Accession ID: MIRT001934 [miRNA, hsa-miR-520c-3p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-520cLinkOut: [miRBase ]
Description Homo sapiens miR-520c stem-loop
Comment The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-520c-3p
Mature Sequence 54| AAAGUGCUUCCUUUUAGAGGGU |75
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-520c-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_001136016    LinkOut: [ RefSeq ]
Other Transcripts NM_000484 , NM_001136129 , NM_001136130 , NM_001136131 , NM_201413 , NM_201414   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_001136016|3'UTR
   1 ACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATAATG
  81 TGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCTGAA
 161 CTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGTTTT
 241 GTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCTTAG
 321 CCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGATGCT
 401 TCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAACAT
 481 TTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTATAT
 561 TTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGACTT
 641 CAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTTACG
 721 GGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGTACA
 801 GAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGACTTT
 881 TCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTTAAC
 961 CAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCCTGG
1041 ACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGAGCA
1121 AAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugGGA-GAUUUUCCUUCGUGAAa 5'
            ||| :| |  | |||||||| 
Target 5' tcCCTGTTCATTGTAAGCACTTt 3'
694 - 716 156.00 -16.00
2
miRNA  3' uggGAGAUUUUCCUUCGUGAAa 5'
             :|:||||:  || ||:|| 
Target 5' gcaTTTTAAAGTTAAACATTTt 3'
462 - 483 119.00 -6.90
3
miRNA  3' ugGGAGAUUUU--CCU-UCGUgaaa 5'
            |||||:||:  ||| ||||    
Target 5' agCCTCTGAAGTTGGACAGCAaaac 3'
15 - 39 114.00 -16.76
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-520c-3p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , qRT-PCR ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research Literature survey
Original Description (Extracted from the article) ... Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs,result Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs,results in translational repression of APP mRNA and significantly reduces APP protein levels. we observed that mir-520c over-expression significantly decreased luciferase activity when the putative mir-106a target site was included in the reporter compared to either a reporter lacking the putative target site or a reporter carrying a seed-region mutant of the putative mir-106a target site (Figure 1B). ...

- Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al., 2008, Mol Neurodegener.

Article - Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al.
- Mol Neurodegener, 2008
ABSTRACT: A number of studies have shown that increased APP levels, resulting from either a genomic locus duplication or alteration in APP regulatory sequences, can lead to development of early-onset dementias, including Alzheimer's disease (AD). Therefore, understanding how APP levels are regulated could provide valuable insight into the genetic basis of AD and illuminate novel therapeutic avenues for AD. Here we test the hypothesis that APP protein levels can be regulated by miRNAs, evolutionarily conserved small noncoding RNA molecules that play an important role in regulating gene expression. Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3'UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs, results in translational repression of APP mRNA and significantly reduces APP protein levels. These results are the first to demonstrate that levels of human APP can be regulated by miRNAs.
LinkOut: [PMID: 18684319]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
424 hsa-miR-520c-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001934 APP amyloid beta (A4) precursor protein 4 1
MIRT004082 CD44 CD44 molecule (Indian blood group) 4 2
MIRT006155 MTOR mechanistic target of rapamycin (serine/threonine kinase) 3 1
MIRT006156 SIRT1 sirtuin 1 3 1
MIRT053054 GPC3 glypican 3 3 2
MIRT054074 MICA MHC class I polypeptide-related sequence A 3 2
MIRT056492 PFKP phosphofructokinase, platelet 1 4
MIRT057402 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT061201 MED17 mediator complex subunit 17 1 1
MIRT061372 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT063075 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT064724 CCND2 cyclin D2 1 1
MIRT065877 GDF11 growth differentiation factor 11 1 1
MIRT066875 TMEM19 transmembrane protein 19 1 1
MIRT067249 FOXJ2 forkhead box J2 1 1
MIRT070860 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 2
MIRT071391 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 3
MIRT075794 KIAA0513 KIAA0513 1 3
MIRT077851 MINK1 misshapen-like kinase 1 1 1
MIRT078831 UNK unkempt homolog (Drosophila) 1 1
MIRT079431 FOXK2 forkhead box K2 1 2
MIRT080197 PRKACB protein kinase, cAMP-dependent, catalytic, beta 1 1
MIRT083980 RAB22A RAB22A, member RAS oncogene family 1 2
MIRT084961 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT093821 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT093959 SLAIN2 SLAIN motif family, member 2 1 1
MIRT108668 ZBTB33 zinc finger and BTB domain containing 33 1 2
MIRT112106 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 3
MIRT122383 RGMB RGM domain family, member B 1 2
MIRT124145 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 2
MIRT130121 TXNIP thioredoxin interacting protein 1 4
MIRT138711 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT147304 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 5
MIRT155922 SIK1 salt-inducible kinase 1 1 1
MIRT165917 CREBRF CREB3 regulatory factor 1 1
MIRT173706 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT178679 FAM102B family with sequence similarity 102, member B 1 1
MIRT187265 DAZAP2 DAZ associated protein 2 1 5
MIRT199124 ZNF532 zinc finger protein 532 1 1
MIRT199299 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT200940 ZNF264 zinc finger protein 264 1 3
MIRT201038 ZNF805 zinc finger protein 805 1 1
MIRT213221 REST RE1-silencing transcription factor 1 3
MIRT216441 SERF1A small EDRK-rich factor 1A (telomeric) 1 1
MIRT216466 SERF1B small EDRK-rich factor 1B (centromeric) 1 1
MIRT242216 TTC9 tetratricopeptide repeat domain 9 1 2
MIRT242371 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT242516 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT243441 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT244606 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT281007 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT302458 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT321788 FZD6 frizzled family receptor 6 1 4
MIRT322540 HMBOX1 homeobox containing 1 1 1
MIRT325528 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT356947 FEM1C fem-1 homolog c (C. elegans) 1 4
MIRT383614 POU2F1 POU class 2 homeobox 1 1 1
MIRT437405 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 3 1
MIRT441409 FAM9C family with sequence similarity 9, member C 1 1
MIRT442449 FGF7 fibroblast growth factor 7 1 3
MIRT443076 ABLIM1 actin binding LIM protein 1 1 1
MIRT444423 EMC1 ER membrane protein complex subunit 1 1 1
MIRT446618 HIP1 huntingtin interacting protein 1 1 2
MIRT446809 C5orf30 chromosome 5 open reading frame 30 1 1
MIRT448353 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 3
MIRT448741 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT449160 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT450832 IFFO1 intermediate filament family orphan 1 1 1
MIRT450926 CADM2 cell adhesion molecule 2 1 1
MIRT450958 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT461253 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT463603 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT467911 SLC22A23 solute carrier family 22, member 23 1 1
MIRT471998 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT473613 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT474726 KIF13A kinesin family member 13A 1 3
MIRT476990 FAM73B family with sequence similarity 73, member B 1 1
MIRT477100 FAM160B1 family with sequence similarity 160, member B1 1 3
MIRT477271 ERGIC2 ERGIC and golgi 2 1 1
MIRT478727 CSNK1A1 casein kinase 1, alpha 1 1 3
MIRT479998 CAPRIN2 caprin family member 2 1 2
MIRT480662 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT480829 BLCAP bladder cancer associated protein 1 5
MIRT481757 APH1A anterior pharynx defective 1 homolog A (C. elegans) 1 1
MIRT484832 ZNFX1 zinc finger, NFX1-type containing 1 1 1
MIRT484932 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485342 MYO1D myosin ID 1 1
MIRT485828 ARID4B AT rich interactive domain 4B (RBP1-like) 1 2
MIRT486015 LPAR2 lysophosphatidic acid receptor 2 1 1
MIRT493132 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 3
MIRT494084 DUSP2 dual specificity phosphatase 2 1 2
MIRT496050 MORC1 MORC family CW-type zinc finger 1 1 1
MIRT497458 DDR2 discoidin domain receptor tyrosine kinase 2 1 1
MIRT498049 SNX5 sorting nexin 5 1 3
MIRT500879 SUCO SUN domain containing ossification factor 1 2
MIRT501402 RBBP6 retinoblastoma binding protein 6 1 4
MIRT503792 ZNF12 zinc finger protein 12 1 3
MIRT504085 C9orf40 chromosome 9 open reading frame 40 1 3
MIRT504280 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT505164 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 2
MIRT505214 UBN2 ubinuclein 2 1 4
MIRT505987 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 2
MIRT506268 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT506977 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT507210 FZD9 frizzled family receptor 9 1 3
MIRT507424 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT508562 CEP72 centrosomal protein 72kDa 1 2
MIRT508731 ZNF682 zinc finger protein 682 1 2
MIRT508822 GPR155 G protein-coupled receptor 155 1 1
MIRT509116 BMP8B bone morphogenetic protein 8b 1 3
MIRT509423 MCM7 minichromosome maintenance complex component 7 1 3
MIRT509731 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT510015 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 2
MIRT510212 ZNF317 zinc finger protein 317 1 2
MIRT511306 KIAA1551 KIAA1551 1 1
MIRT511405 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 3
MIRT511542 HMGB1 high mobility group box 1 1 3
MIRT512025 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT512968 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 2
MIRT513813 NFIB nuclear factor I/B 1 1
MIRT514123 SERF2 small EDRK-rich factor 2 1 1
MIRT514305 FXYD5 FXYD domain containing ion transport regulator 5 1 3
MIRT514468 FANCA Fanconi anemia, complementation group A 1 1
MIRT515191 CRCP CGRP receptor component 1 1
MIRT515561 TMEM134 transmembrane protein 134 1 1
MIRT515918 MFAP2 microfibrillar-associated protein 2 1 2
MIRT516046 MED18 mediator complex subunit 18 1 1
MIRT516357 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT516545 MIXL1 Mix paired-like homeobox 1 1
MIRT516785 PTRF polymerase I and transcript release factor 1 2
MIRT517006 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 1
MIRT517173 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT517246 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 2
MIRT518303 ZNF514 zinc finger protein 514 1 2
MIRT518454 KIF6 kinesin family member 6 1 1
MIRT518685 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1 1
MIRT518790 MED16 mediator complex subunit 16 1 2
MIRT518849 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT518958 GRK7 G protein-coupled receptor kinase 7 1 1
MIRT519258 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT519418 KCNA7 potassium voltage-gated channel, shaker-related subfamily, member 7 1 2
MIRT519534 TMEM38A transmembrane protein 38A 1 1
MIRT520068 YIPF4 Yip1 domain family, member 4 1 1
MIRT520142 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT520296 UBXN2A UBX domain protein 2A 1 1
MIRT520559 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT520815 TAOK1 TAO kinase 1 1 1
MIRT520996 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521225 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT521535 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT522158 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 2
MIRT522203 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT522514 MFN1 mitofusin 1 1 1
MIRT522956 IPO9 importin 9 1 1
MIRT523069 HYPK huntingtin interacting protein K 1 1
MIRT523426 GPR157 G protein-coupled receptor 157 1 2
MIRT523553 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT523640 FOXK1 forkhead box K1 1 2
MIRT524238 DCTN6 dynactin 6 1 1
MIRT524281 CYCS cytochrome c, somatic 1 1
MIRT524380 CREB1 cAMP responsive element binding protein 1 1 1
MIRT524443 CNKSR3 CNKSR family member 3 1 1
MIRT524760 BCL2L2 BCL2-like 2 1 1
MIRT524969 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT525653 NHSL2 NHS-like 2 1 1
MIRT525689 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT526625 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT527538 DLGAP5 discs, large (Drosophila) homolog-associated protein 5 1 2
MIRT529525 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT529989 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 2
MIRT530136 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530577 ABHD15 abhydrolase domain containing 15 1 1
MIRT530975 EXO5 exonuclease 5 1 2
MIRT531466 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT531765 TXK TXK tyrosine kinase 1 2
MIRT532039 FHDC1 FH2 domain containing 1 1 1
MIRT532931 ZNF385A zinc finger protein 385A 1 1
MIRT534509 SAR1B SAR1 homolog B (S. cerevisiae) 1 1
MIRT534617 RNASEH1 ribonuclease H1 1 2
MIRT534772 RASGEF1A RasGEF domain family, member 1A 1 1
MIRT535254 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT535391 PER1 period homolog 1 (Drosophila) 1 1
MIRT536026 MCUR1 coiled-coil domain containing 90A 1 1
MIRT536110 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT536173 MAP1B microtubule-associated protein 1B 1 1
MIRT536297 LIMA1 LIM domain and actin binding 1 1 1
MIRT536363 LEFTY1 left-right determination factor 1 1 1
MIRT536423 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT536552 KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 1 1
MIRT536618 IRF2 interferon regulatory factor 2 1 1
MIRT536632 INO80D INO80 complex subunit D 1 1
MIRT536864 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT536956 HAS3 hyaluronan synthase 3 1 1
MIRT536983 HABP4 hyaluronan binding protein 4 1 2
MIRT537252 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT537436 FBXL7 F-box and leucine-rich repeat protein 7 1 1
MIRT537552 ETNK1 ethanolamine kinase 1 1 1
MIRT537749 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT537962 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT537993 DPP8 dipeptidyl-peptidase 8 1 1
MIRT538262 CUL3 cullin 3 1 2
MIRT538515 CLCN3 chloride channel, voltage-sensitive 3 1 1
MIRT538573 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT538649 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT538865 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT538913 BRI3BP BRI3 binding protein 1 1
MIRT539013 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT539060 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT539104 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT539435 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT540264 FAM89A family with sequence similarity 89, member A 1 1
MIRT540378 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT541292 GLO1 glyoxalase I 1 1
MIRT542131 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542257 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT546548 SATB2 SATB homeobox 2 1 1
MIRT547483 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT547641 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT547882 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT548569 DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 1 1
MIRT550867 SNAP47 synaptosomal-associated protein, 47kDa 1 2
MIRT552163 DAD1 defender against cell death 1 1 1
MIRT552193 F2RL3 coagulation factor II (thrombin) receptor-like 3 1 1
MIRT553583 TMEM100 transmembrane protein 100 1 1
MIRT553678 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 2
MIRT554440 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT554493 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554762 RHOC ras homolog family member C 1 1
MIRT555454 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT556541 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT557071 HOXB3 homeobox B3 1 1
MIRT557651 GATA6 GATA binding protein 6 1 1
MIRT560239 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT561337 ZBTB18 zinc finger protein 238 1 1
MIRT566276 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT567083 KBTBD2 kelch repeat and BTB (POZ) domain containing 2 1 1
MIRT567933 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT567982 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT568169 CCDC6 coiled-coil domain containing 6 1 1
MIRT571713 RPL17-C18orf32 RPL17-C18orf32 readthrough 1 1
MIRT571767 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT572199 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT572666 AGMAT agmatine ureohydrolase (agmatinase) 1 2
MIRT573698 RBM12B RNA binding motif protein 12B 1 1
MIRT574564 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT574733 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT575715 Map1b microtubule-associated protein 1B 1 1
MIRT608738 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT612601 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT614253 WDR53 WD repeat domain 53 1 2
MIRT615166 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT616162 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT616801 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT617868 ESR1 estrogen receptor 1 1 1
MIRT619831 POLM polymerase (DNA directed), mu 1 2
MIRT620968 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT625855 SLC35C2 solute carrier family 35, member C2 1 1
MIRT626211 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626920 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT633112 CBX5 chromobox homolog 5 1 1
MIRT634088 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634945 GTF2H2C general transcription factor IIH, polypeptide 2C 1 2
MIRT640020 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT641696 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT645205 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT656321 MELK maternal embryonic leucine zipper kinase 1 1
MIRT659547 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 1 1
MIRT662397 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT663615 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT663942 ZNF554 zinc finger protein 554 1 1
MIRT664218 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT664384 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT673124 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT677145 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT677251 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT678738 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT679723 FBXL2 F-box and leucine-rich repeat protein 2 1 1
MIRT680364 GATAD1 GATA zinc finger domain containing 1 1 2
MIRT680691 ZNF785 zinc finger protein 785 1 1
MIRT680769 WDR73 WD repeat domain 73 1 1
MIRT681401 RMND1 required for meiotic nuclear division 1 homolog (S. cerevisiae) 1 1
MIRT681695 ABI2 abl-interactor 2 1 1
MIRT681831 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT682322 RAB42 RAB42, member RAS oncogene family 1 1
MIRT683320 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683390 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683494 ZNF7 zinc finger protein 7 1 1
MIRT683526 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT683877 OCIAD1 OCIA domain containing 1 1 1
MIRT683950 MYLK3 myosin light chain kinase 3 1 1
MIRT683979 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684082 TLR7 toll-like receptor 7 1 1
MIRT684135 CEP104 centrosomal protein 104kDa 1 1
MIRT684199 MSRB2 methionine sulfoxide reductase B2 1 1
MIRT684360 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT684494 GPR137B G protein-coupled receptor 137B 1 1
MIRT684576 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT684619 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT684650 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT684715 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT684744 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT684789 MYO1F myosin IF 1 1
MIRT684921 CD28 CD28 molecule 1 1
MIRT685197 DCTN5 dynactin 5 (p25) 1 1
MIRT685250 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685318 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT685353 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT685521 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685580 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT685637 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT685662 C11orf1 chromosome 11 open reading frame 1 1 1
MIRT685711 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685744 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685785 ZNF426 zinc finger protein 426 1 1
MIRT685885 RTN2 reticulon 2 1 1
MIRT685957 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686108 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686158 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686285 WWC1 WW and C2 domain containing 1 1 1
MIRT686323 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686364 USP15 ubiquitin specific peptidase 15 1 1
MIRT686392 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT686446 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686493 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686529 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT686584 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT686695 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT686829 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT686882 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT686916 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT686982 SERINC1 serine incorporator 1 1 1
MIRT687046 RNF115 ring finger protein 115 1 1
MIRT687081 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687256 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687598 MANEAL mannosidase, endo-alpha-like 1 1
MIRT687652 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT687860 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT687985 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT688125 GEMIN8 gem (nuclear organelle) associated protein 8 1 1
MIRT688219 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT688277 FAM213A family with sequence similarity 213, member A 1 1
MIRT688485 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT688508 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688832 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT689176 ZNF665 zinc finger protein 665 1 1
MIRT689801 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689846 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690741 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT690986 ZNF578 zinc finger protein 578 1 1
MIRT691078 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691335 KIAA1841 KIAA1841 1 1
MIRT691499 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT691580 CCDC125 coiled-coil domain containing 125 1 1
MIRT691616 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT692076 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692113 CXorf38 chromosome X open reading frame 38 1 2
MIRT692214 NOL9 nucleolar protein 9 1 1
MIRT692322 RFK riboflavin kinase 1 1
MIRT692384 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692445 METTL8 methyltransferase like 8 1 1
MIRT692480 APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 1 1
MIRT692548 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692609 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692790 SYNPO2L synaptopodin 2-like 1 1
MIRT692821 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT692883 RBM41 RNA binding motif protein 41 1 1
MIRT692993 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693142 THEM4 thioesterase superfamily member 4 1 1
MIRT693355 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694115 ZNF446 zinc finger protein 446 1 1
MIRT694199 ZNF347 zinc finger protein 347 1 1
MIRT694665 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694819 STX4 syntaxin 4 1 1
MIRT694941 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695185 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT695311 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT695665 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695838 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695930 ZNF174 zinc finger protein 174 1 1
MIRT695977 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT696188 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696449 SUGP1 SURP and G patch domain containing 1 1 1
MIRT696865 UBOX5 U-box domain containing 5 1 1
MIRT696912 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697251 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697396 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT697991 TSPAN6 tetraspanin 6 1 1
MIRT698336 TMEM127 transmembrane protein 127 1 1
MIRT699276 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699323 SLC35F5 solute carrier family 35, member F5 1 2
MIRT699639 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699701 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT700050 RPL14 ribosomal protein L14 1 1
MIRT700108 RNF19B ring finger protein 19B 1 1
MIRT701116 PAPD5 PAP associated domain containing 5 1 1
MIRT701300 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701581 MYPN myopalladin 1 1
MIRT702531 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT703097 GPRIN3 GPRIN family member 3 1 1
MIRT704116 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704151 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704203 LDHD lactate dehydrogenase D 1 1
MIRT704468 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT704769 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705090 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT705355 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT706111 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706282 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT706317 CCDC30 coiled-coil domain containing 30 1 1
MIRT706357 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706409 HAS2 hyaluronan synthase 2 1 1
MIRT706440 LIAS lipoic acid synthetase 1 1
MIRT706520 MTMR9 myotubularin related protein 9 1 1
MIRT707594 PCNXL2 pecanex-like 2 (Drosophila) 1 1
MIRT708376 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708454 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT709078 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709543 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT709625 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT714312 ZNF454 zinc finger protein 454 1 1
MIRT715603 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT716546 GOLGA2 golgin A2 1 1
MIRT717809 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT719078 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*