Accession ID: MIRT001779 [miRNA, hsa-miR-222-3p :: KIT, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-222LinkOut: [miRBase ]
Synonyms MIRN222, miRNA222, mir-222, MIR222
Description Homo sapiens miR-222 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-222-3p
Mature Sequence 69| AGCUACAUCUGGCUACUGGGU |89
Evidence Experimental
Experiments Cloned
Putative hsa-miR-222-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KIT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-Kit, CD117, PBT, SCFR
Description v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Transcript NM_0002    LinkOut: [ RefSeq ]
Other Transcripts NM_0010937   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KIT LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KIT
(miRNA target sites are highlighted)
>KIT|NM_0002|3'UTR
   1 TGAGCAGAATCAGTGTTTGGGTCACCCCTCCAGGAATGATCTCTTCTTTTGGCTTCCATGATGGTTATTTTCTTTTCTTT
  81 CAACTTGCATCCAACTCCAGGATAGTGGGCACCCCACTGCAATCCTGTCTTTCTGAGCACACTTTAGTGGCCGATGATTT
 161 TTGTCATCAGCCACCATCCTATTGCAAAGGTTCCAACTGTATATATTCCCAATAGCAACGTAGCTTCTACCATGAACAGA
 241 AAACATTCTGATTTGGAAAAAGAGAGGGAGGTATGGACTGGGGGCCAGAGTCCTTTCCAAGGCTTCTCCAATTCTGCCCA
 321 AAAATATGGTTGATAGTTTACCTGAATAAATGGTAGTAATCACAGTTGGCCTTCAGAACCATCCATAGTAGTATGATGAT
 401 ACAAGATTAGAAGCTGAAAACCTAAGTCCTTTATGTGGAAAACAGAACATCATTAGAACAAAGGACAGAGTATGAACACC
 481 TGGGCTTAAGAAATCTAGTATTTCATGCTGGGAATGAGACATAGGCCATGAAAAAAATGATCCCCAAGTGTGAACAAAAG
 561 ATGCTCTTCTGTGGACCACTGCATGAGCTTTTATACTACCGACCTGGTTTTTAAATAGAGTTTGCTATTAGAGCATTGAA
 641 TTGGAGAGAAGGCCTCCCTAGCCAGCACTTGTATATACGCATCTATAAATTGTCCGTGTTCATACATTTGAGGGGAAAAC
 721 ACCATAAGGTTTCGTTTCTGTATACAACCCTGGCATTATGTCCACTGTGTATAGAAGTAGATTAAGAGCCATATAAGTTT
 801 GAAGGAAACAGTTAATACCATTTTTTAAGGAAACAATATAACCACAAAGCACAGTTTGAACAAAATCTCCTCTTTTAGCT
 881 GATGAACTTATTCTGTAGATTCTGTGGAACAAGCCTATCAGCTTCAGAATGGCATTGTACTCAATGGATTTGATGCTGTT
 961 TGACAAAGTTACTGATTCACTGCATGGCTCCCACAGGAGTGGGAAAACACTGCCATCTTAGTTTGGATTCTTATGTAGCA
1041 GGAAATAAAGTATAGGTTTAGCCTCCTTCGCAGGCATGTCCTGGACACCGGGCCAGTATCTATATATGTGTATGTACGTT
1121 TGTATGTGTGTAGACAAATATTTGGAGGGGTATTTTTGCCCTGAGTCCAAGAGGGTCCTTTAGTACCTGAAAAGTAACTT
1201 GGCTTTCATTATTAGTACTGCTCTTGTTTCTTTTCACATAGCTGTCTAGAGTAGCTTACCAGAAGCTTCCATAGTGGTGC
1281 AGAGGAAGTGGAAGGCATCAGTCCCTATGTATTTGCAGTTCACCTGCACTTAAGGCACTCTGTTATTTAGACTCATCTTA
1361 CTGTACCTGTTCCTTAGACCTTCCATAATGCTACTGTCTCACTGAAACATTTAAATTTTACCCTTTAGACTGTAGCCTGG
1441 ATATTATTCTTGTAGTTTACCTCTTTAAAAACAAAACAAAACAAAACAAAAAACTCCCCTTCCTCACTGCCCAATATAAA
1521 AGGCAAATGTGTACATGGCAGAGTTTGTGTGTTGTCTTGAAAGATTCAGGTATGTTGCCTTTATGGTTTCCCCCTTCTAC
1601 ATTTCTTAGACTACATTTAGAGAACTGTGGCCGTTATCTGGAAGTAACCATTTGCACTGGAGTTCTATGCTCTCGCACCT
1681 TTCCAAAGTTAACAGATTTTGGGGTTGTGTTGTCACCCAAGAGATTGTTGTTTGCCATACTTTGTCTGAAAAATTCCTTT
1761 GTGTTTCTATTGACTTCAATGATAGTAAGAAAAGTGGTTGTTAGTTATAGATGTCTAGGTACTTCAGGGGCACTTCATTG
1841 AGAGTTTTGTCTTGGATATTCTTGAAAGTTTATATTTTTATAATTTTTTCTTACATCAGATGTTTCTTTGCAGTGGCTTA
1921 ATGTTTGAAATTATTTTGTGGCTTTTTTTGTAAATATTGAAATGTAGCAATAATGTCTTTTGAATATTCCCAAGCCCATG
2001 AGTCCTTGAAAATATTTTTTATATATACAGTAACTTTATGTGTAAATACATAAGCGGCGTAAGTTTAAAGGATGTTGGTG
2081 TTCCACGTGTTTTATTCCTGTATGTTGTCCAATTGTTGACAGTTCTGAAGAATTCTAATAAAATGTACATATATAAATCA
2161 AAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugggUCAUCGGUCUACAUCGa 5'
              | || : | ||||||| 
Target 5' tgtaAATATTGAAATGTAGCa 3'
1949 - 1969 149.00 -6.60
2
miRNA  3' ugGGUCA----UCGGUCUACAUCGa 5'
            ::|||    | :|  ||||||| 
Target 5' tcTTAGTTTGGATTCTTATGTAGCa 3'
1016 - 1040 145.00 -11.60
3
miRNA  3' ugGGUCAUCGGUCUACAUCGa 5'
            ||| ||| || | ||||| 
Target 5' tcCCAATAG-CA-ACGTAGCt 3'
207 - 225 129.00 -16.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: KIT    [ Functional MTI ]
Validation Method Other , Reporter assay
Article - Felli, N. Fontana, L. Pelosi, E. Botta, R. et al.
- Proc Natl Acad Sci U S A, 2005
MicroRNAs (miRs) are small noncoding RNAs that regulate gene expression primarily through translational repression. In erythropoietic (E) culture of cord blood CD34+ progenitor cells, the level of miR 221 and 222 is gradually and sharply down-modulated. Hypothetically, this decline could promote erythropoiesis by unblocking expression of key functional proteins. Indeed, (i) bioinformatic analysis suggested that miR 221 and 222 target the 3' UTR of kit mRNA; (ii) the luciferase assay confirmed that both miRs directly interact with the kit mRNA target site; and (iii) in E culture undergoing exponential cell growth, miR down-modulation is inversely related to increasing kit protein expression, whereas the kit mRNA level is relatively stable. Functional studies show that treatment of CD34+ progenitors with miR 221 and 222, via oligonucleotide transfection or lentiviral vector infection, causes impaired proliferation and accelerated differentiation of E cells, coupled with down-modulation of kit protein: this phenomenon, observed in E culture releasing endogenous kit ligand, is magnified in E culture supplemented with kit ligand. Furthermore, transplantation experiments in NOD-SCID mice reveal that miR 221 and 222 treatment of CD34+ cells impairs their engraftment capacity and stem cell activity. Finally, miR 221 and 222 gene transfer impairs proliferation of the kit+ TF-1 erythroleukemic cell line. Altogether, our studies indicate that the decline of miR 221 and 222 during exponential E growth unblocks kit protein production at mRNA level, thus leading to expansion of early erythroblasts. Furthermore, the results on kit+ erythroleukemic cells suggest a potential role of these miRs in cancer therapy.
LinkOut: [PMID: 16330772]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: KIT    [ Functional MTI ]
Validation Method Northern blot , qRT-PCR , Western blot
Conditions PTC
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... Both forms of Kit were readily detected in normal thyroid tissue but were strongly reduced or absent in the four samples showing strong reduction of KIT transcript.//strong overexpression of miRs-221, -222, and -146b in these four PTC patient samples. ...

- He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al., 2005, Proc Natl Acad Sci U S A.

Article - He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al.
- Proc Natl Acad Sci U S A, 2005
Apart from alterations in the RET/PTC-RAS-BRAF pathway, comparatively little is known about the genetics of papillary thyroid carcinoma (PTC). We show that numerous microRNAs (miRNAs) are transcriptionally up-regulated in PTC tumors compared with unaffected thyroid tissue. A set of five miRNAs, including the three most up-regulated ones (miR-221, -222, and -146), distinguished unequivocally between PTC and normal thyroid. Additionally, miR-221 was up-regulated in unaffected thyroid tissue in several PTC patients, presumably an early event in carcinogenesis. Tumors in which the up-regulation (11- to 19-fold) of miR-221, -222, and -146 was strongest showed dramatic loss of KIT transcript and Kit protein. In 5 of 10 such cases, this down expression was associated with germline single-nucleotide changes in the two recognition sequences in KIT for these miRNAs. We conclude that up-regulation of several miRs and regulation of KIT are involved in PTC pathogenesis, and that sequence changes in genes targeted by miRNAs can contribute to their regulation.
LinkOut: [PMID: 16365291]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: KIT    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Garofalo, M. Quintavalle, C. Di Leva, G. et al.
- Oncogene, 2008
To define novel pathways that regulate susceptibility to tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in non-small cell lung cancer (NSCLC), we have performed genome-wide expression profiling of microRNAs (miRs). We show that in TRAIL-resistant NSCLC cells, levels of different miRs are increased, and in particular, miR-221 and -222. We demonstrate that these miRs impair TRAIL-dependent apoptosis by inhibiting the expression of key functional proteins. Indeed, transfection with anti-miR-221 and -222 rendered CALU-1-resistant cells sensitive to TRAIL. Conversely, H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of Kit and p27(kip1) mRNAs, but interfere with TRAIL signaling mainly through p27(kip1). In conclusion, we show that high expression levels of miR-221 and -222 are needed to maintain the TRAIL-resistant phenotype, thus making these miRs as promising therapeutic targets or diagnostic tool for TRAIL resistance in NSCLC.
LinkOut: [PMID: 18246122]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: KIT    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions Human melanoma cell lines
Disease melanoma;
Location of target site 3'UTR
Tools used in this research PicTar , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Moreover, we provide evidences of miR-221 and miR-222 capabilities to regulate two distinct but functionally convergent pathways of melanocyte transformation through the cyclin-dependent kinase inhibitor 1B (p27Kip1/CDKN1B) on one side and c-KIT and its downstream genes on the other.//The c-KIT receptor is a melanocytic multifunctional player regulating melanogenesis, cell growth, migration, and survival (14). This receptor is directly targeted by miR-221/-222 in normal erythropoiesis (13) and neoangiogenesis (32), as well as in papillary thyroid carcinoma (9). ...

- Felicetti, F. Errico, M. C. Bottero, L. et al., 2008, Cancer Res.

Article - Felicetti, F. Errico, M. C. Bottero, L. et al.
- Cancer Res, 2008
The incidence of cutaneous melanoma is steadily increasing. Although several molecular abnormalities have been associated with melanoma progression, the mechanisms underlying the differential gene expression are still largely unknown and targeted therapies are not yet available. Noncoding small RNAs, termed microRNAs (miR), have been recently reported to play important roles in major cellular processes, including those involved in cancer development and progression. We have identified the promyelocytic leukemia zinc finger (PLZF) transcription factor as a repressor of miR-221 and miR-222 by direct binding to their putative regulatory region. Specifically, PLZF silencing in melanomas unblocks miR-221 and miR-222, which in turn controls the progression of the neoplasia through down-modulation of p27Kip1/CDKN1B and c-KIT receptor, leading to enhanced proliferation and differentiation blockade of the melanoma cells, respectively. In vitro and in vivo functional studies, including the use of antisense "antagomir" oligonucleotides, confirmed the key role of miR-221/-222 in regulating the progression of human melanoma; this suggests that targeted therapies suppressing miR-221/-222 may prove beneficial in advanced melanoma.
LinkOut: [PMID: 18417445]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: KIT    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Felicetti, F. Errico, M. C. Segnalini, P. et al.
- Expert Rev Anticancer Ther, 2008
MicroRNAs (miRNAs) represent a new family of small noncoding RNAs that negatively regulate gene expression. Recent studies demonstrated miRNA involvement in all the main biological processes, including tumor development as a consequence of an aberrant deregulated expression. Growing evidence is showing the capability of miRNA expression profiles to unequivocally distinguish between normal and neoplastic tissues, leading to the identification of new diagnostic and/or prognostic molecular markers. In addition, miRNAs might eventually represent new targets to aim at as innovative therapeutic approaches, particularly relevant in those types of cancer, such as melanoma, which are still lacking effective traditional therapies. In particular, the inhibition of miRNA-221 and -222, which are abnormally expressed in melanoma and favor the induction of the malignant phenotype by downregulating c-KIT receptor and p27Kip, might in the future represent an efficient treatment for translation into the clinical setting.
LinkOut: [PMID: 18983236]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-222-3p :: KIT    [ Functional MTI ]
Validation Method Other
Article - Pallante, P. Visone, R. Croce, C. M. Fusco, A.
- Endocr Relat Cancer, 2010
Carcinoma of the thyroid gland is an uncommon cancer, but one of the most frequent malignancies of the endocrine system. Most thyroid cancers are derived from the follicular cells. Follicular carcinoma is considered more malignant than papillary thyroid carcinoma (PTC), and anaplastic thyroid cancer (ATC) is one of the most lethal human cancers. Even though several genetic lesions have been already described in human thyroid cancer, particularly in the papillary histotype, the mechanisms underlying the development of these neoplasias are still far from being completely elucidated. Some years ago, several studies were undertaken to analyze the expression of microRNAs (miRNAs or miRs) in thyroid carcinoma to evaluate a possible role of their deregulation in the process of carcinogenesis. These studies showed an aberrant microRNA expression profile that distinguishes unequivocally among PTC, ATC, and normal thyroid tissue. Here, other than summarizing the current findings on microRNA expression in human thyroid carcinomas, we discuss the mechanisms by which microRNA deregulation may play a role in thyroid carcinogenesis, and the possible use of microRNA knowledge in the diagnosis and therapy of thyroid neoplasms.
LinkOut: [PMID: 19942715]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
292 hsa-miR-222-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000018 STAT5A signal transducer and activator of transcription 5A 4 1
MIRT000131 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 5 20
MIRT000134 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT000135 SOD2 superoxide dismutase 2, mitochondrial 5 1
MIRT000136 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 5 1
MIRT000433 FOXO3 forkhead box O3 4 1
MIRT000719 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 4 4
MIRT001779 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 4 8
MIRT002334 TMED7 transmembrane emp24 protein transport domain containing 7 3 8
MIRT003191 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 4 3
MIRT003451 TIMP3 TIMP metallopeptidase inhibitor 3 3 4
MIRT003756 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 2 1
MIRT004485 FOS FBJ murine osteosarcoma viral oncogene homolog 4 2
MIRT004595 ICAM1 intercellular adhesion molecule 1 1 2
MIRT005321 ESR1 estrogen receptor 1 4 1
MIRT005369 BBC3 BCL2 binding component 3 3 2
MIRT005586 PTEN phosphatase and tensin homolog 4 3
MIRT005715 SELE selectin E 1 1
MIRT005786 TP53 tumor protein p53 2 2
MIRT005791 CORO1A coronin, actin binding protein, 1A 2 2
MIRT005792 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT006019 DIRAS3 DIRAS family, GTP-binding RAS-like 3 3 1
MIRT006064 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 2
MIRT006377 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006728 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT006842 TRPS1 trichorhinophalangeal syndrome I 4 1
MIRT006918 CERS2 LAG1 homolog, ceramide synthase 2 3 1
MIRT046572 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT046573 SLC25A36 solute carrier family 25, member 36 1 1
MIRT046574 KITLG KIT ligand 1 1
MIRT046575 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT046576 TEX10 testis expressed 10 1 1
MIRT046577 MROH8 chromosome 20 open reading frame 132 1 1
MIRT046578 ATP11B ATPase, class VI, type 11B 1 1
MIRT046579 THOP1 thimet oligopeptidase 1 1 1
MIRT046580 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT046581 ZFYVE16 zinc finger, FYVE domain containing 16 1 1
MIRT046582 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT046583 PRDX4 peroxiredoxin 4 1 1
MIRT046584 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT046585 TCEB2 transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) 1 1
MIRT046586 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT046587 PAN2 PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1
MIRT046588 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT046589 ACTB actin, beta 1 1
MIRT046590 ZNF772 zinc finger protein 772 1 1
MIRT046591 DMWD dystrophia myotonica, WD repeat containing 1 1
MIRT046592 RABL6 chromosome 9 open reading frame 86 1 1
MIRT046593 NCKAP5L NCK-associated protein 5-like 1 1
MIRT046594 CDK18 cyclin-dependent kinase 18 1 1
MIRT046595 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT046596 TOM1 target of myb1 (chicken) 1 1
MIRT046597 HIST2H4B histone cluster 2, H4b 1 1
MIRT046598 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 1 1
MIRT046599 IRS4 insulin receptor substrate 4 1 1
MIRT046600 RBM15B RNA binding motif protein 15B 1 1
MIRT046601 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT046602 KIF3B kinesin family member 3B 1 1
MIRT046603 IPO5 importin 5 1 1
MIRT046604 GDI2 GDP dissociation inhibitor 2 1 1
MIRT046605 HDLBP high density lipoprotein binding protein 1 1
MIRT046606 DAZAP1 DAZ associated protein 1 1 1
MIRT046607 FAM53C family with sequence similarity 53, member C 1 1
MIRT046608 COIL coilin 1 1
MIRT046609 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT046610 SAPCD2 chromosome 9 open reading frame 140 1 1
MIRT046611 AUTS2 autism susceptibility candidate 2 1 1
MIRT046612 DERA 2-deoxyribose-5-phosphate aldolase homolog (C. elegans) 1 1
MIRT046613 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT046614 VCP valosin-containing protein 1 1
MIRT046615 UHRF2 ubiquitin-like with PHD and ring finger domains 2 1 1
MIRT046616 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT046617 MINK1 misshapen-like kinase 1 (zebrafish) 1 1
MIRT046618 KPNB1 karyopherin (importin) beta 1 1 1
MIRT046619 SERTAD4 SERTA domain containing 4 1 1
MIRT046620 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT046621 PDXDC1 pyridoxal-dependent decarboxylase domain containing 1 1 1
MIRT046622 FYTTD1 forty-two-three domain containing 1 1 1
MIRT046623 SON SON DNA binding protein 1 1
MIRT046624 RPS17 ribosomal protein S17 1 1
MIRT046625 HES1 hairy and enhancer of split 1, (Drosophila) 1 1
MIRT046626 MGAT4B mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B 1 1
MIRT046627 SMC6 structural maintenance of chromosomes 6 1 1
MIRT046628 TMUB1 transmembrane and ubiquitin-like domain containing 1 1 1
MIRT046629 ZW10 ZW10, kinetochore associated, homolog (Drosophila) 1 1
MIRT046630 BAG6 HLA-B associated transcript 3 1 1
MIRT046631 MROH1 HEAT repeat containing 7A 1 1
MIRT046632 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT046633 CASC3 cancer susceptibility candidate 3 1 1
MIRT046634 NSUN5 NOP2/Sun domain family, member 5 1 1
MIRT046635 CCDC47 coiled-coil domain containing 47 1 1
MIRT046636 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT046637 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT046638 HDGF hepatoma-derived growth factor 1 1
MIRT046639 TOP3A topoisomerase (DNA) III alpha 1 1
MIRT046640 EIF3I eukaryotic translation initiation factor 3, subunit I 1 1
MIRT046641 DBNL drebrin-like 1 1
MIRT046642 TLN1 talin 1 1 1
MIRT046643 RPL8 ribosomal protein L8 1 1
MIRT046644 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT046645 TRMT5 TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) 1 1
MIRT046646 ACACA acetyl-CoA carboxylase alpha 1 1
MIRT046647 MAP1B microtubule-associated protein 1B 1 1
MIRT046648 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT046649 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT046650 RPL12 ribosomal protein L12 1 1
MIRT046651 ZNF708 zinc finger protein 708 1 1
MIRT046652 CSNK1G1 casein kinase 1, gamma 1 1 1
MIRT046653 SART1 squamous cell carcinoma antigen recognized by T cells 1 1
MIRT046654 VCL vinculin 1 1
MIRT046655 HMGA1 high mobility group AT-hook 1 1 1
MIRT046656 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT046657 CDKL5 cyclin-dependent kinase-like 5 1 1
MIRT046658 SETD1B SET domain containing 1B 1 1
MIRT046659 SAP30L SAP30-like 1 1
MIRT046660 GLRX5 glutaredoxin 5 1 1
MIRT046661 SLC25A51 mitochondrial carrier triple repeat 1 1 1
MIRT046662 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT046663 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT046664 TRIM44 tripartite motif-containing 44 1 1
MIRT046665 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT046666 RNF215 ring finger protein 215 1 1
MIRT046667 FASN fatty acid synthase 1 1
MIRT046668 SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 1 1
MIRT046669 STOX2 storkhead box 2 1 1
MIRT046670 SHISA2 shisa homolog 2 (Xenopus laevis) 1 1
MIRT046671 EXOSC10 exosome component 10 1 1
MIRT046672 RPS2 ribosomal protein S2 1 1
MIRT046673 PRRC2A HLA-B associated transcript 2 1 1
MIRT046674 LRP10 low density lipoprotein receptor-related protein 10 1 1
MIRT046675 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT046676 HOXA13 homeobox A13 1 1
MIRT046677 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT046678 ZNF714 zinc finger protein 714 1 1
MIRT046679 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT046680 PKM pyruvate kinase, muscle 1 1
MIRT046681 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT046682 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT046683 NGRN neugrin, neurite outgrowth associated 1 1
MIRT046684 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT046685 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT046686 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT046687 TANGO6 transmembrane and coiled-coil domains 7 1 1
MIRT046688 PCBP2 poly(rC) binding protein 2 1 1
MIRT046689 CANX calnexin 1 1
MIRT046690 XPO6 exportin 6 1 1
MIRT046691 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT046692 CEP250 centrosomal protein 250kDa 1 1
MIRT046693 IARS isoleucyl-tRNA synthetase 1 1
MIRT046694 ZNF770 zinc finger protein 770 1 1
MIRT046695 NARS asparaginyl-tRNA synthetase 1 1
MIRT046696 SPTBN2 spectrin, beta, non-erythrocytic 2 1 1
MIRT046697 GTF3C5 general transcription factor IIIC, polypeptide 5, 63kDa 1 1
MIRT046698 GDI1 GDP dissociation inhibitor 1 1 1
MIRT046699 SV2A synaptic vesicle glycoprotein 2A 1 1
MIRT046700 PELI2 pellino homolog 2 (Drosophila) 1 1
MIRT046701 SKIV2L superkiller viralicidic activity 2-like (S. cerevisiae) 1 1
MIRT046702 SLC37A4 solute carrier family 37 (glucose-6-phosphate transporter), member 4 1 1
MIRT046703 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT046704 CLDN23 claudin 23 1 1
MIRT046705 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 1 1
MIRT046706 SLFN11 schlafen family member 11 1 1
MIRT046707 PFN1 profilin 1 1 1
MIRT046708 UROD uroporphyrinogen decarboxylase 1 1
MIRT046709 USP15 ubiquitin specific peptidase 15 1 1
MIRT046710 MCM7 minichromosome maintenance complex component 7 1 1
MIRT046711 SCARB2 scavenger receptor class B, member 2 1 1
MIRT046712 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT046713 CASKIN2 CASK interacting protein 2 1 1
MIRT046714 GRB10 growth factor receptor-bound protein 10 1 1
MIRT046715 NSMF nasal embryonic LHRH factor 1 1
MIRT046716 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT046717 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT046718 RNF10 ring finger protein 10 1 1
MIRT046719 MESDC2 mesoderm development candidate 2 1 1
MIRT046720 TCERG1 transcription elongation regulator 1 1 1
MIRT046721 DOCK5 dedicator of cytokinesis 5 1 1
MIRT046722 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT046723 KIF5C kinesin family member 5C 1 1
MIRT046724 OAZ2 ornithine decarboxylase antizyme 2 1 1
MIRT046725 GLO1 glyoxalase I 1 1
MIRT046726 MCM3 minichromosome maintenance complex component 3 1 1
MIRT046727 WDR6 WD repeat domain 6 1 1
MIRT046728 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT046729 MARS methionyl-tRNA synthetase 1 1
MIRT046730 MTA2 metastasis associated 1 family, member 2 1 1
MIRT046731 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT046732 BPTF bromodomain PHD finger transcription factor 1 1
MIRT046733 DBN1 drebrin 1 1 1
MIRT046734 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 1
MIRT046735 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT046736 OLA1 Obg-like ATPase 1 1 1
MIRT046737 MORF4L1 mortality factor 4 like 1 1 1
MIRT046738 TATDN2 TatD DNase domain containing 2 1 1
MIRT046739 USP9X ubiquitin specific peptidase 9, X-linked 1 1
MIRT046740 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT046741 CSAG1 chondrosarcoma associated gene 1 1 1
MIRT046742 RBM10 RNA binding motif protein 10 1 1
MIRT046743 SEC24C SEC24 family, member C (S. cerevisiae) 1 1
MIRT046744 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046745 CKAP2 cytoskeleton associated protein 2 1 1
MIRT046746 EIF3B eukaryotic translation initiation factor 3, subunit B 1 1
MIRT046747 TXN thioredoxin 1 1
MIRT046748 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT046749 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT046750 DAXX death-domain associated protein 1 1
MIRT046751 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT046752 PAIP2 poly(A) binding protein interacting protein 2 1 1
MIRT046753 COL5A2 collagen, type V, alpha 2 1 1
MIRT046754 FAM83G family with sequence similarity 83, member G 1 1
MIRT046755 APP amyloid beta (A4) precursor protein 1 1
MIRT046756 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT046757 YLPM1 YLP motif containing 1 1 1
MIRT046758 ZMYND11 zinc finger, MYND domain containing 11 1 1
MIRT046759 NFS1 NFS1 nitrogen fixation 1 homolog (S. cerevisiae) 1 1
MIRT046760 HERC4 hect domain and RLD 4 1 1
MIRT046761 ZNF460 zinc finger protein 460 1 1
MIRT046762 YY1AP1 YY1 associated protein 1 1 1
MIRT046763 HSPA14 heat shock 70kDa protein 14 1 1
MIRT046764 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT046765 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT046766 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT046767 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT046768 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 1
MIRT046769 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT046770 JTB jumping translocation breakpoint 1 1
MIRT046771 KIF4A kinesin family member 4A 1 1
MIRT046772 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT046773 DPP8 dipeptidyl-peptidase 8 1 1
MIRT046774 ZNF131 zinc finger protein 131 1 1
MIRT046775 UBIAD1 UbiA prenyltransferase domain containing 1 1 1
MIRT046776 PCNT pericentrin 1 1
MIRT046777 CBX2 chromobox homolog 2 (Pc class homolog, Drosophila) 1 1
MIRT046778 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT046779 RFC1 replication factor C (activator 1) 1, 145kDa 1 1
MIRT046780 PLXNB2 plexin B2 1 1
MIRT046781 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT046782 ACTG1 actin, gamma 1 1 1
MIRT046783 PKP2 plakophilin 2 1 1
MIRT046784 FBXO21 F-box protein 21 1 1
MIRT046785 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT046786 FAM126B family with sequence similarity 126, member B 1 1
MIRT046787 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT046788 PHAX phosphorylated adaptor for RNA export 1 1
MIRT046789 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT046790 ILK integrin-linked kinase 1 1
MIRT046791 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT046792 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT046793 NDC1 transmembrane protein 48 1 1
MIRT046794 POMGNT1 protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase 1 1
MIRT046795 CAPRIN1 cell cycle associated protein 1 1 1
MIRT046796 POLE polymerase (DNA directed), epsilon 1 1
MIRT046797 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT046798 KNSTRN chromosome 15 open reading frame 23 1 1
MIRT046799 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT046800 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT046801 NKRF NFKB repressing factor 1 1
MIRT046802 EZR ezrin 1 1
MIRT046803 RNF4 ring finger protein 4 1 1
MIRT046804 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT046805 AP1B1 adaptor-related protein complex 1, beta 1 subunit 1 1
MIRT046806 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT046807 ATXN7L3 ataxin 7-like 3 1 1
MIRT046808 SORT1 sortilin 1 1 1
MIRT046809 PIGQ phosphatidylinositol glycan anchor biosynthesis, class Q 1 1
MIRT046810 RAP1GAP2 RAP1 GTPase activating protein 2 1 1
MIRT046811 FLNA filamin A, alpha 1 1
MIRT046812 PHRF1 PHD and ring finger domains 1 1 1
MIRT046813 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT046814 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT046815 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 1
MIRT046816 FPGS folylpolyglutamate synthase 1 1
MIRT046817 GANAB glucosidase, alpha; neutral AB 1 1
MIRT046818 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT046819 PANK3 pantothenate kinase 3 1 1
MIRT046820 POLD2 polymerase (DNA directed), delta 2, regulatory subunit 50kDa 1 1
MIRT046821 ENO1 enolase 1, (alpha) 1 1
MIRT046822 SLC35A2 solute carrier family 35 (UDP-galactose transporter), member A2 1 1
MIRT046823 PARK7 Parkinson disease (autosomal recessive, early onset) 7 1 1
MIRT046824 SEPT11 septin 11 1 1
MIRT046825 TRAP1 TNF receptor-associated protein 1 1 1
MIRT046826 CAST calpastatin 1 1
MIRT046827 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT046828 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT046829 RANBP10 RAN binding protein 10 1 1
MIRT046830 MEA1 male-enhanced antigen 1 1 1
MIRT046831 ATF5 activating transcription factor 5 1 1
MIRT046832 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT046833 PTDSS2 phosphatidylserine synthase 2 1 1
MIRT046834 EXOSC1 exosome component 1 1 1
MIRT046835 CABYR calcium binding tyrosine-(Y)-phosphorylation regulated 1 1
MIRT046836 SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1 1