Accession ID: MIRT001780 [miRNA, hsa-miR-221 ::
KIT, target gene]
| pre-miRNA ID | hsa-mir-221 LinkOut: [miRBase ] |
|---|---|
| Synonyms | MIRN221, miRNA221, mir-221, MIR221 |
| Description | Homo sapiens miR-221 stem-loop |
| Comment | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . |
| 2nd Structure of pre-miRNA |  |
| Mature miRNA | hsa-miR-221-3p |
|---|---|
| Mature Sequence | 65| AGCUACAUUGUCUGCUGGGUUUC |87 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-221-3p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
| Mature miRNA | hsa-miR-221-5p |
| Mature Sequence | 25| ACCUGGCAUACAAUGUAGAUUU |46 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-221-5p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
 |
| Gene Symbol | KIT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Synonyms | C-Kit, CD117, PBT, SCFR | ||||||||||||||||||||
| Description | v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog | ||||||||||||||||||||
| Transcript | NM_000222 LinkOut: [ RefSeq ] | ||||||||||||||||||||
| Other Transcripts | NM_001093772 | ||||||||||||||||||||
| Expression | LinkOut: [ BioGPS ] | ||||||||||||||||||||
| KEGG Pathway |
hsa04060 Cytokine-cytokine receptor interaction - Homo sapiens (human) hsa04144 Endocytosis - Homo sapiens (human) hsa04640 Hematopoietic cell lineage - Homo sapiens (human) hsa04916 Melanogenesis - Homo sapiens (human) hsa05200 Pathways in cancer - Homo sapiens (human) hsa05221 Acute myeloid leukemia - Homo sapiens (human) |
||||||||||||||||||||
| Putative miRNA Targets on KIT | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] | ||||||||||||||||||||
| 3'UTR of KIT (miRNA target sites are highlighted) |
>KIT|NM_000222|3'UTR 1 TGAGCAGAATCAGTGTTTGGGTCACCCCTCCAGGAATGATCTCTTCTTTTGGCTTCCATGATGGTTATTTTCTTTTCTTT 81 CAACTTGCATCCAACTCCAGGATAGTGGGCACCCCACTGCAATCCTGTCTTTCTGAGCACACTTTAGTGGCCGATGATTT 161 TTGTCATCAGCCACCATCCTATTGCAAAGGTTCCAACTGTATATATTCCCAATAGCAACGTAGCTTCTACCATGAACAGA 241 AAACATTCTGATTTGGAAAAAGAGAGGGAGGTATGGACTGGGGGCCAGAGTCCTTTCCAAGGCTTCTCCAATTCTGCCCA 321 AAAATATGGTTGATAGTTTACCTGAATAAATGGTAGTAATCACAGTTGGCCTTCAGAACCATCCATAGTAGTATGATGAT 401 ACAAGATTAGAAGCTGAAAACCTAAGTCCTTTATGTGGAAAACAGAACATCATTAGAACAAAGGACAGAGTATGAACACC 481 TGGGCTTAAGAAATCTAGTATTTCATGCTGGGAATGAGACATAGGCCATGAAAAAAATGATCCCCAAGTGTGAACAAAAG 561 ATGCTCTTCTGTGGACCACTGCATGAGCTTTTATACTACCGACCTGGTTTTTAAATAGAGTTTGCTATTAGAGCATTGAA 641 TTGGAGAGAAGGCCTCCCTAGCCAGCACTTGTATATACGCATCTATAAATTGTCCGTGTTCATACATTTGAGGGGAAAAC 721 ACCATAAGGTTTCGTTTCTGTATACAACCCTGGCATTATGTCCACTGTGTATAGAAGTAGATTAAGAGCCATATAAGTTT 801 GAAGGAAACAGTTAATACCATTTTTTAAGGAAACAATATAACCACAAAGCACAGTTTGAACAAAATCTCCTCTTTTAGCT 881 GATGAACTTATTCTGTAGATTCTGTGGAACAAGCCTATCAGCTTCAGAATGGCATTGTACTCAATGGATTTGATGCTGTT 961 TGACAAAGTTACTGATTCACTGCATGGCTCCCACAGGAGTGGGAAAACACTGCCATCTTAGTTTGGATTCTTATGTAGCA 1041 GGAAATAAAGTATAGGTTTAGCCTCCTTCGCAGGCATGTCCTGGACACCGGGCCAGTATCTATATATGTGTATGTACGTT 1121 TGTATGTGTGTAGACAAATATTTGGAGGGGTATTTTTGCCCTGAGTCCAAGAGGGTCCTTTAGTACCTGAAAAGTAACTT 1201 GGCTTTCATTATTAGTACTGCTCTTGTTTCTTTTCACATAGCTGTCTAGAGTAGCTTACCAGAAGCTTCCATAGTGGTGC 1281 AGAGGAAGTGGAAGGCATCAGTCCCTATGTATTTGCAGTTCACCTGCACTTAAGGCACTCTGTTATTTAGACTCATCTTA 1361 CTGTACCTGTTCCTTAGACCTTCCATAATGCTACTGTCTCACTGAAACATTTAAATTTTACCCTTTAGACTGTAGCCTGG 1441 ATATTATTCTTGTAGTTTACCTCTTTAAAAACAAAACAAAACAAAACAAAAAACTCCCCTTCCTCACTGCCCAATATAAA 1521 AGGCAAATGTGTACATGGCAGAGTTTGTGTGTTGTCTTGAAAGATTCAGGTATGTTGCCTTTATGGTTTCCCCCTTCTAC 1601 ATTTCTTAGACTACATTTAGAGAACTGTGGCCGTTATCTGGAAGTAACCATTTGCACTGGAGTTCTATGCTCTCGCACCT 1681 TTCCAAAGTTAACAGATTTTGGGGTTGTGTTGTCACCCAAGAGATTGTTGTTTGCCATACTTTGTCTGAAAAATTCCTTT 1761 GTGTTTCTATTGACTTCAATGATAGTAAGAAAAGTGGTTGTTAGTTATAGATGTCTAGGTACTTCAGGGGCACTTCATTG 1841 AGAGTTTTGTCTTGGATATTCTTGAAAGTTTATATTTTTATAATTTTTTCTTACATCAGATGTTTCTTTGCAGTGGCTTA 1921 ATGTTTGAAATTATTTTGTGGCTTTTTTTGTAAATATTGAAATGTAGCAATAATGTCTTTTGAATATTCCCAAGCCCATG 2001 AGTCCTTGAAAATATTTTTTATATATACAGTAACTTTATGTGTAAATACATAAGCGGCGTAAGTTTAAAGGATGTTGGTG 2081 TTCCACGTGTTTTATTCCTGTATGTTGTCCAATTGTTGACAGTTCTGAAGAATTCTAATAAAATGTACATATATAAATCA 2161 AAAAAAAAAAAAAAA Target sites Provided by authors Predicted by miRanda |
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
| miRNA:Target | hsa-miR-221 :: KIT [ Functional MTI ] |
|---|---|
| Validation Method | Northern blot , qRT-PCR , Western blot |
| Conditions | PTC |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda, PicTar, TargetScan |
| Original Description (Extracted from the article) | ... Both forms of Kit were readily detected in normal thyroid tissue but were strongly reduced or absent in the four samples showing strong reduction of KIT transcript.//strong overexpression of miRs-221, -222, and -146b in these four PTC patient samples. ... - He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al., 2005, Proc Natl Acad Sci U S A. |
| Article |
- He, H.
Jazdzewski, K.
Li, W.
Liyanarachchi, et al. - Proc Natl Acad Sci U S A, 2005
Apart from alterations in the RET/PTC-RAS-BRAF pathway, comparatively little is known about the genetics of papillary thyroid carcinoma (PTC). We show that numerous microRNAs (miRNAs) are transcriptionally up-regulated in PTC tumors compared with unaffected thyroid tissue. A set of five miRNAs, including the three most up-regulated ones (miR-221, -222, and -146), distinguished unequivocally between PTC and normal thyroid. Additionally, miR-221 was up-regulated in unaffected thyroid tissue in several PTC patients, presumably an early event in carcinogenesis. Tumors in which the up-regulation (11- to 19-fold) of miR-221, -222, and -146 was strongest showed dramatic loss of KIT transcript and Kit protein. In 5 of 10 such cases, this down expression was associated with germline single-nucleotide changes in the two recognition sequences in KIT for these miRNAs. We conclude that up-regulation of several miRs and regulation of KIT are involved in PTC pathogenesis, and that sequence changes in genes targeted by miRNAs can contribute to their regulation.
LinkOut: [PMID: 16365291]
|
| miRNA:Target | hsa-miR-221 :: KIT [ Functional MTI ] |
|---|---|
| Validation Method | Luciferase reporter assay |
| Article |
- Garofalo, M.
Quintavalle, C.
Di Leva, G. et al. - Oncogene, 2008
To define novel pathways that regulate susceptibility to tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in non-small cell lung cancer (NSCLC), we have performed genome-wide expression profiling of microRNAs (miRs). We show that in TRAIL-resistant NSCLC cells, levels of different miRs are increased, and in particular, miR-221 and -222. We demonstrate that these miRs impair TRAIL-dependent apoptosis by inhibiting the expression of key functional proteins. Indeed, transfection with anti-miR-221 and -222 rendered CALU-1-resistant cells sensitive to TRAIL. Conversely, H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of Kit and p27(kip1) mRNAs, but interfere with TRAIL signaling mainly through p27(kip1). In conclusion, we show that high expression levels of miR-221 and -222 are needed to maintain the TRAIL-resistant phenotype, thus making these miRs as promising therapeutic targets or diagnostic tool for TRAIL resistance in NSCLC.
LinkOut: [PMID: 18246122]
|
| miRNA:Target | hsa-miR-221 :: KIT [ Functional MTI ] |
|---|---|
| Validation Method | qRT-PCR , Western blot |
| Conditions | Human melanoma cell lines |
| Location of target site | 3'UTR |
| Tools used in this research | PicTar, RNAhybrid, TargetScan |
| Original Description (Extracted from the article) | ... Moreover, we provide evidences of miR-221 and miR-222 capabilities to regulate two distinct but functionally convergent pathways of melanocyte transformation through the cyclin-dependent kinase inhibitor 1B (p27Kip1/CDKN1B) on one side and c-KIT and its downstream genes on the other.//The c-KIT receptor is a melanocytic multifunctional player regulating melanogenesis, cell growth, migration, and survival (14). This receptor is directly targeted by miR-221/-222 in normal erythropoiesis (13) and neoangiogenesis (32), as well as in papillary thyroid carcinoma (9). ... - Felicetti, F. Errico, M. C. Bottero, L. et al., 2008, Cancer Res. |
| Article |
- Felicetti, F.
Errico, M. C.
Bottero, L. et al. - Cancer Res, 2008
The incidence of cutaneous melanoma is steadily increasing. Although several molecular abnormalities have been associated with melanoma progression, the mechanisms underlying the differential gene expression are still largely unknown and targeted therapies are not yet available. Noncoding small RNAs, termed microRNAs (miR), have been recently reported to play important roles in major cellular processes, including those involved in cancer development and progression. We have identified the promyelocytic leukemia zinc finger (PLZF) transcription factor as a repressor of miR-221 and miR-222 by direct binding to their putative regulatory region. Specifically, PLZF silencing in melanomas unblocks miR-221 and miR-222, which in turn controls the progression of the neoplasia through down-modulation of p27Kip1/CDKN1B and c-KIT receptor, leading to enhanced proliferation and differentiation blockade of the melanoma cells, respectively. In vitro and in vivo functional studies, including the use of antisense "antagomir" oligonucleotides, confirmed the key role of miR-221/-222 in regulating the progression of human melanoma; this suggests that targeted therapies suppressing miR-221/-222 may prove beneficial in advanced melanoma.
LinkOut: [PMID: 18417445]
|
| miRNA:Target | hsa-miR-221 :: KIT [ Functional MTI ] |
|---|---|
| Validation Method | Luciferase reporter assay |
| Article |
- Felicetti, F.
Errico, M. C.
Segnalini, P. et al. - Expert Rev Anticancer Ther, 2008
MicroRNAs (miRNAs) represent a new family of small noncoding RNAs that negatively regulate gene expression. Recent studies demonstrated miRNA involvement in all the main biological processes, including tumor development as a consequence of an aberrant deregulated expression. Growing evidence is showing the capability of miRNA expression profiles to unequivocally distinguish between normal and neoplastic tissues, leading to the identification of new diagnostic and/or prognostic molecular markers. In addition, miRNAs might eventually represent new targets to aim at as innovative therapeutic approaches, particularly relevant in those types of cancer, such as melanoma, which are still lacking effective traditional therapies. In particular, the inhibition of miRNA-221 and -222, which are abnormally expressed in melanoma and favor the induction of the malignant phenotype by downregulating c-KIT receptor and p27Kip, might in the future represent an efficient treatment for translation into the clinical setting.
LinkOut: [PMID: 18983236]
|
| miRNA:Target | hsa-miR-221 :: KIT [ Functional MTI ] |
|---|---|
| Validation Method | Luciferase reporter assay , qRT-PCR , Western blot |
| Conditions | Human PASMC |
| Location of target site | 3'UTR |
| Original Description (Extracted from the article) | ... miR-221 Targets c-Kit and p27Kip1 in PASMC.//In this study we demonstrate that PDGF induces the expression of miR-221, which results in down-regulation of c-kit and p27Kip1 in human primary pulmonary artery smooth muscle cells (PASMC). ... - Davis, B. N. Hilyard, A. C. Nguyen, P. H. et al., 2009, J Biol Chem. |
| Article |
- Davis, B. N.
Hilyard, A. C.
Nguyen, P. H. et al. - J Biol Chem, 2009
The platelet-derived growth factor (PDGF) signaling pathway is a critical regulator of animal development and homeostasis. Activation of the PDGF pathway leads to neointimal proliferative responses to artery injury; it promotes a switch of vascular smooth muscle cells (vSMC) to a less contractile phenotype by inhibiting the SMC-specific gene expression and increasing the rate of proliferation and migration. The molecular mechanism for these pleiotropic effects of PDGFs has not been fully described. Here, we identify the microRNA-221 (miR-221), a small noncoding RNA, as a modulator of the phenotypic change of vSMCs in response to PDGF signaling. We demonstrate that miR-221 is transcriptionally induced upon PDGF treatment in primary vSMCs, leading to down-regulation of the targets c-Kit and p27Kip1. Down-regulation of p27Kip1 by miR-221 is critical for PDGF-mediated induction of cell proliferation. Additionally, decreased c-Kit causes inhibition of SMC-specific contractile gene transcription by reducing the expression of Myocardin (Myocd), a potent SMC-specific nuclear coactivator. Our study demonstrates that PDGF signaling, by modulating the expression of miR-221, regulates two critical determinants of the vSMC phenotype; they are SMC gene expression and cell proliferation.
LinkOut: [PMID: 19088079]
|
| miRNA:Target | hsa-miR-221 :: KIT [ Functional MTI ] |
|---|---|
| Validation Method | qRT-PCR , Western blot |
| Conditions | Melanoma cell |
| Original Description (Extracted from the article) | ... Collectively, these studies demonstrated that targeted inhibition of mir-221 led to the restoration of cKit expression and ligand-dependent signaling ... - Igoucheva, O. Alexeev, V., 2009, Biochem Biophys Res Commun. |
| Article |
- Igoucheva, O.
Alexeev, V. - Biochem Biophys Res Commun, 2009
Loss of cKit receptor in cutaneous melanomas was attributed to the down-regulation of AP2 transcription factor. Our analysis of 27 melanoma cell lines showed no correlation between AP2 and c-kit expression. Suggesting a post-transcriptional mechanism of cKit down-modulation, we performed genome-wide microRNA (miRNA) expression profiling and found that several miRNA species are commonly up-regulated in melanomas. Among them was mir-221, which can directly interact with c-kit 3'UTR and inhibit cKit protein translation. Observed inverse correlation of the c-kit and mir-221 expression in various melanocytic cells pointed to its involvement in regulation of cKit in melanoma. Moreover, a series of functional assays demonstrated that mir-221 could directly inhibit cKit, p27(Kip1) and, possibly, other pivotal proteins in melanoma. Collectively, the studies presented here indicate that mir-221 could be a novel therapeutic target for the treatment of cutaneous melanoma. They also suggest that regulation of expression and functional activity of identified up-regulated miRNAs should be further studied in the context of malignant melanoma.
LinkOut: [PMID: 19126397]
|