Accession ID: MIRT001780 [miRNA, hsa-miR-221-3p :: KIT, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-221LinkOut: [miRBase ]
Synonyms MIRN221, miRNA221, mir-221, MIR221
Description Homo sapiens miR-221 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-221-3p
Mature Sequence 65| AGCUACAUUGUCUGCUGGGUUUC |87
Evidence Experimental
Experiments Cloned
Putative hsa-miR-221-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KIT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-Kit, CD117, PBT, SCFR
Description v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Transcript NM_0002    LinkOut: [ RefSeq ]
Other Transcripts NM_0010937   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KIT LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KIT
(miRNA target sites are highlighted)
>KIT|NM_0002|3'UTR
   1 TGAGCAGAATCAGTGTTTGGGTCACCCCTCCAGGAATGATCTCTTCTTTTGGCTTCCATGATGGTTATTTTCTTTTCTTT
  81 CAACTTGCATCCAACTCCAGGATAGTGGGCACCCCACTGCAATCCTGTCTTTCTGAGCACACTTTAGTGGCCGATGATTT
 161 TTGTCATCAGCCACCATCCTATTGCAAAGGTTCCAACTGTATATATTCCCAATAGCAACGTAGCTTCTACCATGAACAGA
 241 AAACATTCTGATTTGGAAAAAGAGAGGGAGGTATGGACTGGGGGCCAGAGTCCTTTCCAAGGCTTCTCCAATTCTGCCCA
 321 AAAATATGGTTGATAGTTTACCTGAATAAATGGTAGTAATCACAGTTGGCCTTCAGAACCATCCATAGTAGTATGATGAT
 401 ACAAGATTAGAAGCTGAAAACCTAAGTCCTTTATGTGGAAAACAGAACATCATTAGAACAAAGGACAGAGTATGAACACC
 481 TGGGCTTAAGAAATCTAGTATTTCATGCTGGGAATGAGACATAGGCCATGAAAAAAATGATCCCCAAGTGTGAACAAAAG
 561 ATGCTCTTCTGTGGACCACTGCATGAGCTTTTATACTACCGACCTGGTTTTTAAATAGAGTTTGCTATTAGAGCATTGAA
 641 TTGGAGAGAAGGCCTCCCTAGCCAGCACTTGTATATACGCATCTATAAATTGTCCGTGTTCATACATTTGAGGGGAAAAC
 721 ACCATAAGGTTTCGTTTCTGTATACAACCCTGGCATTATGTCCACTGTGTATAGAAGTAGATTAAGAGCCATATAAGTTT
 801 GAAGGAAACAGTTAATACCATTTTTTAAGGAAACAATATAACCACAAAGCACAGTTTGAACAAAATCTCCTCTTTTAGCT
 881 GATGAACTTATTCTGTAGATTCTGTGGAACAAGCCTATCAGCTTCAGAATGGCATTGTACTCAATGGATTTGATGCTGTT
 961 TGACAAAGTTACTGATTCACTGCATGGCTCCCACAGGAGTGGGAAAACACTGCCATCTTAGTTTGGATTCTTATGTAGCA
1041 GGAAATAAAGTATAGGTTTAGCCTCCTTCGCAGGCATGTCCTGGACACCGGGCCAGTATCTATATATGTGTATGTACGTT
1121 TGTATGTGTGTAGACAAATATTTGGAGGGGTATTTTTGCCCTGAGTCCAAGAGGGTCCTTTAGTACCTGAAAAGTAACTT
1201 GGCTTTCATTATTAGTACTGCTCTTGTTTCTTTTCACATAGCTGTCTAGAGTAGCTTACCAGAAGCTTCCATAGTGGTGC
1281 AGAGGAAGTGGAAGGCATCAGTCCCTATGTATTTGCAGTTCACCTGCACTTAAGGCACTCTGTTATTTAGACTCATCTTA
1361 CTGTACCTGTTCCTTAGACCTTCCATAATGCTACTGTCTCACTGAAACATTTAAATTTTACCCTTTAGACTGTAGCCTGG
1441 ATATTATTCTTGTAGTTTACCTCTTTAAAAACAAAACAAAACAAAACAAAAAACTCCCCTTCCTCACTGCCCAATATAAA
1521 AGGCAAATGTGTACATGGCAGAGTTTGTGTGTTGTCTTGAAAGATTCAGGTATGTTGCCTTTATGGTTTCCCCCTTCTAC
1601 ATTTCTTAGACTACATTTAGAGAACTGTGGCCGTTATCTGGAAGTAACCATTTGCACTGGAGTTCTATGCTCTCGCACCT
1681 TTCCAAAGTTAACAGATTTTGGGGTTGTGTTGTCACCCAAGAGATTGTTGTTTGCCATACTTTGTCTGAAAAATTCCTTT
1761 GTGTTTCTATTGACTTCAATGATAGTAAGAAAAGTGGTTGTTAGTTATAGATGTCTAGGTACTTCAGGGGCACTTCATTG
1841 AGAGTTTTGTCTTGGATATTCTTGAAAGTTTATATTTTTATAATTTTTTCTTACATCAGATGTTTCTTTGCAGTGGCTTA
1921 ATGTTTGAAATTATTTTGTGGCTTTTTTTGTAAATATTGAAATGTAGCAATAATGTCTTTTGAATATTCCCAAGCCCATG
2001 AGTCCTTGAAAATATTTTTTATATATACAGTAACTTTATGTGTAAATACATAAGCGGCGTAAGTTTAAAGGATGTTGGTG
2081 TTCCACGTGTTTTATTCCTGTATGTTGTCCAATTGTTGACAGTTCTGAAGAATTCTAATAAAATGTACATATATAAATCA
2161 AAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Other , Reporter assay
Article - Felli, N. Fontana, L. Pelosi, E. Botta, R. et al.
- Proc Natl Acad Sci U S A, 2005
MicroRNAs (miRs) are small noncoding RNAs that regulate gene expression primarily through translational repression. In erythropoietic (E) culture of cord blood CD34+ progenitor cells, the level of miR 221 and 222 is gradually and sharply down-modulated. Hypothetically, this decline could promote erythropoiesis by unblocking expression of key functional proteins. Indeed, (i) bioinformatic analysis suggested that miR 221 and 222 target the 3' UTR of kit mRNA; (ii) the luciferase assay confirmed that both miRs directly interact with the kit mRNA target site; and (iii) in E culture undergoing exponential cell growth, miR down-modulation is inversely related to increasing kit protein expression, whereas the kit mRNA level is relatively stable. Functional studies show that treatment of CD34+ progenitors with miR 221 and 222, via oligonucleotide transfection or lentiviral vector infection, causes impaired proliferation and accelerated differentiation of E cells, coupled with down-modulation of kit protein: this phenomenon, observed in E culture releasing endogenous kit ligand, is magnified in E culture supplemented with kit ligand. Furthermore, transplantation experiments in NOD-SCID mice reveal that miR 221 and 222 treatment of CD34+ cells impairs their engraftment capacity and stem cell activity. Finally, miR 221 and 222 gene transfer impairs proliferation of the kit+ TF-1 erythroleukemic cell line. Altogether, our studies indicate that the decline of miR 221 and 222 during exponential E growth unblocks kit protein production at mRNA level, thus leading to expansion of early erythroblasts. Furthermore, the results on kit+ erythroleukemic cells suggest a potential role of these miRs in cancer therapy.
LinkOut: [PMID: 16330772]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Northern blot , qRT-PCR , Western blot
Conditions PTC
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... Both forms of Kit were readily detected in normal thyroid tissue but were strongly reduced or absent in the four samples showing strong reduction of KIT transcript.//strong overexpression of miRs-221, -222, and -146b in these four PTC patient samples. ...

- He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al., 2005, Proc Natl Acad Sci U S A.

Article - He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al.
- Proc Natl Acad Sci U S A, 2005
Apart from alterations in the RET/PTC-RAS-BRAF pathway, comparatively little is known about the genetics of papillary thyroid carcinoma (PTC). We show that numerous microRNAs (miRNAs) are transcriptionally up-regulated in PTC tumors compared with unaffected thyroid tissue. A set of five miRNAs, including the three most up-regulated ones (miR-221, -222, and -146), distinguished unequivocally between PTC and normal thyroid. Additionally, miR-221 was up-regulated in unaffected thyroid tissue in several PTC patients, presumably an early event in carcinogenesis. Tumors in which the up-regulation (11- to 19-fold) of miR-221, -222, and -146 was strongest showed dramatic loss of KIT transcript and Kit protein. In 5 of 10 such cases, this down expression was associated with germline single-nucleotide changes in the two recognition sequences in KIT for these miRNAs. We conclude that up-regulation of several miRs and regulation of KIT are involved in PTC pathogenesis, and that sequence changes in genes targeted by miRNAs can contribute to their regulation.
LinkOut: [PMID: 16365291]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Garofalo, M. Quintavalle, C. Di Leva, G. et al.
- Oncogene, 2008
To define novel pathways that regulate susceptibility to tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in non-small cell lung cancer (NSCLC), we have performed genome-wide expression profiling of microRNAs (miRs). We show that in TRAIL-resistant NSCLC cells, levels of different miRs are increased, and in particular, miR-221 and -222. We demonstrate that these miRs impair TRAIL-dependent apoptosis by inhibiting the expression of key functional proteins. Indeed, transfection with anti-miR-221 and -222 rendered CALU-1-resistant cells sensitive to TRAIL. Conversely, H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of Kit and p27(kip1) mRNAs, but interfere with TRAIL signaling mainly through p27(kip1). In conclusion, we show that high expression levels of miR-221 and -222 are needed to maintain the TRAIL-resistant phenotype, thus making these miRs as promising therapeutic targets or diagnostic tool for TRAIL resistance in NSCLC.
LinkOut: [PMID: 18246122]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions Human melanoma cell lines
Disease melanoma;
Location of target site 3'UTR
Tools used in this research PicTar , RNAhybrid , TargetScan
Original Description (Extracted from the article) ... Moreover, we provide evidences of miR-221 and miR-222 capabilities to regulate two distinct but functionally convergent pathways of melanocyte transformation through the cyclin-dependent kinase inhibitor 1B (p27Kip1/CDKN1B) on one side and c-KIT and its downstream genes on the other.//The c-KIT receptor is a melanocytic multifunctional player regulating melanogenesis, cell growth, migration, and survival (14). This receptor is directly targeted by miR-221/-222 in normal erythropoiesis (13) and neoangiogenesis (32), as well as in papillary thyroid carcinoma (9). ...

- Felicetti, F. Errico, M. C. Bottero, L. et al., 2008, Cancer Res.

Article - Felicetti, F. Errico, M. C. Bottero, L. et al.
- Cancer Res, 2008
The incidence of cutaneous melanoma is steadily increasing. Although several molecular abnormalities have been associated with melanoma progression, the mechanisms underlying the differential gene expression are still largely unknown and targeted therapies are not yet available. Noncoding small RNAs, termed microRNAs (miR), have been recently reported to play important roles in major cellular processes, including those involved in cancer development and progression. We have identified the promyelocytic leukemia zinc finger (PLZF) transcription factor as a repressor of miR-221 and miR-222 by direct binding to their putative regulatory region. Specifically, PLZF silencing in melanomas unblocks miR-221 and miR-222, which in turn controls the progression of the neoplasia through down-modulation of p27Kip1/CDKN1B and c-KIT receptor, leading to enhanced proliferation and differentiation blockade of the melanoma cells, respectively. In vitro and in vivo functional studies, including the use of antisense "antagomir" oligonucleotides, confirmed the key role of miR-221/-222 in regulating the progression of human melanoma; this suggests that targeted therapies suppressing miR-221/-222 may prove beneficial in advanced melanoma.
LinkOut: [PMID: 18417445]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Other
Article - Zhao, H. Kalota, A. Jin, S. Gewirtz, A. M.
- Blood, 2009
The c-myb proto-oncogene encodes an obligate hematopoietic cell transcription factor important for lineage commitment, proliferation, and differentiation. Given its critical functions, c-Myb regulatory factors are of great interest but remain incompletely defined. Herein we show that c-Myb expression is subject to posttranscriptional regulation by microRNA (miRNA)-15a. Using a luciferase reporter assay, we found that miR-15a directly binds the 3'-UTR of c-myb mRNA. By transfecting K562 myeloid leukemia cells with a miR-15a mimic, functionality of binding was shown. The mimic decreased c-Myb expression, and blocked the cells in the G(1) phase of cell cycle. Exogenous expression of c-myb mRNA lacking the 3'-UTR partially rescued the miR-15a induced cell-cycle block. Of interest, the miR-15a promoter contained several potential c-Myb protein binding sites. Occupancy of one canonical c-Myb binding site was demonstrated by chromatin immunoprecipitation analysis and shown to be required for miR-15a expression in K562 cells. Finally, in studies using normal human CD34(+) cells, we showed that c-Myb and miR-15a expression were inversely correlated in cells undergoing erythroid differentiation, and that overexpression of miR-15a blocked both erythroid and myeloid colony formation in vitro. In aggregate, these findings suggest the presence of a c-Myb-miR-15a autoregulatory feedback loop of potential importance in human hematopoiesis.
LinkOut: [PMID: 18818396]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Felicetti, F. Errico, M. C. Segnalini, P. et al.
- Expert Rev Anticancer Ther, 2008
MicroRNAs (miRNAs) represent a new family of small noncoding RNAs that negatively regulate gene expression. Recent studies demonstrated miRNA involvement in all the main biological processes, including tumor development as a consequence of an aberrant deregulated expression. Growing evidence is showing the capability of miRNA expression profiles to unequivocally distinguish between normal and neoplastic tissues, leading to the identification of new diagnostic and/or prognostic molecular markers. In addition, miRNAs might eventually represent new targets to aim at as innovative therapeutic approaches, particularly relevant in those types of cancer, such as melanoma, which are still lacking effective traditional therapies. In particular, the inhibition of miRNA-221 and -222, which are abnormally expressed in melanoma and favor the induction of the malignant phenotype by downregulating c-KIT receptor and p27Kip, might in the future represent an efficient treatment for translation into the clinical setting.
LinkOut: [PMID: 18983236]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions Human PASMC
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-221 Targets c-Kit and p27Kip1 in PASMC.//In this study we demonstrate that PDGF induces the expression of miR-221, which results in down-regulation of c-kit and p27Kip1 in human primary pulmonary artery smooth muscle cells (PASMC). ...

- Davis, B. N. Hilyard, A. C. Nguyen, P. H. et al., 2009, J Biol Chem.

Article - Davis, B. N. Hilyard, A. C. Nguyen, P. H. et al.
- J Biol Chem, 2009
The platelet-derived growth factor (PDGF) signaling pathway is a critical regulator of animal development and homeostasis. Activation of the PDGF pathway leads to neointimal proliferative responses to artery injury; it promotes a switch of vascular smooth muscle cells (vSMC) to a less contractile phenotype by inhibiting the SMC-specific gene expression and increasing the rate of proliferation and migration. The molecular mechanism for these pleiotropic effects of PDGFs has not been fully described. Here, we identify the microRNA-221 (miR-221), a small noncoding RNA, as a modulator of the phenotypic change of vSMCs in response to PDGF signaling. We demonstrate that miR-221 is transcriptionally induced upon PDGF treatment in primary vSMCs, leading to down-regulation of the targets c-Kit and p27Kip1. Down-regulation of p27Kip1 by miR-221 is critical for PDGF-mediated induction of cell proliferation. Additionally, decreased c-Kit causes inhibition of SMC-specific contractile gene transcription by reducing the expression of Myocardin (Myocd), a potent SMC-specific nuclear coactivator. Our study demonstrates that PDGF signaling, by modulating the expression of miR-221, regulates two critical determinants of the vSMC phenotype; they are SMC gene expression and cell proliferation.
LinkOut: [PMID: 19088079]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions Melanoma cell
Original Description (Extracted from the article) ... Collectively, these studies demonstrated that targeted inhibition of mir-221 led to the restoration of cKit expression and ligand-dependent signaling ...

- Igoucheva, O. Alexeev, V., 2009, Biochem Biophys Res Commun.

Article - Igoucheva, O. Alexeev, V.
- Biochem Biophys Res Commun, 2009
Loss of cKit receptor in cutaneous melanomas was attributed to the down-regulation of AP2 transcription factor. Our analysis of 27 melanoma cell lines showed no correlation between AP2 and c-kit expression. Suggesting a post-transcriptional mechanism of cKit down-modulation, we performed genome-wide microRNA (miRNA) expression profiling and found that several miRNA species are commonly up-regulated in melanomas. Among them was mir-221, which can directly interact with c-kit 3'UTR and inhibit cKit protein translation. Observed inverse correlation of the c-kit and mir-221 expression in various melanocytic cells pointed to its involvement in regulation of cKit in melanoma. Moreover, a series of functional assays demonstrated that mir-221 could directly inhibit cKit, p27(Kip1) and, possibly, other pivotal proteins in melanoma. Collectively, the studies presented here indicate that mir-221 could be a novel therapeutic target for the treatment of cutaneous melanoma. They also suggest that regulation of expression and functional activity of identified up-regulated miRNAs should be further studied in the context of malignant melanoma.
LinkOut: [PMID: 19126397]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Other
Article - Pallante, P. Visone, R. Croce, C. M. Fusco, A.
- Endocr Relat Cancer, 2010
Carcinoma of the thyroid gland is an uncommon cancer, but one of the most frequent malignancies of the endocrine system. Most thyroid cancers are derived from the follicular cells. Follicular carcinoma is considered more malignant than papillary thyroid carcinoma (PTC), and anaplastic thyroid cancer (ATC) is one of the most lethal human cancers. Even though several genetic lesions have been already described in human thyroid cancer, particularly in the papillary histotype, the mechanisms underlying the development of these neoplasias are still far from being completely elucidated. Some years ago, several studies were undertaken to analyze the expression of microRNAs (miRNAs or miRs) in thyroid carcinoma to evaluate a possible role of their deregulation in the process of carcinogenesis. These studies showed an aberrant microRNA expression profile that distinguishes unequivocally among PTC, ATC, and normal thyroid tissue. Here, other than summarizing the current findings on microRNA expression in human thyroid carcinomas, we discuss the mechanisms by which microRNA deregulation may play a role in thyroid carcinogenesis, and the possible use of microRNA knowledge in the diagnosis and therapy of thyroid neoplasms.
LinkOut: [PMID: 19942715]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-221-3p :: KIT    [ Functional MTI ]
Validation Method Reporter assay;Microarray
Article - Pineau, P. Volinia, S. McJunkin, K. et al.
- Proc Natl Acad Sci U S A, 2010
MicroRNA (miRNAs) are negative regulators of gene expression and can function as tumor suppressors or oncogenes. Expression patterns of miRNAs and their role in the pathogenesis of hepatocellular carcinoma (HCC) are still poorly understood. We profiled miRNA expression in tissue samples (104 HCC, 90 adjacent cirrhotic livers, 21 normal livers) as well as in 35 HCC cell lines. A set of 12 miRNAs (including miR-21, miR-221/222, miR-34a, miR-519a, miR-93, miR-96, and let-7c) was linked to disease progression from normal liver through cirrhosis to full-blown HCC. miR-221/222, the most up-regulated miRNAs in tumor samples, are shown to target the CDK inhibitor p27 and to enhance cell growth in vitro. Conversely, these activities can be efficiently inhibited by an antagomiR specific for miR-221. In addition, we show, using a mouse model of liver cancer, that miR-221 overexpression stimulates growth of tumorigenic murine hepatic progenitor cells. Finally, we identified DNA damage-inducible transcript 4 (DDIT4), a modulator of mTOR pathway, as a bona fide target of miR-221. Taken together, these data reveal an important contribution for miR-221 in hepatocarcinogenesis and suggest a role for DDIT4 dysregulation in this process. Thus, the use of synthetic inhibitors of miR-221 may prove to be a promising approach to liver cancer treatment.
LinkOut: [PMID: 20018759]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
252 hsa-miR-221-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000137 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 6 24
MIRT000140 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 2
MIRT000141 BMF Bcl2 modifying factor 4 1
MIRT000434 FOXO3 forkhead box O3 4 1
MIRT001780 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 5 12
MIRT001971 HOXB5 homeobox B5 1 1
MIRT002272 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 5 5
MIRT002335 TMED7 transmembrane emp24 protein transport domain containing 7 4 9
MIRT003358 DDIT4 DNA-damage-inducible transcript 4 6 2
MIRT003359 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 5 1
MIRT003360 TBK1 TANK-binding kinase 1 4 1
MIRT003361 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 2 1
MIRT003362 DKK2 dickkopf homolog 2 (Xenopus laevis) 2 1
MIRT003363 CREBZF CREB/ATF bZIP transcription factor 2 1
MIRT003364 BRAP BRCA1 associated protein 2 1
MIRT003365 USP18 ubiquitin specific peptidase 18 2 1
MIRT003366 ARIH2 ariadne homolog 2 (Drosophila) 2 1
MIRT003367 BBC3 BCL2 binding component 3 4 3
MIRT003368 HMGXB4 HMG box domain containing 4 2 1
MIRT003452 TIMP3 TIMP metallopeptidase inhibitor 3 3 4
MIRT003757 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 2 1
MIRT004430 ICAM1 intercellular adhesion molecule 1 3 2
MIRT004484 FOS FBJ murine osteosarcoma viral oncogene homolog 4 2
MIRT004753 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 5 1
MIRT005295 NAIP NLR family, apoptosis inhibitory protein 2 1
MIRT005320 ESR1 estrogen receptor 1 4 1
MIRT005475 TICAM1 toll-like receptor adaptor molecule 1 4 1
MIRT005585 PTEN phosphatase and tensin homolog 4 3
MIRT005714 SELE selectin E 1 1
MIRT005785 TP53 tumor protein p53 1 1
MIRT005787 CORO1A coronin, actin binding protein, 1A 2 2
MIRT005789 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT006018 DIRAS3 DIRAS family, GTP-binding RAS-like 3 3 1
MIRT006063 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT006376 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006841 TRPS1 trichorhinophalangeal syndrome I 4 1
MIRT006917 CERS2 LAG1 homolog, ceramide synthase 2 3 1
MIRT007377 FMR1 fragile X mental retardation 1 1 1
MIRT024137 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT024138 ABHD3 abhydrolase domain containing 3 1 1
MIRT024139 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT024140 SPTSSA chromosome 14 open reading frame 147 1 1
MIRT024141 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT024142 NR2C2AP nuclear receptor 2C2-associated protein 1 1
MIRT024143 APOL2 apolipoprotein L, 2 1 1
MIRT024144 TDRP chromosome 8 open reading frame 42 1 1
MIRT024145 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT024146 TMEM168 transmembrane protein 168 1 1
MIRT024147 TUB tubby homolog (mouse) 1 1
MIRT024148 ZNF652 zinc finger protein 652 1 1
MIRT024149 DVL2 dishevelled, dsh homolog 2 (Drosophila) 2 1
MIRT024150 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT024151 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT024152 KLF9 Kruppel-like factor 9 1 1
MIRT024153 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT024154 TMEM64 transmembrane protein 64 1 1
MIRT024155 GID8 chromosome 20 open reading frame 11 1 1
MIRT024156 ZNF571 zinc finger protein 571 1 1
MIRT024157 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT024158 ATL2 atlastin GTPase 2 1 1
MIRT024159 E2F3 E2F transcription factor 3 1 1
MIRT024160 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT024161 CXorf38 chromosome X open reading frame 38 1 1
MIRT024162 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT024163 NHSL1 NHS-like 1 1 1
MIRT024164 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 1
MIRT024165 WDR61 WD repeat domain 61 1 1
MIRT024166 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 1
MIRT024167 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT024168 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT024169 RNF20 ring finger protein 20 1 1
MIRT024170 PHF12 PHD finger protein 12 1 1
MIRT024171 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT024172 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT024173 LYSMD1 LysM, putative peptidoglycan-binding, domain containing 1 1 1
MIRT024174 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT024175 TIPARP TCDD-inducible poly(ADP-ribose) polymerase 1 1
MIRT024176 GPR107 G protein-coupled receptor 107 1 1
MIRT024177 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT024178 STAMBP STAM binding protein 1 1
MIRT024179 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 1 1
MIRT024180 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT024181 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT024182 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT024183 RNF4 ring finger protein 4 1 1
MIRT024184 ASXL3 additional sex combs like 3 (Drosophila) 1 1
MIRT024185 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT024186 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT024187 RNF44 ring finger protein 44 1 1
MIRT024188 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT024189 ZNF275 zinc finger protein 275 1 1
MIRT024190 TMEM132B transmembrane protein 132B 1 1
MIRT024191 CCSAP chromosome 1 open reading frame 96 1 1
MIRT024192 BRD1 bromodomain containing 1 1 1
MIRT024193 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT024194 FBXO28 F-box protein 28 1 1
MIRT024195 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT024196 PANK3 pantothenate kinase 3 1 1
MIRT024197 ZKSCAN8 zinc finger protein 192 1 1
MIRT024198 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT024199 UBE2J1 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) 1 1
MIRT024200 MIDN midnolin 1 1
MIRT024201 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT024202 ATXN1 ataxin 1 1 2
MIRT024203 POGZ pogo transposable element with ZNF domain 1 1
MIRT024204 PPP1R15B protein phosphatase 1, regulatory (inhibitor) subunit 15B 1 1
MIRT024205 HECTD2 HECT domain containing 2 1 1
MIRT024206 POU3F2 POU class 3 homeobox 2 1 1
MIRT024207 HOXC10 homeobox C10 1 1
MIRT024208 MEOX2 mesenchyme homeobox 2 2 1
MIRT024209 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT046837 RUNDC3B RUN domain containing 3B 1 1
MIRT046838 TRAF4 TNF receptor-associated factor 4 1 1
MIRT046839 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT046840 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT046841 RBM33 RNA binding motif protein 33 1 1
MIRT046842 CROT carnitine O-octanoyltransferase 1 1
MIRT046843 ACTB actin, beta 1 1
MIRT046844 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT046845 USP28 ubiquitin specific peptidase 28 1 1
MIRT046846 PALB2 partner and localizer of BRCA2 1 1
MIRT046847 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT046848 YY1 YY1 transcription factor 1 1
MIRT046849 PLP2 proteolipid protein 2 (colonic epithelium-enriched) 1 1
MIRT046850 PXN paxillin 1 1
MIRT046851 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT046852 RPS24 ribosomal protein S24 1 1
MIRT046853 TSN translin 1 1
MIRT046854 HIST1H3D histone cluster 1, H3d 1 1
MIRT046855 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT046856 PSMD4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1 1
MIRT046857 PELO pelota homolog (Drosophila) 1 1
MIRT046859 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT046860 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT046861 HIST2H3D histone cluster 2, H3d 1 1
MIRT046862 MTSS1L metastasis suppressor 1-like 1 1
MIRT046863 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046864 NOP58 NOP58 ribonucleoprotein homolog (yeast) 1 1
MIRT046865 TUBA1C tubulin, alpha 1c 1 1
MIRT046866 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT046867 TMEM248 chromosome 7 open reading frame 42 1 1
MIRT046868 RAB5C RAB5C, member RAS oncogene family 1 1
MIRT046869 RPL15 ribosomal protein L15 1 1
MIRT046870 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT046871 LPHN2 latrophilin 2 1 1
MIRT046872 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT046873 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT046874 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT046875 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT046876 B4GALT2 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 1 1
MIRT046877 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT046878 PEX19 peroxisomal biogenesis factor 19 1 1
MIRT046879 PITPNM1 phosphatidylinositol transfer protein, membrane-associated 1 1 1
MIRT046880 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT046881 KIF16B kinesin family member 16B 1 1
MIRT046882 SEPHS1 selenophosphate synthetase 1 1 1
MIRT046883 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT046884 SF1 splicing factor 1 1 1
MIRT046885 RHOA ras homolog gene family, member A 1 1
MIRT046886 RBM39 RNA binding motif protein 39 1 1
MIRT046887 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT046888 FLNA filamin A, alpha 1 1
MIRT046889 CCDC142 coiled-coil domain containing 142 1 1
MIRT046890 ZYX zyxin 1 1
MIRT046891 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT046892 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT046893 MDFIC MyoD family inhibitor domain containing 1 1
MIRT046894 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT046895 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT046896 UBC ubiquitin C 1 1
MIRT046897 UQCR10 ubiquinol-cytochrome c reductase, complex III subunit X 1 1
MIRT046898 ADD1 adducin 1 (alpha) 1 1
MIRT046899 HECTD1 HECT domain containing 1 1 1
MIRT046900 FUS fused in sarcoma 1 1
MIRT046901 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT046902 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT046903 RPL21 ribosomal protein L21 1 1
MIRT046904 WDR34 WD repeat domain 34 1 1
MIRT046905 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT046906 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT046907 AP3B1 adaptor-related protein complex 3, beta 1 subunit 1 1
MIRT046908 EVL Enah/Vasp-like 1 1
MIRT046909 NCL nucleolin 1 1
MIRT046910 GLYR1 glyoxylate reductase 1 homolog (Arabidopsis) 1 1
MIRT046911 PEG10 paternally expressed 10 1 1
MIRT046912 ANKRD28 ankyrin repeat domain 28 1 1
MIRT046913 TMEM183A transmembrane protein 183A 1 1
MIRT046914 LDHB lactate dehydrogenase B 1 1
MIRT046915 TRIM28 tripartite motif-containing 28 1 1
MIRT046916 NUP210 nucleoporin 210kDa 1 1
MIRT046917 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT046918 PEX1 peroxisomal biogenesis factor 1 1 1
MIRT046919 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT046920 SRP68 signal recognition particle 68kDa 1 1
MIRT046921 NUF2 NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) 1 1
MIRT046922 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT046923 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT046924 CLIC1 chloride intracellular channel 1 1 1
MIRT046925 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT046926 NFYC nuclear transcription factor Y, gamma 1 1
MIRT046927 PHF21A PHD finger protein 21A 1 1
MIRT046928 TSC22D2 TSC22 domain family, member 2 1 1
MIRT046929 PKM pyruvate kinase, muscle 1 1
MIRT046930 CENPT centromere protein T 1 1
MIRT046931 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT046932 LAMTOR5 hepatitis B virus x interacting protein 1 1
MIRT046933 MIEN1 chromosome 17 open reading frame 37 1 1
MIRT046934 RPS7 ribosomal protein S7 1 1
MIRT046935 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT046936 IQCE IQ motif containing E 1 1
MIRT046937 RPLP0 ribosomal protein, large, P0 1 1
MIRT046938 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT046939 CDC25C cell division cycle 25 homolog C (S. pombe) 1 1
MIRT046940 TOB2 transducer of ERBB2, 2 1 1
MIRT046941 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT046942 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT046943 SPAG5 sperm associated antigen 5 1 1
MIRT046944 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT046945 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT046946 SAPCD2 chromosome 9 open reading frame 140 1 1
MIRT046947 NFYA nuclear transcription factor Y, alpha 1 1
MIRT046948 KHSRP KH-type splicing regulatory protein 1 1
MIRT046949 AMOT angiomotin 1 1
MIRT046950 POLG polymerase (DNA directed), gamma 1 1
MIRT046951 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT046952 FBN3 fibrillin 3 1 1
MIRT046953 SPRYD3 SPRY domain containing 3 1 1
MIRT046954 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT046955 BAG3 BCL2-associated athanogene 3 1 1
MIRT046956 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT046957 PRDM16 PR domain containing 16 1 1
MIRT046958 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT046959 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT046960 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT046961 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046962 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT046963 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT046964 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT046965 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT046966 RBM6 RNA binding motif protein 6 1 1
MIRT046967 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT046968 CNRIP1 cannabinoid receptor interacting protein 1 1 1
MIRT046969 NUP205 nucleoporin 205kDa 1 1
MIRT046970 DENR density-regulated protein 1 1
MIRT046971 ACTG1 actin, gamma 1 1 1
MIRT046972 ZNF35 zinc finger protein 35 1 1
MIRT046973 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT046974 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 1 1
MIRT046975 CABYR calcium binding tyrosine-(Y)-phosphorylation regulated 1 1
MIRT046976 MFN2 mitofusin 2 1 1
MIRT046977 ARHGAP42 Rho GTPase activating protein 42 1 1
MIRT046978 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1