Accession ID: MIRT001800 [miRNA, hsa-miR-16 :: BCL2, target gene]
miRNA Infomation
miRNA namehsa-miR-16
miRNA-target interaction network
Gene Information
Gene Symbol BCL2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bcl-2
Description B-cell CLL/lymphoma 2
Transcript NM_000633   LinkOut: [ RefSeq ]
Other Transcripts NM_000657   
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa04210    Apoptosis - Homo sapiens (human)
hsa04510    Focal adhesion - Homo sapiens (human)
hsa04722    Neurotrophin signaling pathway - Homo sapiens (human)
hsa05014    Amyotrophic lateral sclerosis (ALS) - Homo sapiens (human)
hsa05200    Pathways in cancer - Homo sapiens (human)
hsa05210    Colorectal cancer - Homo sapiens (human)
hsa05215    Prostate cancer - Homo sapiens (human)
hsa05222    Small cell lung cancer - Homo sapiens (human)
Putative miRNA Targets on BCL2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BCL2
(miRNA target sites are highlighted)
>BCL2|NM_000633|3'UTR
   1 TGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGT
  81 ACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACA
 161 CACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATT
 241 ATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAG
 321 CACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCA
 401 TCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTCTGGCTGCTGGAGGCTGGGGAGAAGGT
 481 GTTCATTCACTTGCATTTCTTTGCCCTGGGGGCTGTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCT
 561 CCCTGGCCTGAAGAAGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAACTTCAG
 641 ATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAATGCCCTTAAATCATAGGAAAGTATTTT
 721 TTTAAGCTACCAATTGTGCCGAGAAAAGCATTTTAGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTA
 801 TATTCATATATTTTGGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTGGAACTT
 881 GAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGAGCATCAGGCCGCCACAAGTGCCTGCT
 961 TTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTGTCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACT
1041 GGCCTCCTCCAGGGATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCACTGTCA
1121 AGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGTAGGCCCGTTTTCACGTGGAGCATGGG
1201 AGCCACGACCCTTCTTAAGACATGTATCACTGTAGAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATG
1281 GTGAAGGCTGGGAACGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTGTGGCCT
1361 TGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACAAATCCTAAAAGAAGCATTGAAGTGAG
1441 GTGTCATGGATTAATTGACCCCTGTCTATGGAATTACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAA
1521 AACCTGACAAAAAAAAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAATCAATGG
1601 TGGGGAACTATAAAGAAGTAACAAAAGAAGTGACATCTTCAGCAAATAAACTAGGAAATTTTTTTTTCTTCCAGTTTAGA
1681 ATCAGCCTTGAAACATTGATGGAATAACTCTGTGGCATTATTGCATTATATACCATTTATCTGTATTAACTTTGGAATGT
1761 ACTCTGTTCAATGTTTAATGCTGTGGTTGATATTTCGAAAGCTGCTTTAAAAAAATACATGCATCTCAGCGTTTTTTTGT
1841 TTTTAATTGTATTTAGTTATGGCCTATACACTATTTGTGAGCAAAGGTGATCGTTTTCTGTTTGAGATTTTTATCTCTTG
1921 ATTCTTCAAAAGCATTCTGAGAAGGTGAGATAAGCCCTGAGTCTCAGCTACCTAAGAAAAACCTGGATGTCACTGGCCAC
2001 TGAGGAGCTTTGTTTCAACCAAGTCATGTGCATTTCCACGTCAACAGAATTGTTTATTGTGACAGTTATATCTGTTGTCC
2081 CTTTGACCTTGTTTCTTGAAGGTTTCCTCGTCCCTGGGCAATTCCGCATTTAATTCATGGTATTCAGGATTACATGCATG
2161 TTTGGTTAAACCCATGAGATTCATTCAGTTAAAAATCCAGATGGCAAATGACCAGCAGATTCAAATCTATGGTGGTTTGA
2241 CCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTT
2321 CTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGA
2401 AGCCAGACCTCCCCGGCGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATT
2481 TTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTGCCAAAATCATTTTAAT
2561 GGAGTCAGTTTGCAGTATGCTCCACGTGGTAAGATCCTCCAAGCTGCTTTAGAAGTAACAATGAAGAACGTGGACGTTTT
2641 TAATATAAAGCCTGTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAG
2721 GTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTGTTACCTGGTTTTAATAACAGTAAATGTGCCCA
2801 GCCTCTTGGCCCCAGAACTGTACAGTATTGTGGCTGCACTTGCTCTAAGAGTAGTTGATGTTGCATTTTCCTTATTGTTA
2881 AAAACATGTTAGAAGCAATGAATGTATATAAAAGCCTCAACTAGTCATTTTTTTCTCCTCTTCTTTTTTTTCATTATATC
2961 TAATTATTTTGCAGTTGGGCAACAGAGAACCATCCCTATTTTGTATTGAAGAGGGATTCACATCTGCATCTTAACTGCTC
3041 TTTATGAATGAAAAAACAGTCCTCTGTATGTACTCCTCTTTACACTGGCCAGGGTCAGAGTTAAATAGAGTATATGCACT
3121 TTCCAAATTGGGGACAAGGGCTCTAAAAAAAGCCCCAAAAGGAGAAGAACATCTGAGAACCTCCTCGGCCCTCCCAGTCC
3201 CTCGCTGCACAAATACTCCGCAAGAGAGGCCAGAATGACAGCTGACAGGGTCTATGGCCATCGGGTCGTCTCCGAAGATT
3281 TGGCAGGGGCAGAAAACTCTGGCAGGCTTAAGATTTGGAATAAAGTCACAGAATTAAGGAAGCACCTCAATTTAGTTCAA
3361 ACAAGACGCCAACATTCTCTCCACAGCTCACTTACCTCTCTGTGTTCAGATGTGGCCTTCCATTTATATGTGATCTTTGT
3441 TTTATTAGTAAATGCTTATCATCTAAAGATGTAGCTCTGGCCCAGTGGGAAAAATTAGGAAGTGATTATAAATCGAGAGG
3521 AGTTATAATAATCAAGATTAAATGTAAATAATCAGGGCAATCCCAACACATGTCTAGCTTTCACCTCCAGGATCTATTGA
3601 GTGAACAGAATTGCAAATAGTCTCTATTTGTAATTGAACTTATCCTAAAACAAATAGTTTATAAATGTGAACTTAAACTC
3681 TAATTAATTCCAACTGTACTTTTAAGGCAGTGGCTGTTTTTAGACTTTCTTATCACTTATAGTTAGTAATGTACACCTAC
3761 TCTATCAGAGAAAAACAGGAAAGGCTCGAAATACAAGCCATTCTAAGGAAATTAGGGAGTCAGTTGAAATTCTATTCTGA
3841 TCTTATTCTGTGGTGTCTTTTGCAGCCCAGACAAATGTGGTTACACACTTTTTAAGAAATACAATTCTACATTGTCAAGC
3921 TTATGAAGGTTCCAATCAGATCTTTATTGTTATTCAATTTGGATCTTTCAGGGATTTTTTTTTTAAATTATTATGGGACA
4001 AAGGACATTTGTTGGAGGGGTGGGAGGGAGGAAGAATTTTTAAATGTAAAACATTCCCAAGTTTGGATCAGGGAGTTGGA
4081 AGTTTTCAGAATAACCAGAACTAAGGGTATGAAGGACCTGTATTGGGGTCGATGTGATGCCTCTGCGAAGAACCTTGTGT
4161 GACAAATGAGAAACATTTTGAAGTTTGTGGTACGACCTTTAGATTCCAGAGACATCAGCATGGCTCAAAGTGCAGCTCCG
4241 TTTGGCAGTGCAATGGTATAAATTTCAAGCTGGATATGTCTAATGGGTATTTAAACAATAAATGTGCAGTTTTAACTAAC
4321 AGGATATTTAATGACAACCTTCTGGTTGGTAGGGACATCTGTTTCTAAATGTTTATTATGTACAATACAGAAAAAAATTT
4401 TATAAAATTAAGCAATGTGAAACTGAATTGGAGAGTGATAATACAAGTCCTTTAGTCTTACCCAGTGAATCATTCTGTTC
4481 CATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGAAAATCAGATGGAGCATG
4561 AATGGTACTGTACCGGTTCATCTGGACTGCCCCAGAAAAATAACTTCAAGCAAACATCCTATCAACAACAAGGTTGTTCT
4641 GCATACCAAGCTGAGCACAGAAGATGGGAACACTGGTGGAGGATGGAAAGGCTCGCTCAATCAAGAAAATTCTGAGACTA
4721 TTAATAAATAAGACTGTAGTGTAGATACTGAGTAAATCCATGCACCTAAACCTTTTGGAAAATCTGCCGTGGGCCCTCCA
4801 GATAGCTCATTTCATTAAGTTTTTCCCTCCAAGGTAGAATTTGCAAGAGTGACAGTGGATTGCATTTCTTTTGGGGAAGC
4881 TTTCTTTTGGTGGTTTTGTTTATTATACCTTCTTAAGTTTTCAACCAAGGTTTGCTTTTGTTTTGAGTTACTGGGGTTAT
4961 TTTTGTTTTAAATAAAAATAAGTGTACAATAAGTGTTTTTGTATTGAAAGCTTTTGTTATCAAGATTTTCATACTTTTAC
5041 CTTCCATGGCTCTTTTTAAGATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTA
5121 AGGATACTTTACATGGTTAAGGTAAAGTAAGTCTCCAGTTGGCCACCATTAGCTATAATGGCACTTTGTTTGTGTTGTTG
5201 GAAAAAGTCACATTGCCATTAAACTTTCCTTGTCTGTCTAGTTAATATTGTGAAGAAAAATAAAGTACAGTGTGAGATAC
5281 TG
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions CLL patient samples
Location of target site 3'UTR
Original Description (Extracted from the article) ... BCL2 Is a Target of Posttranscriptional Repression by miR-15 and miR-16.//both mutants completely abolish the interaction between miR-15a and miR-16-1 and the 3'UTR of BCL2 (Fig. 2C).//These data indicate that both miRNAs directly interact with the 3'UTR of BCL2. ...

- Cimmino, A. Calin, G. A. Fabbri, M. Iorio, et al., 2005, Proc Natl Acad Sci U S A.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gcGGUUAUAAAUGCACGACGAu 5'
            |||||  |   |||||||| 
Target 5' atCCAATCCT---GTGCTGCTa 3'
1 - 19
Article - Cimmino, A. Calin, G. A. Fabbri, M. Iorio, et al.
- Proc Natl Acad Sci U S A, 2005
Chronic lymphocytic leukemia (CLL) is the most common human leukemia and is characterized by predominantly nondividing malignant B cells overexpressing the antiapoptotic B cell lymphoma 2 (Bcl2) protein. miR-15a and miR-16-1 are deleted or down-regulated in the majority of CLLs. Here, we demonstrate that miR-15a and miR-16-1 expression is inversely correlated to Bcl2 expression in CLL and that both microRNAs negatively regulate Bcl2 at a posttranscriptional level. BCL2 repression by these microRNAs induces apoptopsis in a leukemic cell line model. Therefore, miR-15 and miR-16 are natural antisense Bcl2 interactors that could be used for therapy of Bcl2-overexpressing tumors.
LinkOut: [PMID: 16166262]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Raveche, E. S. Salerno, E. Scaglione, B. J. et al.
- Blood, 2007
New Zealand black (NZB) mice with autoimmune and B lymphoproliferative disease (B-LPD) are a model for human chronic lymphocytic leukemia (CLL). A genomewide linkage scan of the NZB loci associated with lymphoma was conducted in F1 backcrosses of NZB and a control strain, DBA/2. Of 202 mice phenotyped for the presence or absence of LPD, surface maker expression, DNA content, and microsatellite polymorphisms, 74 had disease. The CD5(+), IgM(+), B220(dim), hyperdiploid LPD was linked to 3 loci on chromosomes 14, 18, and 19 that are distinct from previously identified autoimmunity-associated loci. The region of synteny with mouse D14mit160 is the human 13q14 region, associated with human CLL, containing microRNAs mir-15a16-1. DNA sequencing of multiple NZB tissues identified a point mutation in the 3' flanking sequence of the identical microRNA, mir-16-1, and this mutation was not present in other strains, including the nearest neighbor, NZW. Levels of miR-16 were decreased in NZB lymphoid tissue. Exogenous miR-16 delivered to an NZB malignant B-1 cell line resulted in cell-cycle alterations and increased apoptosis. Linkage of the mir-15a/16-1 complex and the development of B-LPD in this spontaneous mouse model suggest that the altered expression of the mir-15a/16-1 is the molecular lesion in CLL.
LinkOut: [PMID: 17351108]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Article - Calin, G. A. Pekarsky, Y. Croce, C. M.
- Best Pract Res Clin Haematol, 2007
New findings support the view that chronic lymphocytic leukemia (CLL) is a genetic disease in which the main alterations occur in a new class of genes named microRNAs (miRNAs). Cases with good prognostic features typically are characterized by miRNA down-regulation of genes miR-15a and miR-16-1, located at 13q14.3. Both microRNAs negatively regulate BCL2 at a post-transcriptional level. On the other hand, in CLL cases that use unmutated immunoglobulin heavy-chain variable-region genes (IgV(H)) or have high-level expression of the 70-kD zeta-associated protein (ZAP-70) have high levels of TCL1 due to low-level expression of miR-29 and miR-181, which directly target this oncogene. Conceivably, these miRNAs might be used to target BCL2 or TCL1 for therapy of this disease.
LinkOut: [PMID: 17707831]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay
Conditions HeLa 229
Location of target site 3'UTR
Original Description (Extracted from the article) ... We present evidence for the down-regulation of c-MYC, one of the most potent and frequently deregulated oncogenes, by let-7 miRNA, via the predicted binding site in the 3`UTR, and verify the suppression of BCL-2 by miR16. ...

- Koscianska, E. Baev, V. Skreka, K. et al., 2007, BMC Mol Biol.

Article - Koscianska, E. Baev, V. Skreka, K. et al.
- BMC Mol Biol, 2007
BACKGROUND: MicroRNAs (miRNAs) are one of the most abundant groups of regulatory genes in multicellular organisms, playing important roles in many fundamental cellular processes. More than four hundred miRNAs have been identified in humans and the deregulation of miRNA expression has been also shown in many cancers. Despite the postulated involvement of miRNAs in tumourigenesis, there are only a few examples where an oncogene or a tumour suppressor has been identified as a miRNA target. RESULTS: Here, we present an in silico analysis of potential miRNA- oncogene interactions. Moreover, we have tested the validity of two possible interactions of miRNAs with genes related to cancer. We present evidence for the down-regulation of c-MYC, one of the most potent and frequently deregulated oncogenes, by let-7 miRNA, via the predicted binding site in the 3'UTR, and verify the suppression of BCL-2 by miR16. CONCLUSION: In this work both bioinformatic and experimental approaches for the prediction and validation of possible targets for miRNAs have been used. A list of putative targets for different oncomirs, validation of which would be of special interest, is proposed and two such interactions have been experimentally validated.
LinkOut: [PMID: 17877811]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method qRT-PCR , proteomics analysis
Location of target site 3'UTR
Original Description (Extracted from the article) ... changed ...

- Calin, G. A. Cimmino, A. Fabbri, M. et al., 2008, Proc Natl Acad Sci U S A.

Article - Calin, G. A. Cimmino, A. Fabbri, M. et al.
- Proc Natl Acad Sci U S A, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot
Conditions SGC7901/VCR,
Location of target site 3'UTR, unknown
Tools used in this research TargetScan,
Original Description (Extracted from the article) ... As expected, this suppression was abolished by deleting part of the perfectly complementary sequences in the BCL2 3`-UTR (pGL3-mutBcl2-30UTR) which disrupts the interaction between miR-15b/miR-16 and BCL2 (Fig. 3d). Taken together, these results demonstrate that miR-15b and miR-16 directly inhibit BCL2 expression at posttranscriptional level through its 3`UTR. ...

- Xia, L. Zhang, D. Du, R. Pan, Y. Zhao, L. et al., 2008, Int J Cancer.

Article - Xia, L. Zhang, D. Du, R. Pan, Y. Zhao, L. et al.
- Int J Cancer, 2008
microRNAs are endogenous small noncoding RNAs that regulate gene expression negatively at posttranscriptional level. This latest addition to the complex gene regulatory circuitry revolutionizes our way to understanding physiological and pathological processes in the human body. Here we investigated the possible role of microRNAs in the development of multidrug resistance (MDR) in gastric cancer cells. microRNA expression profiling revealed a limited set of microRNAs with altered expression in multidrug- resistant gastric cancer cell line SGC7901/VCR compared to its parental SGC7901 cell line. Among the downregulated microRNAs are miR-15b and miR-16, members of miR-15/16 family, whose expression was further validated by qRT-PCR. In vitro drug sensitivity assay demonstrated that overexpression of miR-15b or miR-16 sensitized SGC7901/VCR cells to anticancer drugs whereas inhibition of them using antisense oligonucleotides conferred SGC7901 cells MDR. The downregulation of miR-15b and miR-16 in SGC7901/VCR cells was concurrent with the upregulation of Bcl-2 protein. Enforced mir-15b or miR-16 expression reduced Bcl-2 protein level and the luciferase activity of a BCL2 3' untranslated region-based reporter construct in SGC7901/VCR cells, suggesting that BCL2 is a direct target of miR-15b and miR-16. Moreover, overexpression of miR-15b or miR-16 could sensitize SGC7901/VCR cells to VCR-induced apoptosis. Taken together, our findings suggest that miR-15b and miR-16 could play a role in the development of MDR in gastric cancer cells at least in part by modulation of apoptosis via targeting BCL2.
LinkOut: [PMID: 18449891]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions HepG2
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-16 targets Bcl-2 in HepG2 cells.//By Western blot analysis, transfection with miR-16 precursor was found to suppress, while transfection with anti-miR-16 inhibitor increased the Bcl-2 expression in HepG2 cells. Furthermore, transfection with anti-miR-16 inhibitor increased, while transfection with miR-16 precursor suppressed the luciferase reporter activity of pGL3-bcl2 construct in cells (Fig. 3). ...

- Tsang, W. P. Kwok, T. T., 2010, J Nutr Biochem.

Article - Tsang, W. P. Kwok, T. T.
- J Nutr Biochem, 2010
Epigallocatechin gallate (EGCG) is a major type of green tea polyphenols and is known to have cancer prevention effect. MicroRNAs (miRNAs) are 19 to 25 nucleotides and are believed to be important in gene regulation. In the present study, the influence of EGCG on the expressions of miRNAs in human cancer cells was investigated as this has not yet been reported. By miRNA microarray analysis, EGCG treatment was found to modify the expressions of some of the miRNAs in human hepatocellular carcinoma HepG2 cells, 13 were up-regulated and 48 were down-regulated. miR-16 is one of the miRNAs up-regulated by EGCG and one of its target genes is confirmed to be the anti-apoptotic protein Bcl-2. EGCG treatment induced apoptosis and down-regulated Bcl-2 in HepG2 cells. Transfection with anti-miR-16 inhibitor suppressed miR-16 expression and counteracted the EGCG effects on Bcl-2 down-regulation and also induction of apoptosis in cells. Results from the present study confirm the role of miR-16 in mediating the apoptotic effect of EGCG and also support the importance of miRNAs in the regulation of the biological activity of EGCG.
LinkOut: [PMID: 19269153]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Western blot
Conditions OV-202
Original Description (Extracted from the article) ... MiR-15a and miR-16 also target Bcl-2 in ovarian cancer cell lines. ...

- Bhattacharya, R. Nicoloso, M. Arvizo, R. et al., 2009, Cancer Res.

Article - Bhattacharya, R. Nicoloso, M. Arvizo, R. et al.
- Cancer Res, 2009
Oncogenic activation of Bmi-1 is found in a wide variety of epithelial malignancies including ovarian cancer, yet a specific mechanism for overexpression of Bmi-1 has not been determined. Thus, realizing the immense pathologic significance of Bmi-1 in cancer, we wanted to investigate if microRNA (miRNA) aberrations played a role in the regulation of Bmi-1 in ovarian cancer. In this report, we identify two miRNAs, miR-15a and miR-16, that are underexpressed in ovarian cell lines and in primary ovarian tissues. We show that these miRNAs directly target the Bmi-1 3' untranslated region and significantly correlate with Bmi-1 protein levels in ovarian cancer patients and cell lines. Furthermore, Bmi-1 protein levels are downregulated in response to miR-15a or miR-16 expression and lead to significant reduction in ovarian cancer cell proliferation and clonal growth. These findings suggest the development of therapeutic strategies by restoring miR-15a and miR-16 expression in ovarian cancer and in other cancers that involve upregulation of Bmi-1.
LinkOut: [PMID: 19903841]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Immunohistochemistry , Microarray , Western blot
Conditions artificial tissues
Location of target site 3'UTR
Original Description (Extracted from the article) ... we show that miR-16 is upregulated, suggesting cellular BCL2 levels would be lower, which indeed is the case. ...

- Kovalchuk, O. Zemp, F. J. Filkowski, J. N. et al., 2010, Carcinogenesis.

Article - Kovalchuk, O. Zemp, F. J. Filkowski, J. N. et al.
- Carcinogenesis, 2010
The radiation-induced bystander effect (RIBE) is a phenomenon whereby unexposed cells exhibit molecular symptoms of stress exposure when adjacent or nearby cells are traversed by ionizing radiation (IR). Recent data suggest that RIBE may be epigenetically mediated by microRNAs (miRNAs), which are small regulatory molecules that target messenger RNA transcripts for translational inhibition. Here, we analyzed microRNAome changes in bystander tissues after alpha-particle microbeam irradiation of three-dimensional artificial human tissues using miRNA microarrays. Our results indicate that IR leads to a deregulation of miRNA expression in bystander tissues. We report that major bystander end points, including apoptosis, cell cycle deregulation and DNA hypomethylation, may be mediated by altered expression of miRNAs. Specifically, c-MYC-mediated upregulation of the miR-17 family was associated with decreased levels of E2F1 and RB1, suggesting a switch to a proliferative state in bystander tissues, while priming these cells for impending death signals. Upregulation of the miR-29 family resulted in decreased levels of its targets DNMT3a and MCL1, consequently affecting DNA methylation and apoptosis. Altered expression of miR-16 led to changes in expression of BCL2, suggesting modulation of apoptosis. Thus, our data clearly show that miRNAs play a profound role in the manifestation of late RIBE end points. In summary, this study creates a roadmap for understanding the role of microRNAome in RIBE and for developing novel RIBE biomarkers.
LinkOut: [PMID: 20643754]
Experimental Support 10 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-16 :: BCL2    [ Functional MTI ]
Validation Method Western blot
Conditions MCF-7, MDA-MB-231
Location of target site 3'UTR
Original Description (Extracted from the article) ... These results further implicate the BCL-2 targeting miR-15a/16 as important regulators of BCL-2 expression and tamoxifen response and suggest that oncogene suppression of miR-15a and/or miR-16 may represent an important mechanism of tamoxifen resistance. ...

- Cittelly, D. M. Das, P. M. Salvo, V. A. et al., 2010, Carcinogenesis.

Article - Cittelly, D. M. Das, P. M. Salvo, V. A. et al.
- Carcinogenesis, 2010
Tamoxifen is the most commonly prescribed therapy for patients with estrogen receptor (ERalpha) positive breast tumors. Tumor resistance to tamoxifen remains a serious clinical problem especially in patients with tumors that also overexpress HER2. Current preclinical models of HER2 overexpression fail to recapitulate the clinical spectrum of endocrine resistance associated with HER2/ER positive tumors. Here we show that ectopic expression of a clinically important oncogenic isoform of HER2, HER2Delta16, which is expressed in over 30% of ER positive breast tumors, promotes tamoxifen resistance and estrogen independence of MCF-7 xenografts. MCF-7/HER2Delta16 cells evade tamoxifen through upregulation of BCL-2, whereas RNAi-mediated suppression of BCL-2 expression or treatment of MCF-7/HER2Delta16 cells with the BCL-2 family pharmacological inhibitor ABT-737 restores tamoxifen sensitivity. Tamoxifen-resistant MCF-7/HER2Delta16 cells upregulate BCL-2 protein levels in response to suppressed ERalpha signaling mediated by estrogen withdrawal, tamoxifen treatment, or fulvestrant treatment. In addition, HER2Delta16 expression results in suppression of BCL-2 targeting microRNAs miR-15a and miR-16. Reintroduction of miR-15a/16 reduced tamoxifen-induced BCL-2 expression and sensitized MCF-7/HER2Delta16 to tamoxifen. Conversely, inhibition of miR-15a/16 in tamoxifen sensitive cells activated BCL-2 expression and promoted tamoxifen resistance. Our results suggest that HER2Delta16 expression promotes endocrine-resistant HER2/ERalpha positive breast tumors and in contrast to wild-type HER2, preclinical models of HER2Delta16 overexpression recapitulate multiple phenotypes of endocrine resistant human breast tumors. The mechanism of HER2Delta16 therapeutic evasion, involving tamoxifen induced upregulation of BCL-2 and suppression of miR-15a/16, provides a template for unique therapeutic interventions combining tamoxifen with modulation of microRNAs and/or ABT-737 mediated BCL-2 inhibition and apoptosis.
LinkOut: [PMID: 20876285]