Accession ID: MIRT001795 [miRNA, hsa-miR-19a-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-19aLinkOut: [miRBase ]
Synonyms MIRN19A, hsa-mir-19a, miR-19a, miRNA19A, MIR19A
Description Homo sapiens miR-19a stem-loop
Comment This sequence maps to chromosome 13 and is named miR-19a precursor-13 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-19a-3p
Mature Sequence 49| UGUGCAAAUCUAUGCAAAACUGA |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-19a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-19a-3p :: MECP2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Reporter assay;Microarray;Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Experimental Support for Predicted Targets.//{These MTI shown in Fig. 3} ...

- Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al., 2003, Cell.

Article - Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al.
- Cell, 2003
MicroRNAs (miRNAs) can play important gene regulatory roles in nematodes, insects, and plants by basepairing to mRNAs to specify posttranscriptional repression of these messages. However, the mRNAs regulated by vertebrate miRNAs are all unknown. Here we predict more than 400 regulatory target genes for the conserved vertebrate miRNAs by identifying mRNAs with conserved pairing to the 5' region of the miRNA and evaluating the number and quality of these complementary sites. Rigorous tests using shuffled miRNA controls supported a majority of these predictions, with the fraction of false positives estimated at 31% for targets identified in human, mouse, and rat and 22% for targets identified in pufferfish as well as mammals. Eleven predicted targets (out of 15 tested) were supported experimentally using a HeLa cell reporter system. The predicted regulatory targets of mammalian miRNAs were enriched for genes involved in transcriptional regulation but also encompassed an unexpectedly broad range of other functions.
LinkOut: [PMID: 14697198]
Experimental Support 2 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-19a-3p :: MECP2    [ Non-Functional MTI ]
Validation Method Reporter assay;Other
Article - Pezzolesi, M. G. Platzer, P. Waite, K. A. Eng, C.
- Am J Hum Genet, 2008
Germline mutations in the gene encoding phosphatase and tensin homolog deleted on chromosome ten (PTEN [MIM 601728]) are associated with a number of clinically distinct heritable cancer syndromes, including both Cowden syndrome (CS) and Bannayan-Riley-Ruvalcaba syndrome (BRRS). Seemingly identical pathogenic PTEN mutations have been observed in patients with CS and BRRS, as well as in patients with incomplete features of CS, referred to as CS-like (CSL) patients. These observations indicate that additional, unidentified, genetic and epigenetic factors act as phenotypic modifiers in these disorders. These genetic factors could also contribute to disease in patients with CS, CSL, or BRRS without identifiable PTEN mutations. Two potential modifiers are miR-19a and miR-21, which are previously identified PTEN-targeting miRNAs. We investigated the role of these miRNAs by characterizing their relative expression levels in PTEN-mutation-positive and PTEN-mutation-negative patients with CS, CSL, or BRRS. Interestingly, we observed differential expression of miR-19a and miR-21 in our PTEN-mutation-positive patients. Both were found to be significantly overexpressed within this group (p < 0.01) and were inversely correlated with germline PTEN protein levels. Similarly, the relative expression of miR-19a and miR-21 was differentially expressed in a series of PTEN-mutation-negative patients with CS or CSL with variable clinical phenotypes and decreased full-length PTEN protein expression. Among PTEN-mutation-positive patients with CS, both miRNAs were significantly overexpressed (p = 0.006-0.013). Taken together, our study results suggest that differential expression of PTEN-targeting miR-19a and miR-21 modulates the PTEN protein levels and the CS and CSL phenotypes, irrespective of the patient's mutation status, and support their roles as genetic modifiers in CS and CSL.
LinkOut: [PMID: 18460397]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
39 hsa-miR-19a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001794 HOXA5 homeobox A5 2 2
MIRT001795 MECP2 methyl CpG binding protein 2 (Rett syndrome) 3 2
MIRT002958 PTEN phosphatase and tensin homolog 4 5
MIRT003214 ESR1 estrogen receptor 1 4 2
MIRT003426 CCND1 cyclin D1 5 3
MIRT003533 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 3 3
MIRT003536 NR4A2 nuclear receptor subfamily 4, group A, member 2 3 3
MIRT003781 ATXN1 ataxin 1 4 3
MIRT004334 KAT2B K(lysine) acetyltransferase 2B 3 2
MIRT004337 SOCS1 suppressor of cytokine signaling 1 3 3
MIRT004350 PRMT5 protein arginine methyltransferase 5 2 2
MIRT004452 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 5
MIRT004593 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 3 3
MIRT004934 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 4 3
MIRT005396 ARIH2 ariadne homolog 2 (Drosophila) 2 2
MIRT005630 SMAD4 SMAD family member 4 3 2
MIRT006179 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 4 1
MIRT006475 CUL5 cullin 5 2 1
MIRT006646 TLR2 toll-like receptor 2 3 1
MIRT006787 TNF tumor necrosis factor 1 1
MIRT007118 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT007119 RAB13 RAB13, member RAS oncogene family 1 1
MIRT007120 MSMO1 methylsterol monooxygenase 1 1 1
MIRT007121 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT007122 PSAP prosaposin 1 1
MIRT031304 THBS1 thrombospondin 1 1 1
MIRT031305 CTGF connective tissue growth factor 1 1
MIRT031306 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT031307 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT031308 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT031309 RAB14 RAB14, member RAS oncogene family 1 1
MIRT050641 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT050642 RNF4 ring finger protein 4 1 1
MIRT050643 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT050644 TMEM87A transmembrane protein 87A 1 1
MIRT050645 MTF2 metal response element binding transcription factor 2 1 1
MIRT050646 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT050647 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT050648 WDFY3 WD repeat and FYVE domain containing 3 1 1