Accession ID: MIRT001935 [miRNA, hsa-miR-106a-5p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-106aLinkOut: [miRBase ]
Description Homo sapiens miR-106a stem-loop
Comment This miRNA was not cloned in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-106a-5p
Mature Sequence 13| AAAAGUGCUUACAGUGCAGGUAG |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-106a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_0004    LinkOut: [ RefSeq ]
Other Transcripts NM_0011361 , NM_0011361 , NM_2014 , NM_2014   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_0004|3'UTR
   1 TAGACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATA
  81 ATGTGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCT
 161 GAACTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGT
 241 TTTGTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCT
 321 TAGCCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGAT
 401 GCTTCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAA
 481 CATTTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTA
 561 TATTTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGA
 641 CTTCAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTT
 721 ACGGGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGT
 801 ACAGAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGAC
 881 TTTTCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTT
 961 AACCAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCC
1041 TGGACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGA
1121 GCAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-106a-5p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , qRT-PCR ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research Literature survey
Original Description (Extracted from the article) ... Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs,results in translational repression of APP mRNA and significantly reduces APP protein levels. We observed a significant ~50% decrease (p < 0.0001) in luciferase activity when the putative mir-106a target site was included in the reporter compared to either a reporter lacking the putative target site or reporter carrying a seed-region mutant of the putative mir-106a target site. ...

- Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al., 2008, Mol Neurodegener.

Article - Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al.
- Mol Neurodegener, 2008
ABSTRACT: A number of studies have shown that increased APP levels, resulting from either a genomic locus duplication or alteration in APP regulatory sequences, can lead to development of early-onset dementias, including Alzheimer's disease (AD). Therefore, understanding how APP levels are regulated could provide valuable insight into the genetic basis of AD and illuminate novel therapeutic avenues for AD. Here we test the hypothesis that APP protein levels can be regulated by miRNAs, evolutionarily conserved small noncoding RNA molecules that play an important role in regulating gene expression. Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3'UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs, results in translational repression of APP mRNA and significantly reduces APP protein levels. These results are the first to demonstrate that levels of human APP can be regulated by miRNAs.
LinkOut: [PMID: 18684319]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-106a-5p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... We found that miR-20a, miR-17-5p, and miRNA106b affected signi´Čücantly luciferase expression (Fig. 1B). In contrast, a scrambled miRNA sequence, as well as the other candidate miRNAs (miR-15a, miR-130a, let-7d and let-7a) showed no effect in this assay. Curiously, miR-106a, which is closely related to miR-106b, had in this assay an inconsistent effect. ...

- Hebert, S. S. Horre, K. Nicolai, L. et al., 2009, Neurobiol Dis.

Article - Hebert, S. S. Horre, K. Nicolai, L. et al.
- Neurobiol Dis, 2009
Gene dosage effects of Amyloid precursor protein (APP) can cause familial AD. Recent evidence suggest that microRNA (miRNA) pathways, implicated in gene transcriptional control, could be involved in the development of sporadic Alzheimer's disease (AD). We therefore investigated whether miRNAs could participate in the regulation of APP gene expression. We show that miRNAs belonging to the miR-20a family (that is, miR-20a, miR-17-5p and miR-106b) could regulate APP expression in vitro and at the endogenous level in neuronal cell lines. A tight correlation between these miRNAs and APP was found during brain development and in differentiating neurons. We thus identify miRNAs as novel endogenous regulators of APP expression, suggesting that variations in miRNA expression could contribute to changes in APP expression in the brain during development and disease. This possibility is further corroborated by the observation that a statistically significant decrease in miR-106b expression was found in sporadic AD patients.
LinkOut: [PMID: 19110058]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
60 hsa-miR-106a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000374 E2F1 E2F transcription factor 1 5 3
MIRT001223 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 5 4
MIRT001837 HIPK3 homeodomain interacting protein kinase 3 2 1
MIRT001838 MYLIP myosin regulatory light chain interacting protein 3 1
MIRT001840 RB1 retinoblastoma 1 5 4
MIRT001935 APP amyloid beta (A4) precursor protein 4 2
MIRT003743 RUNX1 runt-related transcription factor 1 4 1
MIRT004028 ARID4B AT rich interactive domain 4B (RBP1-like) 3 1
MIRT004465 VEGFA vascular endothelial growth factor A 2 1
MIRT005082 IL10 interleukin 10 3 1
MIRT006331 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT006825 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 2 1
MIRT007270 CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 1 1
MIRT026980 PAK7 p21 protein (Cdc42/Rac)-activated kinase 7 1 1
MIRT026981 PTEN phosphatase and tensin homolog 1 1
MIRT035532 SIRPA signal-regulatory protein alpha 1 1
MIRT048312 XIAP X-linked inhibitor of apoptosis 1 1
MIRT048313 CUL4A cullin 4A 1 1
MIRT048314 COL2A1 collagen, type II, alpha 1 1 1
MIRT048315 TFG TRK-fused gene 1 1
MIRT048316 RPH3A rabphilin 3A homolog (mouse) 1 1
MIRT048317 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT048318 PELI1 pellino homolog 1 (Drosophila) 1 1
MIRT048319 PRRC2A HLA-B associated transcript 2 1 1
MIRT048320 CYB561D1 cytochrome b-561 domain containing 1 1 1
MIRT048321 CKAP2 cytoskeleton associated protein 2 1 1
MIRT048322 ZBTB47 zinc finger and BTB domain containing 47 1 1
MIRT048323 SH3BP5L SH3-binding domain protein 5-like 1 1
MIRT048324 HEATR1 HEAT repeat containing 1 1 1
MIRT048325 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT048326 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT048327 ARHGAP5 Rho GTPase activating protein 5 1 1
MIRT048328 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT048329 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT048330 RNF182 ring finger protein 182 1 1
MIRT048331 VDAC1 voltage-dependent anion channel 1 1 1
MIRT048332 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT048333 SEPT2 septin 2 1 1
MIRT048334 CHST14 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 1 1
MIRT048335 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT048336 SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1 1
MIRT048337 HOXC11 homeobox C11 1 1
MIRT048338 CHTF8 CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) 1 1
MIRT048339 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT048340 RTCA RNA terminal phosphate cyclase domain 1 1 1
MIRT048341 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT048342 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT048343 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT048344 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT048345 MTMR3 myotubularin related protein 3 1 1
MIRT048346 RTN3 reticulon 3 1 1
MIRT048347 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT048348 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT048349 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1A 1 1
MIRT048350 CCDC47 coiled-coil domain containing 47 1 1
MIRT048351 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048352 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT048353 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT048354 MTF1 metal-regulatory transcription factor 1 1 1
MIRT048355 ZNF598 zinc finger protein 598 1 1