096 PTEN phosphatase and tensin homolog 1 1
MIRT023464 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT023465 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023466 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT023467 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT023468 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT023469 KIAA1279 KIAA1279 1 1
MIRT023470 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT023471 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT023472 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT023473 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023474 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT023475 MED4 mediator complex subunit 4 1 1
MIRT023476 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT023477 PNN pinin, desmosome associated protein 1 1
MIRT023478 ARFIP1 ADP-ribosylation factor interacting protein 1 1 1
MIRT023479 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT023480 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT023481 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT023482 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT046240 SOS1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT046241 CATSPERB cation channel, sperm-associated, beta 1 1
MIRT046242 RPS27A ribosomal protein S27a 1 1
MIRT046243 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT046244 RBPMS2 RNA binding protein with multiple splicing 2 1 1
MIRT046245 HK1 hexokinase 1 1 1
MIRT046246 BCL7B B-cell CLL/lymphoma 7B 1 1
MIRT046247 MED13L mediator complex subunit 13-like 1 1
MIRT046248 ATXN10 ataxin 10 1 1
MIRT046249 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT046250 FLNA filamin A, alpha 1 1
MIRT046251 CUL4A cullin 4A 1 1
MIRT046252 ZNFX1 zinc finger, NFX1-type containing 1 1 1
MIRT046253 WDR54 WD repeat domain 54 1 1
MIRT046254 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT046255 HERC3 hect domain and RLD 3 1 1
MIRT046256 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT046257 CDK2 cyclin-dependent kinase 2 1 1
MIRT046258 RPL19 ribosomal protein L19 1 1
MIRT046259 ACTN4 actinin, alpha 4 1 1
MIRT046260 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT046261 DDX47 DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 1 1
MIRT046262 CEP104 KIAA0562 1 1
MIRT046263 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT046264 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT046265 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT046266 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT046267 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT046268 LASP1 LIM and SH3 protein 1 1 1
MIRT046269 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT046270 RRAGD Ras-related GTP binding D 1 1
MIRT046271 TCF25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT046272 FAM168B family with sequence similarity 168, member B 1 1
MIRT046273 BCS1L BCS1-like (yeast) 1 1
MIRT046274 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT046275 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT046276 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT046277 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT046278 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT046279 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT046280 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT046281 KDM1A lysine (K)-specific demethylase 1A 1 1
MIRT046282 SSRP1 structure specific recognition protein 1 1 1
MIRT046283 INPP4A inositol polyphosphate-4-phosphatase, type I, 107kDa 1 1
MIRT046284 SBF1 SET binding factor 1 1 1
MIRT046285 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT046286 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT046287 TCP1 t-complex 1 1 1
MIRT046288 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT046289 PI4KB phosphatidylinositol 4-kinase, catalytic, beta 1 1
MIRT046290 AMOTL1 angiomotin like 1 1 1
MIRT046291 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT046292 BCL2L1 BCL2-like 1 1 1
MIRT046293 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT046294 GANAB glucosidase, alpha; neutral AB 1 1
MIRT046295 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT046296 GJA1 gap junction protein, alpha 1, 43kDa 1 1
MIRT046297 COX1 cytochrome c oxidase subunit I 1 1
MIRT046298 HIST2H4B histone cluster 2, H4b 1 1
MIRT046299 CDCA8 cell division cycle associated 8 1 1
MIRT046300 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT046301 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT046302 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT046303 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT046304 AP4B1 adaptor-related protein complex 4, beta 1 subunit 1 1
MIRT046305 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT046306 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT046307 PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 1 1
MIRT046308 CLUAP1 clusterin associated protein 1 1 1
MIRT046309 CD302 CD302 molecule 1 1
MIRT046310 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT046311 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT046312 JAK1 Janus kinase 1 1 1
MIRT046313 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT046314 CYB561D1 cytochrome b-561 domain containing 1 1 1
MIRT046315 PRDX1 peroxiredoxin 1 1 1
MIRT046316 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT046317 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT046318 AARS2 alanyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT046319 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT046320 RPN2 ribophorin II 1 1
MIRT046321 C11orf68 chromosome 11 open reading frame 68 1 1
MIRT046322 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT046323 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT046324 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT046325 ITPR3 inositol 1,4,5-triphosphate receptor, type 3 1 1
MIRT046326 SYDE2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) 1 1
MIRT046327 PRR14L chromosome 22 open reading frame 30 1 1
MIRT046328 SUPT7L suppressor of Ty 7 (S. cerevisiae)-like 1 1
MIRT046329 BBS12 Bardet-Biedl syndrome 12 1 1
MIRT046330 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT046331 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046332 GHITM growth hormone inducible transmembrane protein 1 1
MIRT046333 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT046334 EP300 E1A binding protein p300 1 1
MIRT046335 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT046336 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT046337 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT046338 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT046339 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT046340 DONSON downstream neighbor of SON 1 1
MIRT046341 DNMBP dynamin binding protein 1 1
MIRT046342 KLHL2 kelch-like 2, Mayven (Drosophila) 1 1
MIRT046343 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 1 1
MIRT046344 KANSL1 KIAA1267 1 1
MIRT046345 COPA coatomer protein complex, subunit alpha 1 1
MIRT046346 PHF10 PHD finger protein 10 1 1
MIRT046347 CCNB2 cyclin B2 1 1
MIRT046348 LBR lamin B receptor 1 1
MIRT046349 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT046350 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT046351 RPL22 ribosomal protein L22 1 1
MIRT046352 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT046353 ITFG1 integrin alpha FG-GAP repeat containing 1 1 1
MIRT046354 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT046355 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT046356 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT046357 MAP4 microtubule-associated protein 4 1 1
MIRT046358 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 1 1
MIRT046359 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT046360 PSAP prosaposin 1 1
MIRT046361 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT046362 CLTA clathrin, light chain A 1 1
MIRT046363 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT046364 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT046365 TPCN1 two pore segment channel 1 1 1
MIRT046366 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT046367 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT046368 DGCR2 DiGeorge syndrome critical region gene 2 1 1
MIRT046369 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT046370 PANK2 pantothenate kinase 2 1 1
MIRT046371 USP31 ubiquitin specific peptidase 31 1 1
MIRT046372 NMT1 N-myristoyltransferase 1 1 1
MIRT046373 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT046374 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT046375 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT046376 GTF2I general transcription factor IIi 1 1
MIRT046377 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT046378 EMC1 KIAA0090 1 1
MIRT046379 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT046380 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1