Accession ID: MIRT001795 [miRNA, hsa-miR-19a-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-19aLinkOut: [miRBase ]
Synonyms MIRN19A, hsa-mir-19a, miR-19a, miRNA19A, MIR19A
Description Homo sapiens miR-19a stem-loop
Comment This sequence maps to chromosome 13 and is named miR-19a precursor-13 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-19a-3p
Mature Sequence 49| UGUGCAAAUCUAUGCAAAACUGA |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-19a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MECP2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AUTSX3, DKFZp686A24160, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT
Description methyl CpG binding protein 2 (Rett syndrome)
Transcript NM_0049    LinkOut: [ RefSeq ]
Other Transcripts NM_0011107   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MECP2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MECP2
(miRNA target sites are highlighted)
>MECP2|NM_0049|3'UTR
   1 TGACTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCT
  81 CTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGT
 161 GGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAG
 241 CTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCAC
 321 CTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCCGTTTT
 401 CGGTGCCATCAGTGCCCCGTCTACAGCTCCCCCAGCTCCCCCCACCTCCCCCACTCCCAACCACGTTGGGACAGGGAGGT
 481 GTGAGGCAGGAGAGACAGTTGGATTCTTTAGAGAAGATGGATATGACCAGTGGCTATGGCCTGTGCGATCCCACCCGTGG
 561 TGGCTCAAGTCTGGCCCCACACCAGCCCCAATCCAAAACTGGCAAGGACGCTTCACAGGACAGGAAAGTGGCACCTGTCT
 641 GCTCCAGCTCTGGCATGGCTAGGAGGGGGGAGTCCCTTGAACTACTGGGTGTAGACTGGCCTGAACCACAGGAGAGGATG
 721 GCCCAGGGTGAGGTGGCATGGTCCATTCTCAAGGGACGTCCTCCAACGGGTGGCGCTAGAGGCCATGGAGGCAGTAGGAC
 801 AAGGTGCAGGCAGGCTGGCCTGGGGTCAGGCCGGGCAGAGCACAGCGGGGTGAGAGGGATTCCTAATCACTCAGAGCAGT
 881 CTGTGACTTAGTGGACAGGGGAGGGGGCAAAGGGGGAGGAGAAGAAAATGTTCTTCCAGTTACTTTCCAATTCTCCTTTA
 961 GGGACAGCTTAGAATTATTTGCACTATTGAGTCTTCATGTTCCCACTTCAAAACAAACAGATGCTCTGAGAGCAAACTGG
1041 CTTGAATTGGTGACATTTAGTCCCTCAAGCCACCAGATGTGACAGTGTTGAGAACTACCTGGATTTGTATATATACCTGC
1121 GCTTGTTTTAAAGTGGGCTCAGCACATAGGGTTCCCACGAAGCTCCGAAACTCTAAGTGTTTGCTGCAATTTTATAAGGA
1201 CTTCCTGATTGGTTTCTCTTCTCCCCTTCCATTTCTGCCTTTTGTTCATTTCATCCTTTCACTTCTTTCCCTTCCTCCGT
1281 CCTCCTCCTTCCTAGTTCATCCCTTCTCTTCCAGGCAGCCGCGGTGCCCAACCACACTTGTCGGCTCCAGTCCCCAGAAC
1361 TCTGCCTGCCCTTTGTCCTCCTGCTGCCAGTACCAGCCCCACCCTGTTTTGAGCCCTGAGGAGGCCTTGGGCTCTGCTGA
1441 GTCCGACCTGGCCTGTCTGTGAAGAGCAAGAGAGCAGCAAGGTCTTGCTCTCCTAGGTAGCCCCCTCTTCCCTGGTAAGA
1521 AAAAGCAAAAGGCATTTCCCACCCTGAACAACGAGCCTTTTCACCCTTCTACTCTAGAGAAGTGGACTGGAGGAGCTGGG
1601 CCCGATTTGGTAGTTGAGGAAAGCACAGAGGCCTCCTGTGGCCTGCCAGTCATCGAGTGGCCCAACAGGGGCTCCATGCC
1681 AGCCGACCTTGACCTCACTCAGAAGTCCAGAGTCTAGCGTAGTGCAGCAGGGCAGTAGCGGTACCAATGCAGAACTCCCA
1761 AGACCCGAGCTGGGACCAGTACCTGGGTCCCCAGCCCTTCCTCTGCTCCCCCTTTTCCCTCGGAGTTCTTCTTGAATGGC
1841 AATGTTTTGCTTTTGCTCGATGCAGACAGGGGGCCAGAACACCACACATTTCACTGTCTGTCTGGTCCATAGCTGTGGTG
1921 TAGGGGCTTAGAGGCATGGGCTTGCTGTGGGTTTTTAATTGATCAGTTTTCATGTGGGATCCCATCTTTTTAACCTCTGT
2001 TCAGGAAGTCCTTATCTAGCTGCATATCTTCATCATATTGGTATATCCTTTTCTGTGTTTACAGAGATGTCTCTTATATC
2081 TAAATCTGTCCAACTGAGAAGTACCTTATCAAAGTAGCAAATGAGACAGCAGTCTTATGCTTCCAGAAACACCCACAGGC
2161 ATGTCCCATGTGAGCTGCTGCCATGAACTGTCAAGTGTGTGTTGTCTTGTGTATTTCAGTTATTGTCCCTGGCTTCCTTA
2241 CTATGGTGTAATCATGAAGGAGTGAAACATCATAGAAACTGTCTAGCACTTCCTTGCCAGTCTTTAGTGATCAGGAACCA
2321 TAGTTGACAGTTCCAATCAGTAGCTTAAGAAAAAACCGTGTTTGTCTCTTCTGGAATGGTTAGAAGTGAGGGAGTTTGCC
2401 CCGTTCTGTTTGTAGAGTCTCATAGTTGGACTTTCTAGCATATATGTGTCCATTTCCTTATGCTGTAAAAGCAAGTCCTG
2481 CAACCAAACTCCCATCAGCCCAATCCCTGATCCCTGATCCCTTCCACCTGCTCTGCTGATGACCCCCCCAGCTTCACTTC
2561 TGACTCTTCCCCAGGAAGGGAAGGGGGGTCAGAAGAGAGGGTGAGTCCTCCAGAACTCTTCCTCCAAGGACAGAAGGCTC
2641 CTGCCCCCATAGTGGCCTCGAACTCCTGGCACTACCAAAGGACACTTATCCACGAGAGCGCAGCATCCGACCAGGTTGTC
2721 ACTGAGAAGATGTTTATTTTGGTCAGTTGGGTTTTTATGTATTATACTTAGTCAAATGTAATGTGGCTTCTGGAATCATT
2801 GTCCAGAGCTGCTTCCCCGTCACCTGGGCGTCATCTGGTCCTGGTAAGAGGAGTGCGTGGCCCACCAGGCCCCCCTGTCA
2881 CCCATGACAGTTCATTCAGGGCCGATGGGGCAGTCGTGGTTGGGAACACAGCATTTCAAGCGTCACTTTATTTCATTCGG
2961 GCCCCACCTGCAGCTCCCTCAAAGAGGCAGTTGCCCAGCCTCTTTCCCTTCCAGTTTATTCCAGAGCTGCCAGTGGGGCC
3041 TGAGGCTCCTTAGGGTTTTCTCTCTATTTCCCCCTTTCTTCCTCATTCCCTCGTCTTTCCCAAAGGCATCACGAGTCAGT
3121 CGCCTTTCAGCAGGCAGCCTTGGCGGTTTATCGCCCTGGCAGGCAGGGGCCCTGCAGCTCTCATGCTGCCCCTGCCTTGG
3201 GGTCAGGTTGACAGGAGGTTGGAGGGAAAGCCTTAAGCTGCAGGATTCTCACCAGCTGTGTCCGGCCCAGTTTTGGGGTG
3281 TGACCTCAATTTCAATTTTGTCTGTACTTGAACATTATGAAGATGGGGGCCTCTTTCAGTGAATTTGTGAACAGCAGAAT
3361 TGACCGACAGCTTTCCAGTACCCATGGGGCTAGGTCATTAAGGCCACATCCACAGTCTCCCCCACCCTTGTTCCAGTTGT
3441 TAGTTACTACCTCCTCTCCTGACAATACTGTATGTCGTCGAGCTCCCCCCAGGTCTACCCCTCCCGGCCCTGCCTGCTGG
3521 TGGGCTTGTCATAGCCAGTGGGATTGCCGGTCTTGACAGCTCAGTGAGCTGGAGATACTTGGTCACAGCCAGGCGCTAGC
3601 ACAGCTCCCTTCTGTTGATGCTGTATTCCCATATCAAAAGACACAGGGGACACCCAGAAACGCCACATCCCCCAATCCAT
3681 CAGTGCCAAACTAGCCAACGGCCCCAGCTTCTCAGCTCGCTGGATGGCGGAAGCTGCTACTCGTGAGCGCCAGTGCGGGT
3761 GCAGACAATCTTCTGTTGGGTGGCATCATTCCAGGCCCGAAGCATGAACAGTGCACCTGGGACAGGGAGCAGCCCCAAAT
3841 TGTCACCTGCTTCTCTGCCCAGCTTTTCATTGCTGTGACAGTGATGGCGAAAGAGGGTAATAACCAGACACAAACTGCCA
3921 AGTTGGGTGGAGAAAGGAGTTTCTTTAGCTGACAGAATCTCTGAATTTTAAATCACTTAGTAAGCGGCTCAAGCCCAGGA
4001 GGGAGCAGAGGGATACGAGCGGAGTCCCCTGCGCGGGACCATCTGGAATTGGTTTAGCCCAAGTGGAGCCTGACAGCCAG
4081 AACTCTGTGTCCCCCGTCTAACCACAGCTCCTTTTCCAGAGCATTCCAGTCAGGCTCTCTGGGCTGACTGGGCCAGGGGA
4161 GGTTACAGGTACCAGTTCTTTAAGAAGATCTTTGGGCATATACATTTTTAGCCTGTGTCATTGCCCCAAATGGATTCCTG
4241 TTTCAAGTTCACACCTGCAGATTCTAGGACCTGTGTCCTAGACTTCAGGGAGTCAGCTGTTTCTAGAGTTCCTACCATGG
4321 AGTGGGTCTGGAGGACCTGCCCGGTGGGGGGGCAGAGCCCTGCTCCCTCCGGGTCTTCCTACTCTTCTCTCTGCTCTGAC
4401 GGGATTTGTTGATTCTCTCCATTTTGGTGTCTTTCTCTTTTAGATATTGTATCAATCTTTAGAAAAGGCATAGTCTACTT
4481 GTTATAAATCGTTAGGATACTGCCTCCCCCAGGGTCTAAAATTACATATTAGAGGGGAAAAGCTGAACACTGAAGTCAGT
4561 TCTCAACAATTTAGAAGGAAAACCTAGAAAACATTTGGCAGAAAATTACATTTCGATGTTTTTGAATGAATACGAGCAAG
4641 CTTTTACAACAGTGCTGATCTAAAAATACTTAGCACTTGGCCTGAGATGCCTGGTGAGCATTACAGGCAAGGGGAATCTG
4721 GAGGTAGCCGACCTGAGGACATGGCTTCTGAACCTGTCTTTTGGGAGTGGTATGGAAGGTGGAGCGTTCACCAGTGACCT
4801 GGAAGGCCCAGCACCACCCTCCTTCCCACTCTTCTCATCTTGACAGAGCCTGCCCCAGCGCTGACGTGTCAGGAAAACAC
4881 CCAGGGAACTAGGAAGGCACTTCTGCCTGAGGGGCAGCCTGCCTTGCCCACTCCTGCTCTGCTCGCCTCGGATCAGCTGA
4961 GCCTTCTGAGCTGGCCTCTCACTGCCTCCCCAAGGCCCCCTGCCTGCCCTGTCAGGAGGCAGAAGGAAGCAGGTGTGAGG
5041 GCAGTGCAAGGAGGGAGCACAACCCCCAGCTCCCGCTCCGGGCTCCGACTTGTGCACAGGCAGAGCCCAGACCCTGGAGG
5121 AAATCCTACCTTTGAATTCAAGAACATTTGGGGAATTTGGAAATCTCTTTGCCCCCAAACCCCCATTCTGTCCTACCTTT
5201 AATCAGGTCCTGCTCAGCAGTGAGAGCAGATGAGGTGAAAAGGCCAAGAGGTTTGGCTCCTGCCCACTGATAGCCCCTCT
5281 CCCCGCAGTGTTTGTGTGTCAAGTGGCAAAGCTGTTCTTCCTGGTGACCCTGATTATATCCAGTAACACATAGACTGTGC
5361 GCATAGGCCTGCTTTGTCTCCTCTATCCTGGGCTTTTGTTTTGCTTTTTAGTTTTGCTTTTAGTTTTTCTGTCCCTTTTA
5441 TTTAACGCACCGACTAGACACACAAAGCAGTTGAATTTTTATATATATATCTGTATATTGCACAATTATAAACTCATTTT
5521 GCTTGTGGCTCCACACACACAAAAAAAGACCTGTTAAAATTATACCTGTTGCTTAATTACAATATTTCTGATAACCATAG
5601 CATAGGACAAGGGAAAATAAAAAAAGAAAAAAAAGAAAAAAAAACGACAAATCTGTCTGCTGGTCACTTCTTCTGTCCAA
5681 GCAGATTCGTGGTCTTTTCCTCGCTTCTTTCAAGGGCTTTCCTGTGCCAGGTGAAGGAGGCTCCAGGCAGCACCCAGGTT
5761 TTGCACTCTTGTTTCTCCCGTGCTTGTGAAAGAGGTCCCAAGGTTCTGGGTGCAGGAGCGCTCCCTTGACCTGCTGAAGT
5841 CCGGAACGTAGTCGGCACAGCCTGGTCGCCTTCCACCTCTGGGAGCTGGAGTCCACTGGGGTGGCCTGACTCCCCCAGTC
5921 CCCTTCCCGTGACCTGGTCAGGGTGAGCCCATGTGGAGTCAGCCTCGCAGGCCTCCCTGCCAGTAGGGTCCGAGTGTGTT
6001 TCATCCTTCCCACTCTGTCGAGCCTGGGGGCTGGAGCGGAGACGGGAGGCCTGGCCTGTCTCGGAACCTGTGAGCTGCAC
6081 CAGGTAGAACGCCAGGGACCCCAGAATCATGTGCGTCAGTCCAAGGGGTCCCCTCCAGGAGTAGTGAAGACTCCAGAAAT
6161 GTCCCTTTCTTCTCCCCCATCCTACGAGTAATTGCATTTGCTTTTGTAATTCTTAATGAGCAATATCTGCTAGAGAGTTT
6241 AGCTGTAACAGTTCTTTTTGATCATCTTTTTTTAATAATTAGAAACACCAAAAAAATCCAGAAACTTGTTCTTCCAAAGC
6321 AGAGAGCATTATAATCACCAGGGCCAAAAGCTTCCCTCCCTGCTGTCATTGCTTCTTCTGAGGCCTGAATCCAAAAGAAA
6401 AACAGCCATAGGCCCTTTCAGTGGCCGGGCTACCCGTGAGCCCTTCGGAGGACCAGGGCTGGGGCAGCCTCTGGGCCCAC
6481 ATCCGGGGCCAGCTCCGGCGTGTGTTCAGTGTTAGCAGTGGGTCATGATGCTCTTTCCCACCCAGCCTGGGATAGGGGCA
6561 GAGGAGGCGAGGAGGCCGTTGCCGCTGATGTTTGGCCGTGAACAGGTGGGTGTCTGCGTGCGTCCACGTGCGTGTTTTCT
6641 GACTGACATGAAATCGACGCCCGAGTTAGCCTCACCCGGTGACCTCTAGCCCTGCCCGGATGGAGCGGGGCCCACCCGGT
6721 TCAGTGTTTCTGGGGAGCTGGACAGTGGAGTGCAAAAGGCTTGCAGAACTTGAAGCCTGCTCCTTCCCTTGCTACCACGG
6801 CCTCCTTTCCGTTTGATTTGTCACTGCTTCAATCAATAACAGCCGCTCCAGAGTCAGTAGTCAATGAATATATGACCAAA
6881 TATCACCAGGACTGTTACTCAATGTGTGCCGAGCCCTTGCCCATGCTGGGCTCCCGTGTATCTGGACACTGTAACGTGTG
6961 CTGTGTTTGCTCCCCTTCCCCTTCCTTCTTTGCCCTTTACTTGTCTTTCTGGGGTTTTTCTGTTTGGGTTTGGTTTGGTT
7041 TTTATTTCTCCTTTTGTGTTCCAAACATGAGGTTCTCTCTACTGGTCCTCTTAACTGTGGTGTTGAGGCTTATATTTGTG
7121 TAATTTTTGGTGGGTGAAAGGAATTTTGCTAAGTAAATCTCTTCTGTGTTTGAACTGAAGTCTGTATTGTAACTATGTTT
7201 AAAGTAATTGTTCCAGAGACAAATATTTCTAGACACTTTTTCTTTACAAACAAAAGCATTCGGAGGGAGGGGGATGGTGA
7281 CTGAGATGAGAGGGGAGAGCTGAACAGATGACCCCTGCCCAGATCAGCCAGAAGCCACCCAAAGCAGTGGAGCCCAGGAG
7361 TCCCACTCCAAGCCAGCAAGCCGAATAGCTGATGTGTTGCCACTTTCCAAGTCACTGCAAAACCAGGTTTTGTTCCGCCC
7441 AGTGGATTCTTGTTTTGCTTCCCCTCCCCCCGAGATTATTACCACCATCCCGTGCTTTTAAGGAAAGGCAAGATTGATGT
7521 TTCCTTGAGGGGAGCCAGGAGGGGATGTGTGTGTGCAGAGCTGAAGAGCTGGGGAGAATGGGGCTGGGCCCACCCAAGCA
7601 GGAGGCTGGGACGCTCTGCTGTGGGCACAGGTCAGGCTAATGTTGGCAGATGCAGCTCTTCCTGGACAGGCCAGGTGGTG
7681 GGCATTCTCTCTCCAAGGTGTGCCCCGTGGGCATTACTGTTTAAGACACTTCCGTCACATCCCACCCCATCCTCCAGGGC
7761 TCAACACTGTGACATCTCTATTCCCCACCCTCCCCTTCCCAGGGCAATAAAATGACCATGGAGGGGGCTTGCACTCTCTT
7841 GGCTGTCACCCGATCGCCAGCAAAACTTAGATGTGAGAAAACCCCTTCCCATTCCATGGCGAAAACATCTCCTTAGAAAA
7921 GCCATTACCCTCATTAGGCATGGTTTTGGGCTCCCAAAACACCTGACAGCCCCTCCCTCCTCTGAGAGGCGGAGAGTGCT
8001 GACTGTAGTGACCATTGCATGCCGGGTGCAGCATCTGGAAGAGCTAGGCAGGGTGTCTGCCCCCTCCTGAGTTGAAGTCA
8081 TGCTCCCCTGTGCCAGCCCAGAGGCCGAGAGCTATGGACAGCATTGCCAGTAACACAGGCCACCCTGTGCAGAAGGGAGC
8161 TGGCTCCAGCCTGGAAACCTGTCTGAGGTTGGGAGAGGTGCACTTGGGGCACAGGGAGAGGCCGGGACACACTTAGCTGG
8241 AGATGTCTCTAAAAGCCCTGTATCGTATTCACCTTCAGTTTTTGTGTTTTGGGACAATTACTTTAGAAAATAAGTAGGTC
8321 GTTTTAAAAACAAAAATTATTGATTGCTTTTTTGTAGTGTTCAGAAAAAAGGTTCTTTGTGTATAGCCAAATGACTGAAA
8401 GCACTGATATATTTAAAAACAAAAGGCAATTTATTAAGGAAATTTGTACCATTTCAGTAAACCTGTCTGAATGTACCTGT
8481 ATACGTTTCAAAAACACCCCCCCCCCACTGAATCCCTGTAACCTATTTATTATATAAAGAGTTTGCCTTATAAATTT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUCAAAACGUAUCUAAACGUGu 5'
            || || | ||  |||||||| 
Target 5' acAGCTTAGAAT-TATTTGCACt 3'
964 - 985 160.00 -9.80
2
miRNA  3' agucaaaacgUAUCUAAACGUGu 5'
                    :||| ||||||| 
Target 5' agggccagaaGTAGCTTTGCACt 3'
227 - 249 153.00 -10.90
3
miRNA  3' agucaaaacGUAUCUAAACGUGu 5'
                   || :| ||||||| 
Target 5' ggcagcaccCA-GGTTTTGCACt 3'
5746 - 5767 145.00 -9.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-19a-3p :: MECP2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Reporter assay;Microarray;Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... Experimental Support for Predicted Targets.//{These MTI shown in Fig. 3} ...

- Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al., 2003, Cell.

Article - Lewis, B. P. Shih, I. H. Jones-Rhoades, M. et al.
- Cell, 2003
MicroRNAs (miRNAs) can play important gene regulatory roles in nematodes, insects, and plants by basepairing to mRNAs to specify posttranscriptional repression of these messages. However, the mRNAs regulated by vertebrate miRNAs are all unknown. Here we predict more than 400 regulatory target genes for the conserved vertebrate miRNAs by identifying mRNAs with conserved pairing to the 5' region of the miRNA and evaluating the number and quality of these complementary sites. Rigorous tests using shuffled miRNA controls supported a majority of these predictions, with the fraction of false positives estimated at 31% for targets identified in human, mouse, and rat and 22% for targets identified in pufferfish as well as mammals. Eleven predicted targets (out of 15 tested) were supported experimentally using a HeLa cell reporter system. The predicted regulatory targets of mammalian miRNAs were enriched for genes involved in transcriptional regulation but also encompassed an unexpectedly broad range of other functions.
LinkOut: [PMID: 14697198]
Experimental Support 2 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-19a-3p :: MECP2    [ Non-Functional MTI ]
Validation Method Reporter assay;Other
Article - Pezzolesi, M. G. Platzer, P. Waite, K. A. Eng, C.
- Am J Hum Genet, 2008
Germline mutations in the gene encoding phosphatase and tensin homolog deleted on chromosome ten (PTEN [MIM 601728]) are associated with a number of clinically distinct heritable cancer syndromes, including both Cowden syndrome (CS) and Bannayan-Riley-Ruvalcaba syndrome (BRRS). Seemingly identical pathogenic PTEN mutations have been observed in patients with CS and BRRS, as well as in patients with incomplete features of CS, referred to as CS-like (CSL) patients. These observations indicate that additional, unidentified, genetic and epigenetic factors act as phenotypic modifiers in these disorders. These genetic factors could also contribute to disease in patients with CS, CSL, or BRRS without identifiable PTEN mutations. Two potential modifiers are miR-19a and miR-21, which are previously identified PTEN-targeting miRNAs. We investigated the role of these miRNAs by characterizing their relative expression levels in PTEN-mutation-positive and PTEN-mutation-negative patients with CS, CSL, or BRRS. Interestingly, we observed differential expression of miR-19a and miR-21 in our PTEN-mutation-positive patients. Both were found to be significantly overexpressed within this group (p < 0.01) and were inversely correlated with germline PTEN protein levels. Similarly, the relative expression of miR-19a and miR-21 was differentially expressed in a series of PTEN-mutation-negative patients with CS or CSL with variable clinical phenotypes and decreased full-length PTEN protein expression. Among PTEN-mutation-positive patients with CS, both miRNAs were significantly overexpressed (p = 0.006-0.013). Taken together, our study results suggest that differential expression of PTEN-targeting miR-19a and miR-21 modulates the PTEN protein levels and the CS and CSL phenotypes, irrespective of the patient's mutation status, and support their roles as genetic modifiers in CS and CSL.
LinkOut: [PMID: 18460397]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
39 hsa-miR-19a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001794 HOXA5 homeobox A5 2 2
MIRT001795 MECP2 methyl CpG binding protein 2 (Rett syndrome) 3 2
MIRT002958 PTEN phosphatase and tensin homolog 4 5
MIRT003214 ESR1 estrogen receptor 1 4 2
MIRT003426 CCND1 cyclin D1 5 3
MIRT003533 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 3 3
MIRT003536 NR4A2 nuclear receptor subfamily 4, group A, member 2 3 3
MIRT003781 ATXN1 ataxin 1 4 3
MIRT004334 KAT2B K(lysine) acetyltransferase 2B 3 2
MIRT004337 SOCS1 suppressor of cytokine signaling 1 3 3
MIRT004350 PRMT5 protein arginine methyltransferase 5 2 2
MIRT004452 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 5
MIRT004593 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 3 3
MIRT004934 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 4 3
MIRT005396 ARIH2 ariadne homolog 2 (Drosophila) 2 2
MIRT005630 SMAD4 SMAD family member 4 3 2
MIRT006179 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 4 1
MIRT006475 CUL5 cullin 5 2 1
MIRT006646 TLR2 toll-like receptor 2 3 1
MIRT006787 TNF tumor necrosis factor 1 1
MIRT007118 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT007119 RAB13 RAB13, member RAS oncogene family 1 1
MIRT007120 MSMO1 sterol-C4-methyl oxidase-like 1 1
MIRT007121 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT007122 PSAP prosaposin 1 1
MIRT031304 THBS1 thrombospondin 1 1 1
MIRT031305 CTGF connective tissue growth factor 1 1
MIRT031306 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT031307 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT031308 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT031309 RAB14 RAB14, member RAS oncogene family 1 1
MIRT050641 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT050642 RNF4 ring finger protein 4 1 1
MIRT050643 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT050644 TMEM87A transmembrane protein 87A 1 1
MIRT050645 MTF2 metal response element binding transcription factor 2 1 1
MIRT050646 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT050647 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT050648 WDFY3 WD repeat and FYVE domain containing 3 1 1