Accession ID: MIRT001775 [miRNA, hsa-miR-23b-3p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-23bLinkOut: [miRBase ]
Synonyms MIRN23B, hsa-mir-23b, miRNA23B, MIR23B
Description Homo sapiens miR-23b stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-23b-3p
Mature Sequence 58| AUCACAUUGCCAGGGAUUACC |78
Evidence Experimental
Experiments Cloned
Putative hsa-miR-23b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccauUAGGGAC-C-GUUACACua 5'
              || |:|| |  ||||||  
Target 5' aagcATGCTTGTGAAAATGTGtt 3'
652 - 674 129.00 -9.00
2
miRNA  3' ccAUUAGGGACCG------UUACAcua 5'
            ||: |: ||||      |||||   
Target 5' taTAGCCTATGGCAGAAAAAATGTctg 3'
1226 - 1252 113.00 -8.61
3
miRNA  3' ccauUAGGGACCGUUACAcua 5'
              :|:|:| | |||||   
Target 5' gcccGTTCTT-GAAATGTagg 3'
802 - 821 112.00 -8.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23b-3p :: NOTCH1    [ Functional MTI ]
Validation Method Other , Reporter assay
Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
307 hsa-miR-23b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000125 OPRM1 opioid receptor, mu 1 1 2
MIRT001177 PRAP1 proline-rich acidic protein 1 3 1
MIRT001775 NOTCH1 notch 1 2 1
MIRT003424 E2F1 E2F transcription factor 1 2 1
MIRT003425 RB1 retinoblastoma 1 2 1
MIRT004291 PLAU plasminogen activator, urokinase 4 2
MIRT004292 MET met proto-oncogene (hepatocyte growth factor receptor) 4 1
MIRT006806 PRKACB protein kinase, cAMP-dependent, catalytic, beta 3 2
MIRT006963 PTK2B PTK2B protein tyrosine kinase 2 beta 0 1
MIRT007006 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 1
MIRT007039 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT007040 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT007041 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007051 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 1 1
MIRT007096 PTEN phosphatase and tensin homolog 1 1
MIRT023464 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT023465 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023466 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT023467 ZIC5 Zic family member 5 1 1
MIRT023468 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT023469 KIAA1279 KIAA1279 1 1
MIRT023470 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT023471 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT023472 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT023473 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023474 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 2
MIRT023475 MED4 mediator complex subunit 4 1 1
MIRT023476 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT023477 PNN pinin, desmosome associated protein 1 1
MIRT023478 ARFIP1 ADP-ribosylation factor interacting protein 1 1 1
MIRT023479 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT023480 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT023481 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT023482 MCFD2 multiple coagulation factor deficiency 2 1 2
MIRT046240 SOS1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT046241 CATSPERB catsper channel auxiliary subunit beta 1 1
MIRT046242 RPS27A ribosomal protein S27a 1 1
MIRT046243 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT046244 RBPMS2 RNA binding protein with multiple splicing 2 1 1
MIRT046245 HK1 hexokinase 1 1 1
MIRT046246 BCL7B B-cell CLL/lymphoma 7B 1 1
MIRT046247 MED13L mediator complex subunit 13-like 1 1
MIRT046248 ATXN10 ataxin 10 1 1
MIRT046249 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT046250 FLNA filamin A, alpha 1 1
MIRT046251 CUL4A cullin 4A 1 1
MIRT046252 ZNFX1 zinc finger, NFX1-type containing 1 1 1
MIRT046253 WDR54 WD repeat domain 54 1 1
MIRT046254 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT046255 HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 1 1
MIRT046256 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT046257 CDK2 cyclin-dependent kinase 2 1 1
MIRT046258 RPL19 ribosomal protein L19 1 1
MIRT046259 ACTN4 actinin, alpha 4 1 1
MIRT046260 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT046261 DDX47 DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 1 1
MIRT046262 CEP104 centrosomal protein 104kDa 1 1
MIRT046263 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT046264 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT046265 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT046266 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT046267 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT046268 LASP1 LIM and SH3 protein 1 1 1
MIRT046269 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT046270 RRAGD Ras-related GTP binding D 1 1
MIRT046271 TCF25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT046272 FAM168B family with sequence similarity 168, member B 1 1
MIRT046273 BCS1L BC1 (ubiquinol-cytochrome c reductase) synthesis-like 1 1
MIRT046274 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT046275 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT046276 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT046277 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT046278 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT046279 SLC9A6 solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6 1 1
MIRT046280 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT046281 KDM1A lysine (K)-specific demethylase 1A 1 1
MIRT046282 SSRP1 structure specific recognition protein 1 1 1
MIRT046283 INPP4A inositol polyphosphate-4-phosphatase, type I, 107kDa 1 1
MIRT046284 SBF1 SET binding factor 1 1 1
MIRT046285 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT046286 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT046287 TCP1 t-complex 1 1 1
MIRT046288 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT046289 PI4KB phosphatidylinositol 4-kinase, catalytic, beta 1 1
MIRT046290 AMOTL1 angiomotin like 1 1 1
MIRT046291 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT046292 BCL2L1 BCL2-like 1 1 1
MIRT046293 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT046294 GANAB glucosidase, alpha; neutral AB 1 1
MIRT046295 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT046296 GJA1 gap junction protein, alpha 1, 43kDa 1 1
MIRT046297 COX1 cytochrome c oxidase subunit I 1 1
MIRT046298 HIST2H4B histone cluster 2, H4b 1 1
MIRT046299 CDCA8 cell division cycle associated 8 1 1
MIRT046300 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT046301 PLOD1 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT046302 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT046303 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT046304 AP4B1 adaptor-related protein complex 4, beta 1 subunit 1 1
MIRT046305 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT046306 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT046307 PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 1 1
MIRT046308 CLUAP1 clusterin associated protein 1 1 1
MIRT046309 CD302 CD302 molecule 1 1
MIRT046310 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT046311 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT046312 JAK1 Janus kinase 1 1 1
MIRT046313 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT046314 CYB561D1 cytochrome b-561 domain containing 1 1 1
MIRT046315 PRDX1 peroxiredoxin 1 1 1
MIRT046316 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT046317 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT046318 AARS2 alanyl-tRNA synthetase 2, mitochondrial 1 1
MIRT046319 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT046320 RPN2 ribophorin II 1 1
MIRT046321 C11orf68 chromosome 11 open reading frame 68 1 1
MIRT046322 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT046323 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT046324 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT046325 ITPR3 inositol 1,4,5-trisphosphate receptor, type 3 1 1
MIRT046326 SYDE2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) 1 1
MIRT046327 PRR14L proline rich 14-like 1 1
MIRT046328 SUPT7L suppressor of Ty 7 (S. cerevisiae)-like 1 1
MIRT046329 BBS12 Bardet-Biedl syndrome 12 1 1
MIRT046330 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT046331 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046332 GHITM growth hormone inducible transmembrane protein 1 1
MIRT046333 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT046334 EP300 E1A binding protein p300 1 1
MIRT046335 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT046336 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT046337 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT046338 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT046339 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT046340 DONSON downstream neighbor of SON 1 1
MIRT046341 DNMBP dynamin binding protein 1 1
MIRT046342 KLHL2 kelch-like 2, Mayven (Drosophila) 1 1
MIRT046343 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 1 1
MIRT046344 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT046345 COPA coatomer protein complex, subunit alpha 1 1
MIRT046346 PHF10 PHD finger protein 10 1 1
MIRT046347 CCNB2 cyclin B2 1 1
MIRT046348 LBR lamin B receptor 1 1
MIRT046349 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT046350 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT046351 RPL22 ribosomal protein L22 1 1
MIRT046352 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT046353 ITFG1 integrin alpha FG-GAP repeat containing 1 1 1
MIRT046354 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT046355 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT046356 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT046357 MAP4 microtubule-associated protein 4 1 1
MIRT046358 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT046359 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT046360 PSAP prosaposin 1 1
MIRT046361 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT046362 CLTA clathrin, light chain A 1 1
MIRT046363 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT046364 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT046365 TPCN1 two pore segment channel 1 1 1
MIRT046366 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT046367 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT046368 DGCR2 DiGeorge syndrome critical region gene 2 1 1
MIRT046369 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT046370 PANK2 pantothenate kinase 2 1 1
MIRT046371 USP31 ubiquitin specific peptidase 31 1 1
MIRT046372 NMT1 N-myristoyltransferase 1 1 1
MIRT046373 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT046374 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT046375 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT046376 GTF2I general transcription factor IIi 1 1
MIRT046377 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT046378 EMC1 ER membrane protein complex subunit 1 1 1
MIRT046379 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT046380 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT053244 ZEB1 zinc finger E-box binding homeobox 1 2 1
MIRT054308 TUSC7 LSAMP antisense RNA 3 5 1
MIRT054635 RUNX2 runt-related transcription factor 2 3 1
MIRT064147 TSNAX translin-associated factor X 1 1
MIRT066948 ATXN7L3B ataxin 7-like 3B 1 4
MIRT067321 SESN2 sestrin 2 1 2
MIRT074334 TNRC6A trinucleotide repeat containing 6A 1 3
MIRT097059 TNPO1 transportin 1 1 1
MIRT110338 ADD3 adducin 3 (gamma) 1 1
MIRT133659 ETNK1 ethanolamine kinase 1 1 1
MIRT134660 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT156700 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT213995 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT235221 ZNF257 zinc finger protein 257 1 4
MIRT266430 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT269204 FUT4 fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific) 1 1
MIRT281197 SEMA6D sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D 1 1
MIRT322936 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT323483 CA2 carbonic anhydrase II 3 1
MIRT326651 ZNF275 zinc finger protein 275 1 2
MIRT332709 QSER1 glutamine and serine rich 1 1 1
MIRT399756 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT437896 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT438004 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT438260 HMGA2 high mobility group AT-hook 2 1 1
MIRT438321 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT438322 NOTCH2 notch 2 3 1
MIRT438323 HMGB2 high mobility group box 2 4 3
MIRT438324 ATG12 autophagy related 12 3 2
MIRT448266 ZNF704 zinc finger protein 704 1 4
MIRT461717 ZNF426 zinc finger protein 426 1 1
MIRT462563 STS steroid sulfatase (microsomal), isozyme S 1 1
MIRT466131 TMEM170A transmembrane protein 170A 1 1
MIRT466154 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT466970 STARD7 StAR-related lipid transfer (START) domain containing 7 1 2
MIRT468567 SERINC3 serine incorporator 3 1 6
MIRT468708 SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 1 1
MIRT471442 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT471789 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT472552 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT474686 KLF10 Kruppel-like factor 10 1 1
MIRT479114 CNN2 calponin 2 1 1
MIRT480259 C8orf58 chromosome 8 open reading frame 58 1 1
MIRT485406 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 2
MIRT493595 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT499305 ZNF485 zinc finger protein 485 1 5
MIRT499480 ZNF669 zinc finger protein 669 1 3
MIRT500384 ZNF281 zinc finger protein 281 1 3
MIRT500593 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 2
MIRT501539 POM121C POM121 transmembrane nucleoporin C 1 3
MIRT502717 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT504207 VAV3 vav 3 guanine nucleotide exchange factor 1 6
MIRT504351 VCAM1 vascular cell adhesion molecule 1 1 4
MIRT507519 DSTN destrin (actin depolymerizing factor) 1 2
MIRT510410 ZNF268 zinc finger protein 268 1 2
MIRT513494 SSR1 signal sequence receptor, alpha 1 3
MIRT514676 ZNF701 zinc finger protein 701 1 2
MIRT515105 ZNF578 zinc finger protein 578 1 3
MIRT515366 ZNF208 zinc finger protein 208 1 3
MIRT523134 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 3
MIRT524023 DOCK4 dedicator of cytokinesis 4 1 2
MIRT526726 ZNF138 zinc finger protein 138 1 2
MIRT527297 KIAA1210 KIAA1210 1 1
MIRT527774 DNAJC21 DnaJ (Hsp40) homolog, subfamily C, member 21 1 1
MIRT527957 MTAP methylthioadenosine phosphorylase 1 1
MIRT528476 STAMBPL1 STAM binding protein-like 1 1 1
MIRT528677 CEP57L1 centrosomal protein 57kDa-like 1 1 1
MIRT529968 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) 1 1
MIRT530628 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 2
MIRT531700 ADAM28 ADAM metallopeptidase domain 28 1 1
MIRT532126 NOL11 nucleolar protein 11 1 1
MIRT533565 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT534695 RNF111 ring finger protein 111 1 1
MIRT535234 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT535673 NLGN4X neuroligin 4, X-linked 1 1
MIRT536168 MAP1B microtubule-associated protein 1B 1 1
MIRT536574 JMJD1C jumonji domain containing 1C 1 1
MIRT537660 ERBB2IP erbb2 interacting protein 1 1
MIRT539515 ACSS3 acyl-CoA synthetase short-chain family member 3 1 1
MIRT549738 ZNF273 zinc finger protein 273 1 1
MIRT549945 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT551461 TRIM59 tripartite motif containing 59 1 1
MIRT552500 ZIK1 zinc finger protein interacting with K protein 1 homolog (mouse) 1 1
MIRT552596 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT553492 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT557973 FAM222B family with sequence similarity 222, member B 1 1
MIRT562010 LMNB1 lamin B1 1 1
MIRT564154 ZNF117 zinc finger protein 117 1 1
MIRT565001 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT565258 TPM3 tropomyosin 3 1 1
MIRT565966 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT566189 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT566924 LMAN2 lectin, mannose-binding 2 1 1
MIRT573022 SWAP70 SWAP switching B-cell complex 70kDa subunit 1 1
MIRT574869 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT574946 Vav3 vav 3 oncogene 1 1
MIRT611159 BTLA B and T lymphocyte associated 1 1
MIRT611238 ZNF550 zinc finger protein 550 1 2
MIRT611619 SLC35G3 solute carrier family 35, member G3 1 1
MIRT617562 RPSAP58 ribosomal protein SA pseudogene 58 1 2
MIRT623715 HAPLN1 hyaluronan and proteoglycan link protein 1 1 1
MIRT623970 FBN2 fibrillin 2 1 1
MIRT624023 EN2 engrailed homeobox 2 1 1
MIRT625208 TNFAIP8 tumor necrosis factor, alpha-induced protein 8 1 2
MIRT630782 CRLS1 cardiolipin synthase 1 1 1
MIRT631658 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT642821 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT642994 SNTG1 syntrophin, gamma 1 1 1
MIRT646025 S100A7A S100 calcium binding protein A7A 1 1
MIRT651178 ZNF319 zinc finger protein 319 1 1
MIRT652569 TLR6 toll-like receptor 6 1 1
MIRT652688 THUMPD3 THUMP domain containing 3 1 1
MIRT652805 TBL2 transducin (beta)-like 2 1 1
MIRT658074 FOXR2 forkhead box R2 1 1
MIRT668317 FNIP1 folliculin interacting protein 1 1 1
MIRT669082 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT683292 ZNF253 zinc finger protein 253 1 1
MIRT683827 ZNF682 zinc finger protein 682 1 1
MIRT686223 ZNF267 zinc finger protein 267 1 1
MIRT687152 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT687164 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT697749 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT698110 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT700085 RNF38 ring finger protein 38 1 1
MIRT701910 MMGT1 membrane magnesium transporter 1 1 1
MIRT702053 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705919 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707570 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 1
MIRT709246 CENPM centromere protein M 1 1
MIRT710505 BSDC1 BSD domain containing 1 1 1
MIRT720193 MPP6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1 1
MIRT723229 FAM91A1 family with sequence similarity 91, member A1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*