Accession ID: MIRT001929 [miRNA, hsa-miR-29c ::
GAPDH, target gene]
| pre-miRNA ID | hsa-mir-29c LinkOut: [miRBase ] |
|---|---|
| Description | Homo sapiens miR-29c stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
| 2nd Structure of pre-miRNA | ![]() |
| Mature miRNA | hsa-miR-29c-3p |
|---|---|
| Mature Sequence | 54| UAGCACCAUUUGAAAUCGGUUA |75 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-29c-3p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
| Mature miRNA | hsa-miR-29c-5p |
| Mature Sequence | 16| UGACCGAUUUCUCCUGGUGUUC |37 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-29c-5p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
![]() |
| Gene Symbol | GAPDH LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Synonyms | G3PD, GAPD, MGC88685 | ||||||||||||||||||||
| Description | glyceraldehyde-3-phosphate dehydrogenase | ||||||||||||||||||||
| Transcript | NM_002046 LinkOut: [ RefSeq ] | ||||||||||||||||||||
| Expression | LinkOut: [ BioGPS ] | ||||||||||||||||||||
| KEGG Pathway |
hsa00010 Glycolysis / Gluconeogenesis - Homo sapiens (human) hsa01100 Metabolic pathways - Homo sapiens (human) hsa05010 Alzheimer's disease - Homo sapiens (human) |
||||||||||||||||||||
| Putative miRNA Targets on GAPDH | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] | ||||||||||||||||||||
| 3'UTR of GAPDH (miRNA target sites are highlighted) |
>GAPDH|NM_002046|3'UTR 1 TAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACAC 81 TCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTAGGGAGCC 161 GCACCTTGTCATGTACCATCAATAAAGTACCCTGTGCTCAACC Target sites Provided by authors Predicted by miRanda |
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
| miRNA:Target | hsa-miR-29c :: GAPDH [ Non-Functional MTI ] |
|---|---|
| Validation Method | Luciferase reporter assay |
| Conditions | HeLa, HepG2 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan, PicTar |
| Original Description (Extracted from the article) | ... In cultured cells, introduction of mir-29c down-regulated these genes at the level of mRNA and inhibited expression of luciferase encoded by vectors having the 3UTRs of these genes. Moreover, for each of several genes tested, mutating the mir-29c target sites in the 3 UTR abrogated mir-29c-induced inhibition of luciferase expression. ... - Sengupta, S. den Boon, J. A. Chen, I. H. et al., 2008, Proc Natl Acad Sci U S A. |
| Article |
- Sengupta, S.
den Boon, J. A.
Chen, I. H. et al. - Proc Natl Acad Sci U S A, 2008
Using highly sensitive microarray-based procedures, we identified eight microRNAs (miRNAs) showing robust differential expression between 31 laser-capture-microdissected nasopharyngeal carcinomas (NPCs) and 10 normal healthy nasopharyngeal epithelial samples. In particular, miRNA mir-29c was expressed at one-fifth the levels in tumors as in normal epithelium. In NPC tumors, the lower mir-29c levels correlated with higher levels of multiple mRNAs whose 3' UTRs can bind mir-29c at target sequences conserved across many vertebrates. In cultured cells, introduction of mir-29c down-regulated these genes at the level of mRNA and inhibited expression of luciferase encoded by vectors having the 3' UTRs of these genes. Moreover, for each of several genes tested, mutating the mir-29c target sites in the 3' UTR abrogated mir-29c-induced inhibition of luciferase expression. Most of the mir-29c-targeted genes identified encode extracellular matrix proteins, including multiple collagens and laminin gamma1, that are associated with tumor cell invasiveness and metastatic potential, prominent characteristics of NPC. Thus, we identify eight miRNAs differentially expressed in NPC and demonstrate the involvement of one in regulating genes involved in metastasis.
LinkOut: [PMID: 18390668]
|

