Accession ID: MIRT001800 [miRNA, hsa-miR-16-5p :: BCL2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-16-1LinkOut: [miRBase ]
Description Homo sapiens miR-16-1 stem-loop
Comment Human miR-16 has been cloned by independent groups . A second putative mir-16 hairpin precursor is located on chromosome 3 (MIR:MI0000738).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-16-5p
Mature Sequence 14| UAGCAGCACGUAAAUAUUGGCG |35
Evidence Experimental
Experiments Northern
Putative hsa-miR-16-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_0006    LinkOut: [ RefSeq ]
Other Transcripts NM_0006   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_0006|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcGGUUAUAAAUGCACGACGAu 5'
            |||||  |   |||||||| 
Target 5' atCCAATCCT---GTGCTGCTa 3'
2521 - 2539 157.00 -18.60
2
miRNA  3' gcGGUUAUAAAUGCACGACGau 5'
            :||||:||||  |||||:  
Target 5' gtTCAATGTTTA-ATGCTGTgg 3'
1766 - 1786 135.00 -13.90
3
miRNA  3' gcGGUUAUAAAUGC--ACGACGAU 5'
            :::|||||| ||   |||||| 
Target 5' ggTTGATATTT-CGAAAGCTGCTT 3'
1785 - 1807 133.00 -14.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions CLL patient samples
Location of target site 3'UTR
Original Description (Extracted from the article) ... BCL2 Is a Target of Posttranscriptional Repression by miR-15 and miR-16.//both mutants completely abolish the interaction between miR-15a and miR-16-1 and the 3'UTR of BCL2 (Fig. 2C).//These data indicate that both miRNAs directly interact with the 3'UTR of BCL2. ...

- Cimmino, A. Calin, G. A. Fabbri, M. Iorio, et al., 2005, Proc Natl Acad Sci U S A.

Article - Cimmino, A. Calin, G. A. Fabbri, M. Iorio, et al.
- Proc Natl Acad Sci U S A, 2005
Chronic lymphocytic leukemia (CLL) is the most common human leukemia and is characterized by predominantly nondividing malignant B cells overexpressing the antiapoptotic B cell lymphoma 2 (Bcl2) protein. miR-15a and miR-16-1 are deleted or down-regulated in the majority of CLLs. Here, we demonstrate that miR-15a and miR-16-1 expression is inversely correlated to Bcl2 expression in CLL and that both microRNAs negatively regulate Bcl2 at a posttranscriptional level. BCL2 repression by these microRNAs induces apoptopsis in a leukemic cell line model. Therefore, miR-15 and miR-16 are natural antisense Bcl2 interactors that could be used for therapy of Bcl2-overexpressing tumors.
LinkOut: [PMID: 16166262]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Garzon, R. Pichiorri, F. Palumbo, T. et al.
- Oncogene, 2007
MicroRNAs (miRNAs) are small non-coding RNAs of 19-25 nucleotides that are involved in the regulation of critical cell processes such as apoptosis, cell proliferation and differentiation. However, little is known about the role of miRNAs in granulopoiesis. Here, we report the expression of miRNAs in acute promyelocytic leukemia patients and cell lines during all-trans-retinoic acid (ATRA) treatment by using a miRNA microarrays platform and quantitative real time-polymerase chain reaction (qRT-PCR). We found upregulation of miR-15a, miR-15b, miR-16-1, let-7a-3, let-7c, let-7d, miR-223, miR-342 and miR-107, whereas miR-181b was downregulated. Among the upregulated miRNAs, miR-107 is predicted to target NFI-A, a gene that has been involved in a regulatory loop involving miR-223 and C/EBPa during granulocytic differentiation. Indeed, we have confirmed that miR-107 targets NF1-A. To get insights about ATRA regulation of miRNAs, we searched for ATRA-modulated transcription factors binding sites in the upstream genomic region of the let-7a-3/let-7b cluster and identified several putative nuclear factor-kappa B (NF-kappaB) consensus elements. The use of reporter gene assays, chromatin immunoprecipitation and site-directed mutagenesis revealed that one proximal NF-kappaB binding site is essential for the transactivation of the let-7a-3/let-7b cluster. Finally, we show that ATRA downregulation of RAS and Bcl2 correlate with the activation of known miRNA regulators of those proteins, let-7a and miR-15a/miR-16-1, respectively.
LinkOut: [PMID: 17260024]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Raveche, E. S. Salerno, E. Scaglione, B. J. et al.
- Blood, 2007
New Zealand black (NZB) mice with autoimmune and B lymphoproliferative disease (B-LPD) are a model for human chronic lymphocytic leukemia (CLL). A genomewide linkage scan of the NZB loci associated with lymphoma was conducted in F1 backcrosses of NZB and a control strain, DBA/2. Of 202 mice phenotyped for the presence or absence of LPD, surface maker expression, DNA content, and microsatellite polymorphisms, 74 had disease. The CD5(+), IgM(+), B220(dim), hyperdiploid LPD was linked to 3 loci on chromosomes 14, 18, and 19 that are distinct from previously identified autoimmunity-associated loci. The region of synteny with mouse D14mit160 is the human 13q14 region, associated with human CLL, containing microRNAs mir-15a16-1. DNA sequencing of multiple NZB tissues identified a point mutation in the 3' flanking sequence of the identical microRNA, mir-16-1, and this mutation was not present in other strains, including the nearest neighbor, NZW. Levels of miR-16 were decreased in NZB lymphoid tissue. Exogenous miR-16 delivered to an NZB malignant B-1 cell line resulted in cell-cycle alterations and increased apoptosis. Linkage of the mir-15a/16-1 complex and the development of B-LPD in this spontaneous mouse model suggest that the altered expression of the mir-15a/16-1 is the molecular lesion in CLL.
LinkOut: [PMID: 17351108]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Calin, G. A. Pekarsky, Y. Croce, C. M.
- Best Pract Res Clin Haematol, 2007
New findings support the view that chronic lymphocytic leukemia (CLL) is a genetic disease in which the main alterations occur in a new class of genes named microRNAs (miRNAs). Cases with good prognostic features typically are characterized by miRNA down-regulation of genes miR-15a and miR-16-1, located at 13q14.3. Both microRNAs negatively regulate BCL2 at a post-transcriptional level. On the other hand, in CLL cases that use unmutated immunoglobulin heavy-chain variable-region genes (IgV(H)) or have high-level expression of the 70-kD zeta-associated protein (ZAP-70) have high levels of TCL1 due to low-level expression of miR-29 and miR-181, which directly target this oncogene. Conceivably, these miRNAs might be used to target BCL2 or TCL1 for therapy of this disease.
LinkOut: [PMID: 17707831]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions HeLa 229
Location of target site 3'UTR
Original Description (Extracted from the article) ... We present evidence for the down-regulation of c-MYC, one of the most potent and frequently deregulated oncogenes, by let-7 miRNA, via the predicted binding site in the 3`UTR, and verify the suppression of BCL-2 by miR16. ...

- Koscianska, E. Baev, V. Skreka, K. et al., 2007, BMC Mol Biol.

Article - Koscianska, E. Baev, V. Skreka, K. et al.
- BMC Mol Biol, 2007
BACKGROUND: MicroRNAs (miRNAs) are one of the most abundant groups of regulatory genes in multicellular organisms, playing important roles in many fundamental cellular processes. More than four hundred miRNAs have been identified in humans and the deregulation of miRNA expression has been also shown in many cancers. Despite the postulated involvement of miRNAs in tumourigenesis, there are only a few examples where an oncogene or a tumour suppressor has been identified as a miRNA target. RESULTS: Here, we present an in silico analysis of potential miRNA- oncogene interactions. Moreover, we have tested the validity of two possible interactions of miRNAs with genes related to cancer. We present evidence for the down-regulation of c-MYC, one of the most potent and frequently deregulated oncogenes, by let-7 miRNA, via the predicted binding site in the 3'UTR, and verify the suppression of BCL-2 by miR16. CONCLUSION: In this work both bioinformatic and experimental approaches for the prediction and validation of possible targets for miRNAs have been used. A list of putative targets for different oncomirs, validation of which would be of special interest, is proposed and two such interactions have been experimentally validated.
LinkOut: [PMID: 17877811]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Cho, W. C.
- Mol Cancer, 2007
microRNAs (miRNAs) are evolutionarily conserved, endogenous, small, noncoding RNA molecules of about 22 nucleotides in length that function as posttranscriptional gene regulators. They are deemed to play a crucial role in the initiation and progression of human cancer, and those with a role in cancer are designated as oncogenic miRNAs (oncomiRs). For example, miR-15 and miR-16 induce apoptosis by targeting Bcl2. miRNAs from the miR-17-92 cluster modulate tumor formation and function as oncogenes by influencing the translation of E2F1 mRNA. miR-21 modulates gemcitabine-induced apoptosis by phosphatase and tensin homolog deleted on chromosome 10-dependent activation of PI 3-kinase signaling. miR-34a acts as a suppressor of neuroblastoma tumorigenesis by targeting the mRNA encoding E2F3 and reducing E2F3 protein levels. The chromosomal translocations associating with human tumors disrupt the repression of High mobility group A2 by let-7 miRNA. In addition, the oncomiRs expression profiling of human malignancies has also identified a number of diagnostic and prognostic cancer signatures. This article introduces the roles of oncomiRs in neoplasm development, progression, diagnosis, prognostication, as well as their mechanism of actions on target mRNAs and the functional outcomes of their actions on mRNAs. The paper ends with a brief perspective to the future of oncomiRs.
LinkOut: [PMID: 17894887]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method qRT-PCR , proteomics analysis , Other
Location of target site 3'UTR
Original Description (Extracted from the article) ... changed ...

- Calin, G. A. Cimmino, A. Fabbri, M. et al., 2008, Proc Natl Acad Sci U S A.

Article - Calin, G. A. Cimmino, A. Fabbri, M. et al.
- Proc Natl Acad Sci U S A, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , , Reporter assay
Conditions SGC7901/VCR
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... As expected, this suppression was abolished by deleting part of the perfectly complementary sequences in the BCL2 3`-UTR (pGL3-mutBcl2-30UTR) which disrupts the interaction between miR-15b/miR-16 and BCL2 (Fig. 3d). Taken together, these results demonstrate that miR-15b and miR-16 directly inhibit BCL2 expression at posttranscriptional level through its 3`UTR. ...

- Xia, L. Zhang, D. Du, R. Pan, Y. Zhao, L. et al., 2008, Int J Cancer.

Article - Xia, L. Zhang, D. Du, R. Pan, Y. Zhao, L. et al.
- Int J Cancer, 2008
microRNAs are endogenous small noncoding RNAs that regulate gene expression negatively at posttranscriptional level. This latest addition to the complex gene regulatory circuitry revolutionizes our way to understanding physiological and pathological processes in the human body. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in gastric cancer cells. microRNA expression profiling revealed a limited set of microRNAs with altered expression in multidrug- resistant gastric cancer cell line SGC7901/VCR compared to its parental SGC7901 cell line. Among the downregulated microRNAs are miR-15b and miR-16, members of miR-15/16 family, whose expression was further validated by qRT-PCR. In vitro drug sensitivity assay demonstrated that overexpression of miR-15b or miR-16 sensitized SGC7901/VCR cells to anticancer drugs whereas inhibition of them using antisense oligonucleotides conferred SGC7901 cells MDR. The downregulation of miR-15b and miR-16 in SGC7901/VCR cells was concurrent with the upregulation of Bcl-2 protein. Enforced mir-15b or miR-16 expression reduced Bcl-2 protein level and the luciferase activity of a BCL2 3' untranslated region-based reporter construct in SGC7901/VCR cells, suggesting that BCL2 is a direct target of miR-15b and miR-16. Moreover, overexpression of miR-15b or miR-16 could sensitize SGC7901/VCR cells to VCR-induced apoptosis. Taken together, our findings suggest that miR-15b and miR-16 could play a role in the development of MDR in gastric cancer cells at least in part by modulation of apoptosis via targeting BCL2.
LinkOut: [PMID: 18449891]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Bonci, D. Coppola, V. Musumeci, M. Addario, et al.
- Nat Med, 2008
MicroRNAs (miRNAs) are noncoding small RNAs that repress protein translation by targeting specific messenger RNAs. miR-15a and miR-16-1 act as putative tumor suppressors by targeting the oncogene BCL2. These miRNAs form a cluster at the chromosomal region 13q14, which is frequently deleted in cancer. Here, we report that the miR-15a and miR-16-1 cluster targets CCND1 (encoding cyclin D1) and WNT3A, which promotes several tumorigenic features such as survival, proliferation and invasion. In cancer cells of advanced prostate tumors, the miR-15a and miR-16 level is significantly decreased, whereas the expression of BCL2, CCND1 and WNT3A is inversely upregulated. Delivery of antagomirs specific for miR-15a and miR-16 to normal mouse prostate results in marked hyperplasia, and knockdown of miR-15a and miR-16 promotes survival, proliferation and invasiveness of untransformed prostate cells, which become tumorigenic in immunodeficient NOD-SCID mice. Conversely, reconstitution of miR-15a and miR-16-1 expression results in growth arrest, apoptosis and marked regression of prostate tumor xenografts. Altogether, we propose that miR-15a and miR-16 act as tumor suppressor genes in prostate cancer through the control of cell survival, proliferation and invasion. These findings have therapeutic implications and may be exploited for future treatment of prostate cancer.
LinkOut: [PMID: 18931683]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Guo, C. J. Pan, Q. Li, D. G. Sun, H. Liu, B. W.
- J Hepatol, 2009
BACKGROUND/AIMS: To reveal the microRNA (miRNA) expression profile and related roles in rat HSCs during activation. METHODS: miRNA expression profiling was analyzed in quiescent and in culture-activated HSCs by microarray. The differentially expressed miRNAs, as verified by RT-PCR, were subjected to gene ontology (GO) analysis. Furthermore, the effects of miR-16 and miR-15b on the apoptosis of activated HSCs were investigated by Hoechst 33258, TUNEL staining and annexin-V/PI labeling flow cytometry. The underlying mechanism related to Bcl-2 and caspases was assessed. RESULTS: The upregulated and downregulated miRNAs in activated HSCs were 12 miRNAs and 9 miRNAs, respectively. The differential expression of miR-16, -15b, -122, -138, -143, and -140 was validated. High-enrichment GOs containing apoptosis-related targeted genes and miRNA-gene networks characterized by Bcl-2, which was targeted by the miR-15/16 family, uncovered the critical role of miR-16 and miR-15b in apoptosis. Restoring the intracellular miRNAs by miR-16 and miR-15b administration greatly reduced Bcl-2, and increased the expression of caspases 3, 8, and 9. Significantly elevated rates of apoptosis were then induced in activated HSCs. CONCLUSIONS: The activation of HSCs relate to 21 miRNAs. Among these, mir-15b and miR-16 may be essential for apoptosis by targeting Bcl-2 and the caspase signaling pathway.
LinkOut: [PMID: 19232449]
Experimental Support 11 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Conditions HepG2
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-16 targets Bcl-2 in HepG2 cells.//By Western blot analysis, transfection with miR-16 precursor was found to suppress, while transfection with anti-miR-16 inhibitor increased the Bcl-2 expression in HepG2 cells. Furthermore, transfection with anti-miR-16 inhibitor increased, while transfection with miR-16 precursor suppressed the luciferase reporter activity of pGL3-bcl2 construct in cells (Fig. 3). ...

- Tsang, W. P. Kwok, T. T., 2010, J Nutr Biochem.

Article - Tsang, W. P. Kwok, T. T.
- J Nutr Biochem, 2010
Epigallocatechin gallate (EGCG) is a major type of green tea polyphenols and is known to have cancer prevention effect. MicroRNAs (miRNAs) are 19 to 25 nucleotides and are believed to be important in gene regulation. In the present study, the influence of EGCG on the expressions of miRNAs in human cancer cells was investigated as this has not yet been reported. By miRNA microarray analysis, EGCG treatment was found to modify the expressions of some of the miRNAs in human hepatocellular carcinoma HepG2 cells, 13 were up-regulated and 48 were down-regulated. miR-16 is one of the miRNAs up-regulated by EGCG and one of its target genes is confirmed to be the anti-apoptotic protein Bcl-2. EGCG treatment induced apoptosis and down-regulated Bcl-2 in HepG2 cells. Transfection with anti-miR-16 inhibitor suppressed miR-16 expression and counteracted the EGCG effects on Bcl-2 down-regulation and also induction of apoptosis in cells. Results from the present study confirm the role of miR-16 in mediating the apoptotic effect of EGCG and also support the importance of miRNAs in the regulation of the biological activity of EGCG.
LinkOut: [PMID: 19269153]
Experimental Support 12 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Western blot
Conditions OV-202
Original Description (Extracted from the article) ... MiR-15a and miR-16 also target Bcl-2 in ovarian cancer cell lines. ...

- Bhattacharya, R. Nicoloso, M. Arvizo, R. et al., 2009, Cancer Res.

Article - Bhattacharya, R. Nicoloso, M. Arvizo, R. et al.
- Cancer Res, 2009
Oncogenic activation of Bmi-1 is found in a wide variety of epithelial malignancies including ovarian cancer, yet a specific mechanism for overexpression of Bmi-1 has not been determined. Thus, realizing the immense pathologic significance of Bmi-1 in cancer, we wanted to investigate if microRNA (miRNA) aberrations played a role in the regulation of Bmi-1 in ovarian cancer. In this report, we identify two miRNAs, miR-15a and miR-16, that are underexpressed in ovarian cell lines and in primary ovarian tissues. We show that these miRNAs directly target the Bmi-1 3' untranslated region and significantly correlate with Bmi-1 protein levels in ovarian cancer patients and cell lines. Furthermore, Bmi-1 protein levels are downregulated in response to miR-15a or miR-16 expression and lead to significant reduction in ovarian cancer cell proliferation and clonal growth. These findings suggest the development of therapeutic strategies by restoring miR-15a and miR-16 expression in ovarian cancer and in other cancers that involve upregulation of Bmi-1.
LinkOut: [PMID: 19903841]
Experimental Support 13 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 14 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Immunohistochemistry , Microarray , Western blot
Conditions artificial tissues
Location of target site 3'UTR
Original Description (Extracted from the article) ... we show that miR-16 is upregulated, suggesting cellular BCL2 levels would be lower, which indeed is the case. ...

- Kovalchuk, O. Zemp, F. J. Filkowski, J. N. et al., 2010, Carcinogenesis.

Article - Kovalchuk, O. Zemp, F. J. Filkowski, J. N. et al.
- Carcinogenesis, 2010
The radiation-induced bystander effect (RIBE) is a phenomenon whereby unexposed cells exhibit molecular symptoms of stress exposure when adjacent or nearby cells are traversed by ionizing radiation (IR). Recent data suggest that RIBE may be epigenetically mediated by microRNAs (miRNAs), which are small regulatory molecules that target messenger RNA transcripts for translational inhibition. Here, we analyzed microRNAome changes in bystander tissues after alpha-particle microbeam irradiation of three-dimensional artificial human tissues using miRNA microarrays. Our results indicate that IR leads to a deregulation of miRNA expression in bystander tissues. We report that major bystander end points, including apoptosis, cell cycle deregulation and DNA hypomethylation, may be mediated by altered expression of miRNAs. Specifically, c-MYC-mediated upregulation of the miR-17 family was associated with decreased levels of E2F1 and RB1, suggesting a switch to a proliferative state in bystander tissues, while priming these cells for impending death signals. Upregulation of the miR-29 family resulted in decreased levels of its targets DNMT3a and MCL1, consequently affecting DNA methylation and apoptosis. Altered expression of miR-16 led to changes in expression of BCL2, suggesting modulation of apoptosis. Thus, our data clearly show that miRNAs play a profound role in the manifestation of late RIBE end points. In summary, this study creates a roadmap for understanding the role of microRNAome in RIBE and for developing novel RIBE biomarkers.
LinkOut: [PMID: 20643754]
Experimental Support 15 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Western blot
Conditions MCF-7 , MDA-MB-231
Disease breast carcinoma
Location of target site 3'UTR
Original Description (Extracted from the article) ... These results further implicate the BCL-2 targeting miR-15a/16 as important regulators of BCL-2 expression and tamoxifen response and suggest that oncogene suppression of miR-15a and/or miR-16 may represent an important mechanism of tamoxifen resistance. ...

- Cittelly, D. M. Das, P. M. Salvo, V. A. et al., 2010, Carcinogenesis.

Article - Cittelly, D. M. Das, P. M. Salvo, V. A. et al.
- Carcinogenesis, 2010
Tamoxifen is the most commonly prescribed therapy for patients with estrogen receptor (ERalpha) positive breast tumors. Tumor resistance to tamoxifen remains a serious clinical problem especially in patients with tumors that also overexpress HER2. Current preclinical models of HER2 overexpression fail to recapitulate the clinical spectrum of endocrine resistance associated with HER2/ER positive tumors. Here we show that ectopic expression of a clinically important oncogenic isoform of HER2, HER2Delta16, which is expressed in over 30% of ER positive breast tumors, promotes tamoxifen resistance and estrogen independence of MCF-7 xenografts. MCF-7/HER2Delta16 cells evade tamoxifen through upregulation of BCL-2, whereas RNAi-mediated suppression of BCL-2 expression or treatment of MCF-7/HER2Delta16 cells with the BCL-2 family pharmacological inhibitor ABT-737 restores tamoxifen sensitivity. Tamoxifen-resistant MCF-7/HER2Delta16 cells upregulate BCL-2 protein levels in response to suppressed ERalpha signaling mediated by estrogen withdrawal, tamoxifen treatment, or fulvestrant treatment. In addition, HER2Delta16 expression results in suppression of BCL-2 targeting microRNAs miR-15a and miR-16. Reintroduction of miR-15a/16 reduced tamoxifen-induced BCL-2 expression and sensitized MCF-7/HER2Delta16 to tamoxifen. Conversely, inhibition of miR-15a/16 in tamoxifen sensitive cells activated BCL-2 expression and promoted tamoxifen resistance. Our results suggest that HER2Delta16 expression promotes endocrine-resistant HER2/ERalpha positive breast tumors and in contrast to wild-type HER2, preclinical models of HER2Delta16 overexpression recapitulate multiple phenotypes of endocrine resistant human breast tumors. The mechanism of HER2Delta16 therapeutic evasion, involving tamoxifen induced upregulation of BCL-2 and suppression of miR-15a/16, provides a template for unique therapeutic interventions combining tamoxifen with modulation of microRNAs and/or ABT-737 mediated BCL-2 inhibition and apoptosis.
LinkOut: [PMID: 20876285]
Experimental Support 16 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16-5p :: BCL2    [ Functional MTI ]
Validation Method Other
Article - Klein, U. Dalla-Favera, R.
- Semin Cancer Biol, 2010
Chronic lymphocytic leukemia (CLL), an incurable disease of the elderly, stands out as unique among the malignancies derived from mature B lymphocytes. The histology, immunophenotype, immunoglobulin variable region (IgV) gene somatic hypermutation status, and the pattern of genetic alterations of the tumor cells are markedly distinct from that of any other B-cell tumor. Most notably, CLL cases can have somatically mutated as well as unmutated IgV genes which largely correlate with a favorable and unfavorable clinical prognosis, respectively. Moreover, recent evidence suggests that 6% of the normal elderly population develops a monoclonal B-cell lymphocytosis (MBL) that appears as the precursor to CLL in 1-2% of cases. Over the last decade, global gene expression profile analysis was instrumental in defining CLL as a malignancy originating from the oncogenic transformation of a common cellular precursor that resembles an antigen-experienced B cell. These findings were complemented by the realization that all CLL, independent of their IgV gene somatic mutation status, express B-cell receptors (BCRs) that show evidence of antigen-experience. Indeed, the BCRs of CLL cases among different individuals can be similar to the extent that one was able to define subsets of stereotyped receptors based on the homology in the antigen-binding regions. Together, these observations strongly support the notion that antigen plays a critical role in CLL pathogenesis. This role is complemented by genetic alterations that, analogous to most cancer types, represent the initiating pathogenetic event. In fact, CLL cases display recurrent genetic aberrations including trisomy 12 and monoallelic or biallelic deletion/inactivation of chromosomal regions 17p, 11q and 13q14. However, virtually all CLL cases lack balanced reciprocal chromosomal translocations, the genetic hallmark of germinal center (GC)-derived lymphomas. The most frequent genetic aberration in CLL, deletion of chromosomal region 13q14, was recently shown to have a specific role in CLL pathogenesis. This region encodes a tumor suppressor locus comprising a microRNA cluster embedded in a long sterile RNA gene, whose deletion in the mouse leads to lymphoproliferative syndromes recapitulating the human CLL-associated spectrum, including MBL, CLL and B-cell non-Hodgkin lymphoma (B-NHL). This review will focus on the cellular origin of CLL, its relationship to the mechanisms of generating CLL-associated genetic lesions and on the role of the 13q14 deletion in CLL pathogenesis as emerging from the analysis of a newly generated mouse model.
LinkOut: [PMID: 21029776]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1158 hsa-miR-16-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000266 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT000267 CDK2 cyclin-dependent kinase 2 1 1
MIRT000268 CDK1 cyclin-dependent kinase 1 1 1
MIRT000270 HMGA1 high mobility group AT-hook 1 4 2
MIRT000536 ACVR2A activin A receptor, type IIA 3 1
MIRT000803 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000805 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT000807 TPI1 triosephosphate isomerase 1 1 1
MIRT000809 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 2 1
MIRT000811 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000816 WT1 Wilms tumor 1 2 1
MIRT000818 ASXL2 additional sex combs like 2 (Drosophila) 2 1
MIRT000822 TMEM251 chromosome 14 open reading frame 109 2 1
MIRT000824 CARD8 caspase recruitment domain family, member 8 2 1
MIRT000826 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 1
MIRT000828 CENPJ centromere protein J 2 1
MIRT000830 CEP63 centrosomal protein 63kDa 2 1
MIRT000832 CREBL2 cAMP responsive element binding protein-like 2 2 1
MIRT000834 ECHDC1 enoyl CoA hydratase domain containing 1 2 1
MIRT000846 GOLGA5 golgin A5 2 1
MIRT000848 GOLPH3L golgi phosphoprotein 3-like 2 1
MIRT000850 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 2 1
MIRT000852 H3F3B H3 histone, family 3B (H3.3B) 2 1
MIRT000854 HACE1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 2 1
MIRT000856 HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 2 1
MIRT000858 HERC6 hect domain and RLD 6 2 1
MIRT000862 HRSP12 heat-responsive protein 12 2 1
MIRT000864 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000867 JUN jun oncogene 2 1
MIRT000877 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT000879 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 2 1
MIRT000883 OMA1 OMA1 homolog, zinc metallopeptidase (S. cerevisiae) 2 1
MIRT000885 OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 2 1
MIRT000887 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000889 PHKB phosphorylase kinase, beta 2 1
MIRT000891 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2 1
MIRT000893 PNN pinin, desmosome associated protein 2 1
MIRT000895 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT000897 RAD51C RAD51 homolog C (S. cerevisiae) 2 1
MIRT000899 RHOT1 ras homolog gene family, member T1 2 1
MIRT000901 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 2 1
MIRT000905 SLC35A1 solute carrier family 35 (CMP-sialic acid transporter), member A1 2 1
MIRT000907 SLC35B3 solute carrier family 35, member B3 2 1
MIRT000909 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 2 1
MIRT000913 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT000915 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000921 ZNF559 zinc finger protein 559 2 1
MIRT000939 CDK6 cyclin-dependent kinase 6 4 1
MIRT000940 CCND3 cyclin D3 4 1
MIRT001225 CCND1 cyclin D1 4 7
MIRT001226 CCNE1 cyclin E1 6 8
MIRT001395 ZNF622 zinc finger protein 622 3 2
MIRT001396 YIF1B Yip1 interacting factor homolog B (S. cerevisiae) 3 2
MIRT001397 VTI1B vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 3 2
MIRT001398 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 2 1
MIRT001399 UBE4A ubiquitination factor E4A (UFD2 homolog, yeast) 2 1
MIRT001400 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT001401 UBE2S ubiquitin-conjugating enzyme E2S 2 1
MIRT001402 TXN2 thioredoxin 2 2 1
MIRT001403 TPM3 tropomyosin 3 2 1
MIRT001404 TOMM34 translocase of outer mitochondrial membrane 34 3 2
MIRT001405 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 2 1
MIRT001406 TMEM43 transmembrane protein 43 3 2
MIRT001407 TMEM109 transmembrane protein 109 2 1
MIRT001408 SRPRB signal recognition particle receptor, B subunit 2 1
MIRT001409 SRPR signal recognition particle receptor (docking protein) 2 1
MIRT001410 SQSTM1 sequestosome 1 2 1
MIRT001411 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 2 1
MIRT001412 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 2 1
MIRT001413 SLC38A5 solute carrier family 38, member 5 2 1
MIRT001414 SLC38A1 solute carrier family 38, member 1 2 1
MIRT001415 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 2 1
MIRT001416 SLC16A3 solute carrier family 16, member 3 (monocarboxylic acid transporter 4) 2 1
MIRT001417 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 2 1
MIRT001418 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 3 2
MIRT001419 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 2 1
MIRT001420 SEC24A SEC24 family, member A (S. cerevisiae) 2 1
MIRT001421 RTN4 reticulon 4 3 2
MIRT001422 RFT1 RFT1 homolog (S. cerevisiae) 2 1
MIRT001423 RARS arginyl-tRNA synthetase 4 4
MIRT001424 RAB30 RAB30, member RAS oncogene family 2 1
MIRT001425 PURA purine-rich element binding protein A 4 3
MIRT001426 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 3 2
MIRT001427 PSAT1 phosphoserine aminotransferase 1 2 1
MIRT001428 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 2 1
MIRT001429 PPIF peptidylprolyl isomerase F 2 1
MIRT001430 PLK1 polo-like kinase 1 (Drosophila) 2 1
MIRT001431 PISD phosphatidylserine decarboxylase 1 1
MIRT001432 PHLDB2 pleckstrin homology-like domain, family B, member 2 2 1
MIRT001433 PANX1 pannexin 1 2 1
MIRT001434 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 2 1
MIRT001435 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 2 1
MIRT001437 NOTCH2 Notch homolog 2 (Drosophila) 2 1
MIRT001439 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 2 1
MIRT001440 MRPL20 mitochondrial ribosomal protein L20 1 1
MIRT001441 MLLT11 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 2 1
MIRT001442 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT001444 LYPLA2 lysophospholipase II 2 1
MIRT001445 LUZP1 leucine zipper protein 1 3 2
MIRT001446 LAMC1 laminin, gamma 1 (formerly LAMB2) 2 1
MIRT001447 KPNA3 karyopherin alpha 3 (importin alpha 4) 2 1
MIRT001448 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 2 1
MIRT001449 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 3 2
MIRT001450 IPO4 importin 4 2 1
MIRT001451 IGF2R insulin-like growth factor 2 receptor 2 1
MIRT001452 IFRD2 interferon-related developmental regulator 2 2 1
MIRT001454 IFRD1 interferon-related developmental regulator 1 2 1
MIRT001455 HMOX1 heme oxygenase (decycling) 1 2 1
MIRT001456 HSPA1A heat shock 70kDa protein 1A 3 2
MIRT001457 HSPA1B heat shock 70kDa protein 1B 2 2
MIRT001458 LAMTOR5 hepatitis B virus x interacting protein 2 1
MIRT001459 HARS2 histidyl-tRNA synthetase 2, mitochondrial (putative) 2 1
MIRT001460 HARS histidyl-tRNA synthetase 2 1
MIRT001461 GSTM4 glutathione S-transferase mu 4 2 1
MIRT001462 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 1
MIRT001463 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 2 1
MIRT001464 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 1
MIRT001465 GFM1 G elongation factor, mitochondrial 1 2 1
MIRT001466 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 2 1
MIRT001467 FNDC3B fibronectin type III domain containing 3B 3 2
MIRT001468 FGF2 fibroblast growth factor 2 (basic) 3 2
MIRT001469 EIF4E eukaryotic translation initiation factor 4E 2 1
MIRT001470 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 2 1
MIRT001471 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 3 2
MIRT001472 CHORDC1 cysteine and histidine-rich domain (CHORD)-containing 1 2 1
MIRT001473 CDK5RAP1 CDK5 regulatory subunit associated protein 1 2 1
MIRT001474 CACNA2D1 calcium channel, voltage-dependent, alpha 2/delta subunit 1 2 1
MIRT001475 CA12 carbonic anhydrase XII 3 2
MIRT001476 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 3 2
MIRT001477 SNX15 sorting nexin 15 1 1
MIRT001478 ARL2 ADP-ribosylation factor-like 2 6 2
MIRT001479 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 2 1
MIRT001480 ADSS adenylosuccinate synthase 2 1
MIRT001481 ACP2 acid phosphatase 2, lysosomal 2 1
MIRT001482 ABHD10 abhydrolase domain containing 10 2 1
MIRT001483 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 2 1
MIRT001484 F2 coagulation factor II (thrombin) 2 1
MIRT001800 BCL2 B-cell CLL/lymphoma 2 6 18
MIRT001801 CCNT2 cyclin T2 2 1
MIRT002475 CFL2 cofilin 2 (muscle) 1 1
MIRT002476 CSHL1 chorionic somatomammotropin hormone-like 1 1 1
MIRT002477 CRHBP corticotropin releasing hormone binding protein 1 1
MIRT003326 RPS6 ribosomal protein S6 1 2
MIRT003328 BRCA1 breast cancer 1, early onset 2 2
MIRT003329 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT003430 WNT3A wingless-type MMTV integration site family, member 3A 3 3
MIRT003431 CCND2 cyclin D2 1 2
MIRT003890 VEGFA vascular endothelial growth factor A 4 7
MIRT004366 WIPF1 WAS/WASL interacting protein family, member 1 2 1
MIRT004367 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 2 1
MIRT004368 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT004369 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT004370 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT004371 FAM69A family with sequence similarity 69, member A 2 1
MIRT004372 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT004373 FAM122C family with sequence similarity 122C 2 1
MIRT004374 PWWP2A PWWP domain containing 2A 2 1
MIRT004375 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT004376 CCDC111 coiled-coil domain containing 111 2 1
MIRT004377 C2orf43 chromosome 2 open reading frame 43 2 1
MIRT004378 C4orf27 chromosome 4 open reading frame 27 2 1
MIRT004379 NIPAL2 NIPA-like domain containing 2 2 1
MIRT004380 TRMT13 coiled-coil domain containing 76 2 1
MIRT004381 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT004382 CADM1 cell adhesion molecule 1 3 1
MIRT004470 TPPP3 tubulin polymerization-promoting protein family member 3 2 1
MIRT004637 MYB v-myb myeloblastosis viral oncogene homolog (avian) 4 2
MIRT004742 AURKB aurora kinase B 3 2
MIRT005086 CAPRIN1 cell cycle associated protein 1 4 1
MIRT005258 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 3 2
MIRT005259 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 1
MIRT005260 TOR4A chromosome 9 open reading frame 167 2 1
MIRT005261 C9orf89 chromosome 9 open reading frame 89 2 1
MIRT005262 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 3 2
MIRT005263 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 3 2
MIRT005264 PNPLA6 patatin-like phospholipase domain containing 6 3 2
MIRT005265 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 2 1
MIRT005266 ZNF384 zinc finger protein 384 2 1
MIRT005268 C9orf114 chromosome 9 open reading frame 114 2 1
MIRT005269 PTCD3 Pentatricopeptide repeat domain 3 2 1
MIRT005270 MCU coiled-coil domain containing 109A 2 1
MIRT005271 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 3 2
MIRT005360 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 4 1
MIRT005437 LAMTOR3 MAPK scaffold protein 1 2 1
MIRT005438 LAMTOR2 roadblock domain containing 3 2 1
MIRT005554 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005764 TP53 tumor protein p53 1 1
MIRT006528 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 1 1
MIRT006534 ZYX zyxin 3 1
MIRT006651 NCOR2 nuclear receptor corepressor 2 1 1
MIRT006657 Ccnd1 cyclin D1 1 1
MIRT006751 AXIN2 axin 2 2 2
MIRT006794 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 3 1
MIRT006795 FGFR1 fibroblast growth factor receptor 1 3 1
MIRT006804 HMGA2 high mobility group AT-hook 2 3 1
MIRT006870 PIM1 pim-1 oncogene 1 1
MIRT006912 IFNG interferon, gamma 2 1
MIRT007301 UNG uracil-DNA glycosylase 1 1
MIRT031372 SRP68 signal recognition particle 68kDa 1 1
MIRT031373 RECK reversion-inducing-cysteine-rich protein with kazal motifs 2 2
MIRT031374 DSP desmoplakin 1 1
MIRT031375 RPL10 ribosomal protein L10 2 2
MIRT031376 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT031377 SELRC1 chromosome 1 open reading frame 163 1 1
MIRT031378 RPS27 ribosomal protein S27 1 1
MIRT031379 YTHDC1 YTH domain containing 1 1 1
MIRT031380 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT031381 PPAN peter pan homolog (Drosophila) 1 1
MIRT031382 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT031383 TRMT10C RNA (guanine-9-) methyltransferase domain containing 1 1 1
MIRT031384 SMAD1 SMAD family member 1 1 1
MIRT031385 TRIM32 tripartite motif-containing 32 1 1
MIRT031386 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT031387 RPL4 ribosomal protein L4 1 1
MIRT031388 NOC4L nucleolar complex associated 4 homolog (S. cerevisiae) 1 1
MIRT031389 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT031390 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT031391 PON2 paraoxonase 2 1 1
MIRT031392 EMC6 transmembrane protein 93 1 1
MIRT031393 PTRH1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) 1 1
MIRT031394 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT031395 EEF1G eukaryotic translation elongation factor 1 gamma 1 1
MIRT031396 LSM10 LSM10, U7 small nuclear RNA associated 1 1
MIRT031397 YBX3 cold shock domain protein A 1 1
MIRT031398 INTS5 integrator complex subunit 5 1 1
MIRT031399 MRPS31 mitochondrial ribosomal protein S31 1 1
MIRT031400 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT031401 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT031402 RPL12 ribosomal protein L12 1 1
MIRT031403 MRPL1 mitochondrial ribosomal protein L1 1 1
MIRT031404 ACOT8 acyl-CoA thioesterase 8 1 1
MIRT031405 SLC27A4 solute carrier family 27 (fatty acid transporter), member 4 1 1
MIRT031406 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT031407 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT031408 METAP2 methionyl aminopeptidase 2 1 1
MIRT031409 CD44 CD44 molecule (Indian blood group) 1 1
MIRT031410 SARS seryl-tRNA synthetase 1 1
MIRT031411 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 1
MIRT031412 RPL27A ribosomal protein L27a 1 1
MIRT031413 AUP1 ancient ubiquitous protein 1 2 2
MIRT031414 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 2 2
MIRT031415 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT031416 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT031417 DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT031418 HEATR2 HEAT repeat containing 2 2 2
MIRT031419 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT031420 UGT8 UDP glycosyltransferase 8 1 1
MIRT031421 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT031422 TNPO3 transportin 3 2 2
MIRT031423 SMPD4 sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) 1 1
MIRT031424 WDR18 WD repeat domain 18 1 1
MIRT031425 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT031426 GPATCH4 G patch domain containing 4 1 1
MIRT031427 DDX52 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1 1
MIRT031428 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT031429 ELP3 elongation protein 3 homolog (S. cerevisiae) 1 1
MIRT031430 XKR8 XK, Kell blood group complex subunit-related family, member 8 1 1
MIRT031431 GRB2 growth factor receptor-bound protein 2 1 1
MIRT031432 SNRPB2 small nuclear ribonucleoprotein polypeptide B' 1 1
MIRT031433 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT031434 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT031435 FNTA farnesyltransferase, CAAX box, alpha 1 1
MIRT031436 TMEM126A transmembrane protein 126A 1 1
MIRT031437 WBP11 WW domain binding protein 11 1 1
MIRT031438 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT031439 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT031440 RBM6 RNA binding motif protein 6 1 1
MIRT031441 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT031442 DDHD2 DDHD domain containing 2 1 1
MIRT031443 NIN ninein (GSK3B interacting protein) 1 1
MIRT031444 FLCN folliculin 1 1
MIRT031445 ATF7 activating transcription factor 7 1 1
MIRT031446 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT031447 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT031448 BFAR bifunctional apoptosis regulator 1 1
MIRT031449 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT031450 ZNRF3 zinc and ring finger 3 1 1
MIRT031451 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT031452 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) 1 1
MIRT031453 N4BP1 NEDD4 binding protein 1 1 1
MIRT031454 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 1 1
MIRT031455 TIMM10B fracture callus 1 homolog (rat) 2 2
MIRT031456 KIF5B kinesin family member 5B 2 3
MIRT031457 CALR calreticulin 1 1
MIRT031458 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT031459 RHOF ras homolog gene family, member F (in filopodia) 1 1
MIRT031460 TNFRSF12A tumor necrosis factor receptor superfamily, member 12A 1 1
MIRT031461 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT031462 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT031463 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT031464 TACO1 translational activator of mitochondrially encoded cytochrome c oxidase I 1 1
MIRT031465 RPL9 ribosomal protein L9 1 1
MIRT031466 CYCS cytochrome c, somatic 1 1
MIRT031467 TUBB tubulin, beta 2 2
MIRT031468 PDF peptide deformylase (mitochondrial) 1 1
MIRT031469 LUC7L LUC7-like (S. cerevisiae) 1 1
MIRT031470 EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa 1 1
MIRT031471 NAA10 N(alpha)-acetyltransferase 10, NatA catalytic subunit 1 1
MIRT031472 TUBB4B tubulin, beta 2C 1 1
MIRT031473 STX4 syntaxin 4 1 1
MIRT031474 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT031475 EIF3E eukaryotic translation initiation factor 3, subunit E 1 1
MIRT031476 INF2 inverted formin, FH2 and WH2 domain containing 1 1
MIRT031477 LMF2 lipase maturation factor 2 1 1
MIRT031478 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT031479 BAG6 HLA-B associated transcript 3 1 1
MIRT031480 VMP1 transmembrane protein 49 1 1
MIRT031481 SYF2 SYF2 homolog, RNA splicing factor (S. cerevisiae) 1 1
MIRT031482 NARS2 asparaginyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT031483 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT031484 ENY2 enhancer of yellow 2 homolog (Drosophila) 1 1
MIRT031485 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT031486 STEAP3 STEAP family member 3 1 1
MIRT031487 WDR43 WD repeat domain 43 1 1
MIRT031488 TRMT1 TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) 1 1
MIRT031489 SNX12 sorting nexin 12 1 1
MIRT031490 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT031491 SNX6 sorting nexin 6 1 1
MIRT031492 PHIP pleckstrin homology domain interacting protein 1 1
MIRT031493 LAMTOR1 chromosome 11 open reading frame 59 1 1
MIRT031494 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT031495 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT031496 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 1 1
MIRT031497 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT031498 DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 1 1
MIRT031499 USP9X ubiquitin specific peptidase 9, X-linked 1 1
MIRT031500 C8orf44 chromosome 8 open reading frame 44 1 1
MIRT031501 TMEM168 transmembrane protein 168 1 1
MIRT031502 LPHN1 latrophilin 1 1 1
MIRT031503 NCKAP5L NCK-associated protein 5-like 1 1
MIRT031504 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT031505 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT031506 TRIM44 tripartite motif-containing 44 1 1
MIRT031507 TEX15 testis expressed 15 1 1
MIRT031508 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 2
MIRT031509 RIMS3 regulating synaptic membrane exocytosis 3 1 1
MIRT031510 CEP55 centrosomal protein 55kDa 1 1
MIRT031511 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT031512 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT031513 CAAP1 chromosome 9 open reading frame 82 1 1
MIRT031514 LATS1 LATS, large tumor suppressor, homolog 1 (Drosophila) 1 1
MIRT031515 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 2
MIRT031516 SLC39A10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT031517 ATP13A3 ATPase type 13A3 1 1
MIRT031518 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT031519 TMEM100 transmembrane protein 100 1 1
MIRT031520 SIPA1L2 signal-induced proliferation-associated 1 like 2 1 1
MIRT031521 SMAD7 SMAD family member 7 1 1
MIRT031522 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT031523 SALL1 sal-like 1 (Drosophila) 1 1
MIRT031524 PRDM4 PR domain containing 4 1 1
MIRT031525 FTL ferritin, light polypeptide 1 1
MIRT031526 BCAS2 breast carcinoma amplified sequence 2 1 1
MIRT031527 YBX1 Y box binding protein 1 1 1
MIRT031528 NDUFA9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa 1 1
MIRT031529 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT031530 CCPG1 cell cycle progression 1 1 1
MIRT031531 MICU2 EF-hand domain family, member A1 1 1
MIRT031532 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT031533 WDR3 WD repeat domain 3 1 1
MIRT031534 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT031535 DIABLO diablo homolog (Drosophila) 1 1
MIRT031536 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT031537 UTP23 UTP23, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT031538 PYGB phosphorylase, glycogen; brain 1 1
MIRT031539 NOC3L nucleolar complex associated 3 homolog (S. cerevisiae) 1 1
MIRT031540 DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 1 1
MIRT031541 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT031542 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT031543 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT031544 RPL10L ribosomal protein L10-like 1 1
MIRT031545 EIF3CL eukaryotic translation initiation factor 3, subunit C-like 1 1
MIRT031546 FASTKD2 FAST kinase domains 2 1 1
MIRT031547 C2orf47 chromosome 2 open reading frame 47 1 1
MIRT031548 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT031549 PLRG1 pleiotropic regulator 1 (PRL1 homolog, Arabidopsis) 1 1
MIRT031550 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 1
MIRT031551 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT031552 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT031553 KIAA0368 KIAA0368 1 1
MIRT031554 AGK acylglycerol kinase 1 1
MIRT031555 FDXR ferredoxin reductase 1 1
MIRT031556 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT031557 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT031558 MALSU1 chromosome 7 open reading frame 30 1 1
MIRT031559 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT031560 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT031561 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT031562 SRP72 signal recognition particle 72kDa 1 1
MIRT031563 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT031564 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT031565 DLD dihydrolipoamide dehydrogenase 1 1
MIRT031566 KDSR 3-ketodihydrosphingosine reductase 1 1
MIRT031567 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT031568 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT031569 USP42 ubiquitin specific peptidase 42 1 1
MIRT031570 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT031571 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT031572 KCNG3 potassium voltage-gated channel, subfamily G, member 3 1 1
MIRT031573 HIST2H2BE histone cluster 2, H2be 1 1
MIRT031574 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT031575 ONECUT2 one cut homeobox 2 1 1
MIRT031576 OIP5 Opa interacting protein 5 1 1
MIRT031577 SP1 Sp1 transcription factor 1 1
MIRT031578 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT031579 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) 1 1
MIRT031580 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT031581 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT031582 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT031583 TMEM55B transmembrane protein 55B 1 1
MIRT031584 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT031585 PLSCR4 phospholipid scramblase 4 1 1
MIRT031586 SEH1L SEH1-like (S. cerevisiae) 1 1
MIRT031587 UBN2 ubinuclein 2 1 1
MIRT031588 DESI1 PPPDE peptidase domain containing 2 1 1
MIRT031589 CDK17 cyclin-dependent kinase 17 1 1
MIRT031590 TLK1 tousled-like kinase 1 1 2
MIRT031591 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT031592 TBRG4 transforming growth factor beta regulator 4 1 1
MIRT031593 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT031594 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT031595 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT031596 RBM15B RNA binding motif protein 15B 1 1
MIRT031597 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT031598 NAMPT nicotinamide phosphoribosyltransferase 1 1
MIRT031599 CD97 CD97 molecule 1 1
MIRT031600 COMMD10 COMM domain containing 10 1 1
MIRT031601 NRP1 neuropilin 1 1 1
MIRT031602 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT031603 EPHA2 EPH receptor A2 1 1
MIRT031604 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT031605 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT031606 PLAUR plasminogen activator, urokinase receptor 1 1
MIRT031607 C1orf56 chromosome 1 open reading frame 56 1 1
MIRT031608 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT031609 SLC25A6 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 1 1
MIRT031610 AIMP1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 1 1
MIRT031611 CLNS1A chloride channel, nucleotide-sensitive, 1A 1 1
MIRT031612 RNMTL1 RNA methyltransferase like 1 1 1
MIRT031613 MRPL3 mitochondrial ribosomal protein L3 1 1
MIRT031614 HSPBP1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 1 1
MIRT031615 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT031616 PSMD12 proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 1 1
MIRT031617 PLCXD2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1 1
MIRT031618 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 2 2
MIRT031619 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT031620 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT031621 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT031622 LY6K lymphocyte antigen 6 complex, locus K 1 1
MIRT031623 NOL11 nucleolar protein 11 1 1
MIRT031624 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT031625 CCDC58 coiled-coil domain containing 58 1 1
MIRT031626 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT031627 MEPCE methylphosphate capping enzyme 1 1
MIRT031628 DCUN1D5 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) 1 1
MIRT031629 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT031630 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT031631 RPL5 ribosomal protein L5 1 1
MIRT031632 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT031633 AHCYL1 adenosylhomocysteinase-like 1 1 1
MIRT031634 CLASP1 cytoplasmic linker associated protein 1 1 1
MIRT031635 EIF5B eukaryotic translation initiation factor 5B 1 1
MIRT031636 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT031637 SMAD5 SMAD family member 5 1 1
MIRT031638 NARF nuclear prelamin A recognition factor 1 1
MIRT031639 MAP7 microtubule-associated protein 7 1 1
MIRT031640 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT031641 NUP50 nucleoporin 50kDa 2 2
MIRT031642 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT031643 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT031644 FBXL18 F-box and leucine-rich repeat protein 18 1 1
MIRT031645 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 1 1
MIRT031646 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT031647 AADAT aminoadipate aminotransferase 1 1
MIRT031648 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT031649 SAV1 salvador homolog 1 (Drosophila) 1 1
MIRT031650 CARD10 caspase recruitment domain family, member 10 1 1
MIRT031651 KCNC4 potassium voltage-gated channel, Shaw-related subfamily, member 4 1 2
MIRT031652 SNX16 sorting nexin 16 1 1
MIRT031653 GABARAPL1 GABA(A) receptor-associated protein like 1 1 1
MIRT031654 FAM122A family with sequence similarity 122A 1 1
MIRT031655 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT031656 SIRT4 sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) 1 1
MIRT031657 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT031658 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT031659 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT031660 SLC35B2 solute carrier family 35, member B2 2 2
MIRT031661 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 2 2
MIRT031662 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT031663 TUBA1C tubulin, alpha 1c 1 1
MIRT031664 TUBB3 tubulin, beta 3 1 1
MIRT031665 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT031666 HYAL3 hyaluronoglucosaminidase 3 1 1
MIRT031667 DNAJC1 DnaJ (Hsp40) homolog, subfamily C, member 1 1 1
MIRT031668 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 1
MIRT031669 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT031670 TNFRSF10A tumor necrosis factor receptor superfamily, member 10a 1 1
MIRT031671 RPS2 ribosomal protein S2 1 1
MIRT031672 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT031673 RMDN1 family with sequence similarity 82, member B 1 1
MIRT031674 SPATA5 spermatogenesis associated 5 1 1
MIRT031675 EARS2 glutamyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT031676 CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) 1 1
MIRT031677 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT031678 STRAP serine/threonine kinase receptor associated protein 1 1
MIRT031679 COMT catechol-O-methyltransferase 2 2
MIRT031680 SLIRP chromosome 14 open reading frame 156 1 1
MIRT031681 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT031682 PRPSAP1 phosphoribosyl pyrophosphate synthetase-associated protein 1 2 2
MIRT031683 DNAJC15 DnaJ (Hsp40) homolog, subfamily C, member 15 1 1
MIRT031684 ANKLE2 ankyrin repeat and LEM domain containing 2 1 1
MIRT031685 PRNP prion protein 1 1
MIRT031686 SLC38A2 solute carrier family 38, member 2 1 1
MIRT031687 ZNF598 zinc finger protein 598 1 1
MIRT031688 GTPBP8 GTP-binding protein 8 (putative) 1 1
MIRT031689 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT031690 VIM vimentin 1 1
MIRT031691 DMAP1 DNA methyltransferase 1 associated protein 1 1 1
MIRT031692 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT031693 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 1 1
MIRT031694 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT031695 COPS5 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) 1 1
MIRT031696 CDK9 cyclin-dependent kinase 9 1 1
MIRT031697 ASB6 ankyrin repeat and SOCS box-containing 6 1 1
MIRT031698 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT031699 RBMS3 RNA binding motif, single stranded interacting protein 3 1 1
MIRT031700 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT031701 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT031702 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT031703 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT031704 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT031705 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT031706 TMEM87A transmembrane protein 87A 1 1
MIRT031707 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT031708 RPLP0 ribosomal protein, large, P0 2 2
MIRT031709 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT031710 EIF4B eukaryotic translation initiation factor 4B 2 2
MIRT031711 SRPK1 SFRS protein kinase 1 1 1
MIRT031712 DOCK5 dedicator of cytokinesis 5 1 1
MIRT031713 SPRYD3 SPRY domain containing 3 1 1
MIRT031714 ATL2 atlastin GTPase 2 1 1
MIRT031715 CDV3 CDV3 homolog (mouse) 1 1
MIRT031716 CXorf38 chromosome X open reading frame 38 1 1
MIRT031717 FAM89A family with sequence similarity 89, member A 1 1
MIRT031718 SLC25A39 solute carrier family 25, member 39 1 1
MIRT031719 GLRX glutaredoxin (thioltransferase) 1 1
MIRT031720 DLC1 deleted in liver cancer 1 1 1
MIRT031721 HOXA3 homeobox A3 1 1
MIRT031722 CCNE2 cyclin E2 1 1
MIRT031723 ARL3 ADP-ribosylation factor-like 3 1 1
MIRT031724 MYO5A myosin VA (heavy chain 12, myoxin) 1 1
MIRT031725 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT031726 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 1
MIRT031727 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT031728 HELZ helicase with zinc finger 1 1
MIRT031729 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT031730 RAB1B RAB1B, member RAS oncogene family 2 2
MIRT031731 PNP purine nucleoside phosphorylase 2 2
MIRT031732 KPNA1 karyopherin alpha 1 (importin alpha 5) 2 3
MIRT031733 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 2 2
MIRT031734 SON SON DNA binding protein 2 2
MIRT031735 HSD17B8 hydroxysteroid (17-beta) dehydrogenase 8 1 1
MIRT031736 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT031737 DCAF13 DDB1 and CUL4 associated factor 13 1 1
MIRT031738 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT031739 DAP3 death associated protein 3 2 2
MIRT031740 NTHL1 nth endonuclease III-like 1 (E. coli) 1 1
MIRT031741 PEX14 peroxisomal biogenesis factor 14 1 1
MIRT031742 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT031743 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT031744 IDH3A isocitrate dehydrogenase 3 (NAD+) alpha 1 1
MIRT031745 THEM4 thioesterase superfamily member 4 1 1
MIRT031746 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT031747 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT031748 EDC4 enhancer of mRNA decapping 4 1 1
MIRT031749 CIB1 calcium and integrin binding 1 (calmyrin) 1 1
MIRT031750 NDUFAF4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4 1 1
MIRT031751 OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT031752 EIF2A eukaryotic translation initiation factor 2A, 65kDa 1 1
MIRT031753 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT031754 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT031755 TAF9 TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa 1 1
MIRT031756 RPS12 ribosomal protein S12 2 2
MIRT031757 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 1 1
MIRT031758 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT031759 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT031760 CNOT7 CCR4-NOT transcription complex, subunit 7 1 1
MIRT031761 DMD dystrophin 1 1
MIRT031762 RCL1 RNA terminal phosphate cyclase-like 1 2 2
MIRT031763 SDHAF2 succinate dehydrogenase complex assembly factor 2 1 1
MIRT031764 YARS2 tyrosyl-tRNA synthetase 2, mitochondrial 1 1
MIRT031765 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT031766 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT031767 VAMP8 vesicle-associated membrane protein 8 (endobrevin) 1 1
MIRT031768 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 1
MIRT031769 DKC1 dyskeratosis congenita 1, dyskerin 1 1
MIRT031770 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT031771 LRPPRC leucine-rich PPR-motif containing 1 1
MIRT031772 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 1 1
MIRT031773 CHP1 calcium binding protein P22 1 1
MIRT031774 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT031775 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT031776 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT031777 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT031778 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT031779 SFXN1 sideroflexin 1 1 1
MIRT031780 YIPF4 Yip1 domain family, member 4 1 1
MIRT031781 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT031782 RBMS1 RNA binding motif, single stranded interacting protein 1 1 1
MIRT031783 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT031784 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT031785 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT031786 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT031787 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT031788 FAM122B family with sequence similarity 122B 1 1
MIRT031789 ZNF207 zinc finger protein 207 1 1
MIRT031790 RNF149 ring finger protein 149 1 1
MIRT031791 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT031792 BTG2 BTG family, member 2 1 1
MIRT031793 ATG14 KIAA0831 1 1
MIRT031794 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT031795 KIAA1432 KIAA1432 1 1
MIRT031796 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT031797 XPO7 exportin 7 2 3
MIRT031798 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT031799 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT031800 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT031801 COA6 chromosome 1 open reading frame 31 1 1
MIRT031802 ASPH aspartate beta-hydroxylase 1 1
MIRT031803 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT031804 DTD1 D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) 1 1
MIRT031805 RRP36 chromosome 6 open reading frame 153 1 1
MIRT031806 NARS asparaginyl-tRNA synthetase 1 1
MIRT031807 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT031808 HSPH1 heat shock 105kDa/110kDa protein 1 1 1
MIRT031809 KIF23 kinesin family member 23 1 1
MIRT031810 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT031811 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT031812 TRAP1 TNF receptor-associated protein 1 2 2
MIRT031813 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT031814 VASN vasorin 1 1
MIRT031815 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT031816 DDX31 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 1 1
MIRT031817 EIF3K eukaryotic translation initiation factor 3, subunit K 1 1
MIRT031818 RPLP1 ribosomal protein, large, P1 1 1
MIRT031819 QSOX2 quiescin Q6 sulfhydryl oxidase 2 1 1
MIRT031820 MRFAP1 Mof4 family associated protein 1 1 1
MIRT031821 CUL4A cullin 4A 1 1
MIRT031822 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT031823 ELAC2 elaC homolog 2 (E. coli) 1 1
MIRT031824 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT031825 ALDH18A1 aldehyde dehydrogenase 18 family, member A1 1 1
MIRT031826 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT031827 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT031828 HEATR1 HEAT repeat containing 1 1 1
MIRT031829 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT031830 RPL13 ribosomal protein L13 1 1
MIRT031831 RAB1A RAB1A, member RAS oncogene family 1 1
MIRT031832 CKAP5 cytoskeleton associated protein 5 1 1
MIRT031833 SLC7A5 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 1 1
MIRT031834 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT031835 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT031836 CHPT1 choline phosphotransferase 1 1 1
MIRT031837 AFG3L2 AFG3 ATPase family gene 3-like 2 (yeast) 1 1
MIRT031838 APP amyloid beta (A4) precursor protein 1 1
MIRT031839 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT031840 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 1
MIRT031841 SPTBN2 spectrin, beta, non-erythrocytic 2 1 1
MIRT031842 STXBP3 syntaxin binding protein 3 1 1
MIRT031843 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT031844 IPO7 importin 7 1 1
MIRT031845 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT031846 RAB23 RAB23, member RAS oncogene family 1 1
MIRT031847 SF3A3 splicing factor 3a, subunit 3, 60kDa 1 1
MIRT031848 FEM1C fem-1 homolog c (C. elegans) 1 1
MIRT031849 PDE4D phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) 1 1
MIRT031850 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT031851 CAMKK2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT031852 ATAD5 ATPase family, AAA domain containing 5 1 1
MIRT031853 GCC1 GRIP and coiled-coil domain containing 1 1 1
MIRT031854 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT031855 CNNM2 cyclin M2 1 1
MIRT031856 EPC1 enhancer of polycomb homolog 1 (Drosophila) 1 1
MIRT031857 ZFHX3 zinc finger homeobox 3 1 1
MIRT031858 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT031859 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT031860 USP15 ubiquitin specific peptidase 15 1 1
MIRT031861 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT031862 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT031863 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT031864 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 2 2
MIRT031865 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 2 2
MIRT031866 SLC35A4 solute carrier family 35, member A4 2 2
MIRT031867 ANPEP alanyl (membrane) aminopeptidase 1 1
MIRT031868 ALG2 asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT031869 PELO pelota homolog (Drosophila) 1 1
MIRT031870 NOP10 NOP10 ribonucleoprotein homolog (yeast) 1 1
MIRT031871 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT031872 UTP3 UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae) 1 1
MIRT031873 CDCA8 cell division cycle associated 8 1 1
MIRT031874 RPL30 ribosomal protein L30 1 1
MIRT031875 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT031876 ITGB4 integrin, beta 4 1 1
MIRT031877 UXT ubiquitously-expressed transcript 1 1
MIRT031878 TPBG trophoblast glycoprotein 1 1
MIRT031879 ATP6V1E1 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 1 1
MIRT031880 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT031881 CNPY3 canopy 3 homolog (zebrafish) 1 1
MIRT031882 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 2 2
MIRT031883 CXorf40B chromosome X open reading frame 40B 1 1
MIRT031884 DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 1
MIRT031885 BYSL bystin-like 1 1
MIRT031886 RAB12 RAB12, member RAS oncogene family 1 1
MIRT031887 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT031888 KIF2A kinesin heavy chain member 2A 1 1
MIRT031889 AGRN agrin 1 1
MIRT031890 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT031891 TMEM41A transmembrane protein 41A 1 1
MIRT031892 PSMC2 proteasome (prosome, macropain) 26S subunit, ATPase, 2 1 1
MIRT031893 TTC17 tetratricopeptide repeat domain 17 1 1
MIRT031894 EML4 echinoderm microtubule associated protein like 4 1 1
MIRT031895 UTP20 UTP20, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT031896 CLUH KIAA0664 1 1
MIRT031897 XPOT exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT031898 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 2 2
MIRT031899 NEMF serologically defined colon cancer antigen 1 1 1
MIRT031900 HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 1 1
MIRT031901 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT031902 MRRF mitochondrial ribosome recycling factor 1 1
MIRT031903 ERLIN2 ER lipid raft associated 2 1 1
MIRT031904 NUP160 nucleoporin 160kDa 1 1
MIRT031905 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT031906 MFN2 mitofusin 2 1 1
MIRT031907 LMO7 LIM domain 7 1 1
MIRT031908 SYPL1 synaptophysin-like 1 1 1
MIRT031909 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT031910 ANKRD17 ankyrin repeat domain 17 1 1
MIRT031911 RNF111 ring finger protein 111 1 1
MIRT031912 EXD2 exonuclease 3'-5' domain containing 2 1 1
MIRT031913 NHLRC3 NHL repeat containing 3 1 1
MIRT031914 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT031915 OSBPL3 oxysterol binding protein-like 3 1 2
MIRT031916 GPR180 G protein-coupled receptor 180 1 1
MIRT031917 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT031918 PAPOLG poly(A) polymerase gamma 1 1
MIRT031919 STK38 serine/threonine kinase 38 1 1
MIRT031920 CD274 CD274 molecule 1 1
MIRT031921 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT031922 GTPBP1 GTP binding protein 1 1 1
MIRT031923 MED13 mediator complex subunit 13 1 2
MIRT031924 SETD1B SET domain containing 1B 1 1
MIRT031925 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT031926 SYNJ1 synaptojanin 1 1 1
MIRT031927 RNF217 ring finger protein 217 1 1
MIRT031928 RNF144B ring finger protein 144B 1 1
MIRT031929 RFK riboflavin kinase 1 1
MIRT031930 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT031931 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 1
MIRT031932 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT031933 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT031934 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT031935 CDCA4 cell division cycle associated 4 1 1
MIRT031936 MAP4 microtubule-associated protein 4 2 2
MIRT031937 GOLT1B golgi transport 1 homolog B (S. cerevisiae) 2 2
MIRT031938 PPP6C protein phosphatase 6, catalytic subunit 2 2
MIRT031939 LAMB3 laminin, beta 3 1 1
MIRT031940 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT031941 POLDIP2 polymerase (DNA-directed), delta interacting protein 2 1 1
MIRT031942 RPS25 ribosomal protein S25 1 1
MIRT031943 WARS tryptophanyl-tRNA synthetase 1 1
MIRT031944 GLT8D1 glycosyltransferase 8 domain containing 1 1 1
MIRT031945 RPL3 ribosomal protein L3 1 1
MIRT031946 EIF3H eukaryotic translation initiation factor 3, subunit H 1 1
MIRT031947 LYAR Ly1 antibody reactive homolog (mouse) 1 1
MIRT031948 DUSP14 dual specificity phosphatase 14 1 1
MIRT031949 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT031950 OXNAD1 oxidoreductase NAD-binding domain containing 1 1 1
MIRT031951 FTH1 ferritin, heavy polypeptide 1 1 1
MIRT031952 RBM28 RNA binding motif protein 28 1 1
MIRT031953 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 1 1
MIRT031954 RPL21 ribosomal protein L21 1 1
MIRT031955 RRP9 ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT031956 MINA MYC induced nuclear antigen 1 1
MIRT031957 ACTG1 actin, gamma 1 2 2
MIRT031958 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 1 1
MIRT031959 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT031960 LSG1 large subunit GTPase 1 homolog (S. cerevisiae) 1 1
MIRT031961 SLC25A32 solute carrier family 25, member 32 1 1
MIRT031962 AAAS achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) 1 1
MIRT031963 MRPS23 mitochondrial ribosomal protein S23 1 1
MIRT031964 MARS methionyl-tRNA synthetase 1 1
MIRT031965 MERTK c-mer proto-oncogene tyrosine kinase 1 1
MIRT031966 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT031967 SRP19 signal recognition particle 19kDa 1 1
MIRT031968 C11orf83 chromosome 11 open reading frame 83 1 1
MIRT031969 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT031970 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT031971 IWS1 IWS1 homolog (S. cerevisiae) 1 1
MIRT031972 TTLL12 tubulin tyrosine ligase-like family, member 12 2 2
MIRT031973 PVR poliovirus receptor 1 1
MIRT031974 KIF2C kinesin family member 2C 1 1
MIRT031975 TBL3 transducin (beta)-like 3 1 1
MIRT031976 CAMK2G calcium/calmodulin-dependent protein kinase II gamma 1 1
MIRT031977 ATXN2L ataxin 2-like 2 2
MIRT031978 RPSA ribosomal protein SA 1 1
MIRT031979 TSPAN3 tetraspanin 3 2 2
MIRT031980 SCAF4 splicing factor, arginine/serine-rich 15 2 2
MIRT031981 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT031982 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT031983 C17orf75 chromosome 17 open reading frame 75 1 1
MIRT031984 WDR75 WD repeat domain 75 1 1
MIRT031985 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT031986 BTF3 basic transcription factor 3 1 1
MIRT031987 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT031988 KIF1B kinesin family member 1B 1 1
MIRT031989 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT031990 RPL14 ribosomal protein L14 1 1
MIRT031991 CDC37 cell division cycle 37 homolog (S. cerevisiae) 1 1
MIRT031992 SOWAHC ankyrin repeat domain 57 1 1
MIRT031993 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT031994 SPATA2 spermatogenesis associated 2 1 1
MIRT031995 PRR3 proline rich 3 1 1
MIRT031996 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT031997 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT031998 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT031999 FAT3 FAT tumor suppressor homolog 3 (Drosophila) 1 1
MIRT032000 SZRD1 chromosome 1 open reading frame 144 1 1
MIRT032001 EN2 engrailed homeobox 2 1 1
MIRT032002 MYO5B myosin VB 1 1
MIRT032003 PDK4 pyruvate dehydrogenase kinase, isozyme 4 1 1
MIRT032004 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT032005 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT032006 FBXW7 F-box and WD repeat domain containing 7 1 1
MIRT032007 STK33 serine/threonine kinase 33 1 1
MIRT032008 DIEXF chromosome 1 open reading frame 107 2 2
MIRT032009 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT032010 AK2 adenylate kinase 2 1 1
MIRT032011 PAK1IP1 PAK1 interacting protein 1 1 1
MIRT032012 PSPH phosphoserine phosphatase 1 1
MIRT032013 RPL31 ribosomal protein L31 1 1
MIRT032014 FAM96B family with sequence similarity 96, member B 1 1
MIRT032015 ARG2 arginase, type II 1 1
MIRT032016 STIP1 stress-induced-phosphoprotein 1 1 1
MIRT032017 ARPC5L actin related protein 2/3 complex, subunit 5-like 1 1
MIRT032018 EIF3F eukaryotic translation initiation factor 3, subunit F 1 1
MIRT032019 IPO11 importin 11 1 1
MIRT032020 RPS3A ribosomal protein S3A 1 1
MIRT032021 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT032022 SLC4A1AP solute carrier family 4 (anion exchanger), member 1, adaptor protein 1 1
MIRT032023 MRPL21 mitochondrial ribosomal protein L21 1 1
MIRT032024 LAMTOR4 chromosome 7 open reading frame 59 1 1
MIRT032025 RPL6 ribosomal protein L6 1 1
MIRT032026 KIN KIN, antigenic determinant of recA protein homolog (mouse) 1 1
MIRT032027 POLR1C polymerase (RNA) I polypeptide C, 30kDa 1 1
MIRT032028 HTRA1 HtrA serine peptidase 1 1 1
MIRT032029 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT032030 GEMIN4 gem (nuclear organelle) associated protein 4 1 1
MIRT032031 GARS glycyl-tRNA synthetase 1 1
MIRT032032 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT032033 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT032034 ZRANB2 zinc finger, RAN-binding domain containing 2 1 1
MIRT032035 PDLIM5 PDZ and LIM domain 5 1 1
MIRT032036 L1CAM L1 cell adhesion molecule 1 1
MIRT032037 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT032038 KIF14 kinesin family member 14 1 1
MIRT032039 MORF4L1 mortality factor 4 like 1 1 1
MIRT032040 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT032041 SCAMP3 secretory carrier membrane protein 3 1 1
MIRT032042 FAM129B family with sequence similarity 129, member B 1 1
MIRT032043 PLEC plectin 1 1
MIRT032044 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT032045 ATP8A2 ATPase, aminophospholipid transporter, class I, type 8A, member 2 1 1
MIRT032046 IARS isoleucyl-tRNA synthetase 1 1
MIRT032047 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 1
MIRT032048 EFNB2 ephrin-B2 1 1
MIRT032049 FAM189B family with sequence similarity 189, member B 2 2
MIRT032050 LAMB1 laminin, beta 1 1 1
MIRT032051 TNPO1 transportin 1 1 1
MIRT032052 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 1 1
MIRT032053 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT032054 LMAN2L lectin, mannose-binding 2-like 1 1
MIRT032055 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT032056 PAGR1 chromosome 16 open reading frame 53 1 1
MIRT032057 TOX4 TOX high mobility group box family member 4 1 1
MIRT032058 CALU calumenin 1 1
MIRT032059 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT032060 USP53 ubiquitin specific peptidase 53 1 1
MIRT032061 FAM168A family with sequence similarity 168, member A 1 1
MIRT032062 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT032063 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT032064 UBFD1 ubiquitin family domain containing 1 1 1
MIRT032065 PAQR3 progestin and adipoQ receptor family member III 1 1
MIRT032066 C16orf72 chromosome 16 open reading frame 72 1 1
MIRT032067 TMEM255A family with sequence similarity 70, member A 1 1
MIRT032068 PHF19 PHD finger protein 19 1 1
MIRT032069 ATXN7L3 ataxin 7-like 3 1 1
MIRT032070 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT032071 E2F7 E2F transcription factor 7 1 1
MIRT032072 KIF5A kinesin family member 5A 1 1
MIRT032073 PTPN3 protein tyrosine phosphatase, non-receptor type 3 1 1
MIRT032074 CCDC19 coiled-coil domain containing 19 1 1
MIRT032075 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 2 2
MIRT032076 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 2 2
MIRT051056 FASTKD1 FAST kinase domains 1 1 1
MIRT051057 UFSP2 UFM1-specific peptidase 2 1 1
MIRT051058 PLEKHN1 pleckstrin homology domain containing, family N member 1 1 1
MIRT051059 KLF14 Kruppel-like factor 14 1 1
MIRT051060 AKAP13 A kinase (PRKA) anchor protein 13 1 1
MIRT051061 PHEX phosphate regulating endopeptidase homolog, X-linked 1 1
MIRT051062 IL36RN interleukin 1 family, member 5 (delta) 1 1
MIRT051063 CACNB2 calcium channel, voltage-dependent, beta 2 subunit 1 1
MIRT051064 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT051065 NAV2 neuron navigator 2 1 1
MIRT051066 OTUD7B OTU domain containing 7B 1 1
MIRT051067 JAK2 Janus kinase 2 1 1
MIRT051068 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051069 TXNL1 thioredoxin-like 1 1 1
MIRT051070 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT051071 FBXO3 F-box protein 3 1 1
MIRT051072 CPNE8 copine VIII 1 1
MIRT051073 COL4A1 collagen, type IV, alpha 1 1 1
MIRT051074 SENP6 SUMO1/sentrin specific peptidase 6 1 1
MIRT051075 PRR12 proline rich 12 1 1
MIRT051076 SERINC5 serine incorporator 5 1 1
MIRT051077 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT051078 FNBP1 formin binding protein 1 1 1
MIRT051079 FAM150B family with sequence similarity 150, member B 1 1
MIRT051080 CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 1 1
MIRT051081 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT051082 LIG4 ligase IV, DNA, ATP-dependent 1 1
MIRT051083 RPS24 ribosomal protein S24 1 1
MIRT051084 S100A14 S100 calcium binding protein A14 1 1
MIRT051085 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT051086 TNK1 tyrosine kinase, non-receptor, 1 1 1
MIRT051087 FBXW11 F-box and WD repeat domain containing 11 1 1
MIRT051088 MLF2 myeloid leukemia factor 2 1 1
MIRT051089 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT051090 ZNF638 zinc finger protein 638 1 1
MIRT051091 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051092 DIXDC1 DIX domain containing 1 1 1
MIRT051093 EEF2K eukaryotic elongation factor-2 kinase 1 1
MIRT051094 TMEM154 transmembrane protein 154 1 1
MIRT051095 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT051096 SLFN13 schlafen family member 13 1 1
MIRT051097 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT051098 COX1 cytochrome c oxidase subunit I 1 1
MIRT051099 IDS iduronate 2-sulfatase 1 1
MIRT051100 C19orf54 chromosome 19 open reading frame 54 1 1
MIRT051101 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT051102 OTOL1 otolin-1 1 1
MIRT051103 AGER advanced glycosylation end product-specific receptor 1 1
MIRT051104 PGLYRP1 peptidoglycan recognition protein 1 1 1
MIRT051105 ACTN4 actinin, alpha 4 1 1
MIRT051106 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT051107 FSCN2 fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) 1 1
MIRT051108 NXPH2 neurexophilin 2 1 1
MIRT051109 CABIN1 calcineurin binding protein 1 1 1
MIRT051110 MOB3C MOB1, Mps One Binder kinase activator-like 2C (yeast) 1 1
MIRT051111 ADK adenosine kinase 1 1
MIRT051112 ARL2BP ADP-ribosylation factor-like 2 binding protein 1 1
MIRT051113 RP1L1 retinitis pigmentosa 1-like 1 1 1
MIRT051114 GPR157 G protein-coupled receptor 157 1 1
MIRT051115 IRS4 insulin receptor substrate 4 1 1
MIRT051116 KLHL34 kelch-like 34 (Drosophila) 1 1
MIRT051117 HSPA8 heat shock 70kDa protein 8 1 1
MIRT051118 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT051119 FAT2 FAT tumor suppressor homolog 2 (Drosophila) 1 1
MIRT051120 RPS3 ribosomal protein S3 1 1
MIRT051121 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT051122 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT051123 SYT11 synaptotagmin XI 1 1
MIRT051124 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT051125 GPR55 G protein-coupled receptor 55 1 1
MIRT051126 MRC2 mannose receptor, C type 2 1 1
MIRT051127 LSM5 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT051128 DDN dendrin 1 1
MIRT051129 COL4A2 collagen, type IV, alpha 2 1 1
MIRT051130 UBXN2B UBX domain protein 2B 1 1
MIRT051131 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 1
MIRT051132 ZNF644 zinc finger protein 644 1 1
MIRT051133 ROGDI rogdi homolog (Drosophila) 1 1
MIRT051134 MMP25 matrix metallopeptidase 25 1 1
MIRT051135 RIOK3 RIO kinase 3 (yeast) 1 1
MIRT051136 GSTT2B glutathione S-transferase theta 2B (gene/pseudogene) 1 1
MIRT051137 APLNR apelin receptor 1 1
MIRT051138 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT051139 CCT8 chaperonin containing TCP1, subunit 8 (theta) 1 1
MIRT051140 USMG5 up-regulated during skeletal muscle growth 5 homolog (mouse) 1 1
MIRT051141 LYPD2 LY6/PLAUR domain containing 2 1 1
MIRT051142 YIPF2 Yip1 domain family, member 2 1 1
MIRT051143 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT051144 HIST1H1C histone cluster 1, H1c 1 1
MIRT051145 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT051146 RPH3AL rabphilin 3A-like (without C2 domains) 1 1
MIRT051147 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT051148 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT051149 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT051150 POLB polymerase (DNA directed), beta 1 1
MIRT051151 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT051152 ADAD2 adenosine deaminase domain containing 2 1 1
MIRT051153 CLIP2 CAP-GLY domain containing linker protein 2 1 1
MIRT051154 IPO5 importin 5 1 1
MIRT051155 POTEF POTE ankyrin domain family, member F 1 1
MIRT051156 LIMA1 LIM domain and actin binding 1 1 1
MIRT051157 ACTN1 actinin, alpha 1 1 1
MIRT051158 FAM208A chromosome 3 open reading frame 63 1 1
MIRT051159 IRAK3 interleukin-1 receptor-associated kinase 3 1 1
MIRT051160 NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 1 1
MIRT051161 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT051162 BNC2 basonuclin 2 1 1
MIRT051163 WDR5B WD repeat domain 5B 1 1
MIRT051164 INO80D INO80 complex subunit D 1 1
MIRT051165 USP8 ubiquitin specific peptidase 8 1 1
MIRT051166 RPS17 ribosomal protein S17 1 1
MIRT051167 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT051168 AMOT angiomotin 1 1
MIRT051169 AMER1 family with sequence similarity 123B 1 1
MIRT051170 NEURL4 neuralized homolog 4 (Drosophila) 1 1
MIRT051171 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT051172 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT051173 RAN RAN, member RAS oncogene family 1 1
MIRT051174 MARCH6 membrane-associated ring finger (C3HC4) 6 1 1
MIRT051175 FBXO41 F-box protein 41 1 1
MIRT051176 XYLT1 xylosyltransferase I 1 1
MIRT051177 DOCK9 dedicator of cytokinesis 9 1 1
MIRT051178 LONP1 lon peptidase 1, mitochondrial 1 1
MIRT051179 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT051180 GPAA1 glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) 1 1
MIRT051181 VCL vinculin 1 1
MIRT051182 TIGD3 tigger transposable element derived 3 1 1
MIRT051183 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT051184 KANSL3 KIAA1310 1 1
MIRT051185 ZNF280C zinc finger protein 280C 1 1
MIRT051186 RUNDC3B RUN domain containing 3B 1 1
MIRT051187 E2F3 E2F transcription factor 3 1 1
MIRT051188 CECR5 cat eye syndrome chromosome region, candidate 5 1 1
MIRT051189 TDRD3 tudor domain containing 3 1 1
MIRT051190 IKZF4 IKAROS family zinc finger 4 (Eos) 1 1
MIRT051191 TES testis derived transcript (3 LIM domains) 1 1
MIRT051192 KCNS2 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 1 1
MIRT051193 SLC9A2 solute carrier family 9 (sodium/hydrogen exchanger), member 2 1 1
MIRT051194 MEGF8 multiple EGF-like-domains 8 1 1
MIRT051195 HMGN1 high-mobility group nucleosome binding domain 1 1 1
MIRT051196 THAP7 THAP domain containing 7 1 1
MIRT051197 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT051198 ZNF827 zinc finger protein 827 1 1
MIRT051199 SART1 squamous cell carcinoma antigen recognized by T cells 1 1
MIRT051200 AQP12B aquaporin 12B 1 1
MIRT051201 CLTC clathrin, heavy chain (Hc) 1 1
MIRT051202 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT051203 PSMC1 proteasome (prosome, macropain) 26S subunit, ATPase, 1 1 1
MIRT051204 BTBD2 BTB (POZ) domain containing 2 1 1
MIRT051205 PLD3 phospholipase D family, member 3 1 1
MIRT051206 EGLN2 egl nine homolog 2 (C. elegans) 1 1
MIRT051207 ZZEF1 zinc finger, ZZ-type with EF-hand domain 1 1 1
MIRT051208 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT051209 SBF1 SET binding factor 1 1 1
MIRT051210 XPO4 exportin 4 1 1
MIRT051211 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT051212 HM13 histocompatibility (minor) 13 1 1
MIRT051213 ARMCX2 armadillo repeat containing, X-linked 2 1 1
MIRT051214 FAM105B family with sequence similarity 105, member B 1 1
MIRT051215 CYB5R1 cytochrome b5 reductase 1 1 1
MIRT051216 TUBA1A tubulin, alpha 1a 1 1
MIRT051217 NSUN2 NOP2/Sun domain family, member 2 1 1
MIRT051218 FAM155B family with sequence similarity 155, member B 1 1
MIRT051219 FECH ferrochelatase 1 1
MIRT051220 CNN3 calponin 3, acidic 1 1
MIRT051221 DHX35 DEAH (Asp-Glu-Ala-His) box polypeptide 35 1 1
MIRT051222 HOXD13 homeobox D13 1 1
MIRT051223 TRIM4 tripartite motif-containing 4 1 1
MIRT051224 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT051225 TXLNG taxilin gamma 1 1
MIRT051226 NR1I2 nuclear receptor subfamily 1, group I, member 2 1 1
MIRT051227 ZFPL1 zinc finger protein-like 1 1 1
MIRT051228 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT051229 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) 1 1
MIRT051230 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT051231 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT051232 SLMO2 slowmo homolog 2 (Drosophila) 1 1
MIRT051233 NRXN1 neurexin 1 1 1
MIRT051234 TCP1 t-complex 1 1 1
MIRT051235 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT051236 PLEKHM2 pleckstrin homology domain containing, family M (with RUN domain) member 2 1 1
MIRT051237 IMPAD1 inositol monophosphatase domain containing 1 1 1
MIRT051238 PDE3B phosphodiesterase 3B, cGMP-inhibited 1 1
MIRT051239 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT051240 SETD5 SET domain containing 5 1 1
MIRT051241 CREB3L2 cAMP responsive element binding protein 3-like 2 1 1
MIRT051242 ZNF791 zinc finger protein 791 1 1
MIRT051243 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT051244 PCDHGB4 protocadherin gamma subfamily B, 4 1 1
MIRT051245 DICER1 dicer 1, ribonuclease type III 1 1
MIRT051246 KIAA2013 KIAA2013 1 1
MIRT051247 XPO6 exportin 6 1 1
MIRT051248 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT051249 TEP1 telomerase-associated protein 1 1 1
MIRT051250 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT051251 ACTB actin, beta 1 1
MIRT051252 TRAF4 TNF receptor-associated factor 4 1 1
MIRT051253 TFRC transferrin receptor (p90, CD71) 1 1
MIRT051254 NUP155 nucleoporin 155kDa 1 1
MIRT051255 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 1 1
MIRT051256 TOR1A torsin family 1, member A (torsin A) 1 1
MIRT051257 HTT huntingtin 1 1
MIRT051258 ZBTB2 zinc finger and BTB domain containing 2 1 1
MIRT051259 HIST1H2AJ histone cluster 1, H2aj 1 1
MIRT051260 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT051261 GTPBP4 GTP binding protein 4 1 1
MIRT051262 H2AFX H2A histone family, member X 1 1
MIRT051263 LYRM5 LYR motif containing 5 1 1
MIRT051264 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT051265 MIS12 MIS12, MIND kinetochore complex component, homolog (S. pombe) 1 1
MIRT051266 PDXK pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT051267 NUP98 nucleoporin 98kDa 1 1
MIRT051268 SLC25A38 solute carrier family 25, member 38 1 1
MIRT051269 SMEK2 SMEK homolog 2, suppressor of mek1 (Dictyostelium) 1 1
MIRT051270 COQ3 coenzyme Q3 homolog, methyltransferase (S. cerevisiae) 1 1
MIRT051271 TCFL5 transcription factor-like 5 (basic helix-loop-helix) 1 1
MIRT051272 MYO19 myosin XIX 1 1
MIRT051273 HIST1H4B histone cluster 1, H4b 1 1
MIRT051274 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT051275 NPRL3 nitrogen permease regulator-like 3 (S. cerevisiae) 1 1
MIRT051276 LMTK3 lemur tyrosine kinase 3 1 1
MIRT051277 CTSD cathepsin D 1 1
MIRT051278 SND1 staphylococcal nuclease and tudor domain containing 1 1 1
MIRT051279 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT051280 CAMSAP3 KIAA1543 1 1
MIRT051281 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT051282 ABHD2 abhydrolase domain containing 2 1 1
MIRT051283 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT051284 SLC19A1 solute carrier family 19 (folate transporter), member 1 1 1
MIRT051285 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT051286 TBP TATA box binding protein 1 1
MIRT051287 NISCH nischarin 1 1
MIRT051288 FLNA filamin A, alpha 1 1
MIRT051289 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT051290 PTPN18 protein tyrosine phosphatase, non-receptor type 18 (brain-derived) 1 1
MIRT051291 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051292 IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase 1 1
MIRT051293 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT051294 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051295 MED24 mediator complex subunit 24 1 1
MIRT051296 TGOLN2 trans-golgi network protein 2 1 1
MIRT051297 GOLGA7 golgin A7 1 1
MIRT051298 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT051299 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 1 1
MIRT051300 SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1 1
MIRT051301 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1