Accession ID: MIRT001934 [miRNA, hsa-miR-520c-3p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-520cLinkOut: [miRBase ]
Description Homo sapiens miR-520c stem-loop
Comment The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-520c-3p
Mature Sequence 54| AAAGUGCUUCCUUUUAGAGGGU |75
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-520c-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_0004    LinkOut: [ RefSeq ]
Other Transcripts NM_0011361 , NM_0011361 , NM_2014 , NM_2014   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_0004|3'UTR
   1 TAGACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATA
  81 ATGTGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCT
 161 GAACTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGT
 241 TTTGTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCT
 321 TAGCCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGAT
 401 GCTTCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAA
 481 CATTTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTA
 561 TATTTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGA
 641 CTTCAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTT
 721 ACGGGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGT
 801 ACAGAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGAC
 881 TTTTCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTT
 961 AACCAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCC
1041 TGGACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGA
1121 GCAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-520c-3p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , qRT-PCR ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research Literature survey
Original Description (Extracted from the article) ... Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs,result Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs,results in translational repression of APP mRNA and significantly reduces APP protein levels. we observed that mir-520c over-expression significantly decreased luciferase activity when the putative mir-106a target site was included in the reporter compared to either a reporter lacking the putative target site or a reporter carrying a seed-region mutant of the putative mir-106a target site (Figure 1B). ...

- Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al., 2008, Mol Neurodegener.

Article - Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al.
- Mol Neurodegener, 2008
ABSTRACT: A number of studies have shown that increased APP levels, resulting from either a genomic locus duplication or alteration in APP regulatory sequences, can lead to development of early-onset dementias, including Alzheimer's disease (AD). Therefore, understanding how APP levels are regulated could provide valuable insight into the genetic basis of AD and illuminate novel therapeutic avenues for AD. Here we test the hypothesis that APP protein levels can be regulated by miRNAs, evolutionarily conserved small noncoding RNA molecules that play an important role in regulating gene expression. Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3'UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs, results in translational repression of APP mRNA and significantly reduces APP protein levels. These results are the first to demonstrate that levels of human APP can be regulated by miRNAs.
LinkOut: [PMID: 18684319]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
4 hsa-miR-520c-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001934 APP amyloid beta (A4) precursor protein 4 1
MIRT004082 CD44 CD44 molecule (Indian blood group) 4 2
MIRT006155 MTOR mechanistic target of rapamycin (serine/threonine kinase) 3 1
MIRT006156 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 3 1