Accession ID: MIRT001935 [miRNA, hsa-miR-106a-5p :: APP, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-106aLinkOut: [miRBase ]
Description Homo sapiens miR-106a stem-loop
Comment This miRNA was not cloned in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-106a-5p
Mature Sequence 13| AAAAGUGCUUACAGUGCAGGUAG |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-106a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol APP LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2
Description amyloid beta (A4) precursor protein
Transcript NM_001136016    LinkOut: [ RefSeq ]
Other Transcripts NM_000484 , NM_001136129 , NM_001136130 , NM_001136131 , NM_201413 , NM_201414   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on APP LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of APP
(miRNA target sites are highlighted)
>APP|NM_001136016|3'UTR
   1 ACCCCCGCCACAGCAGCCTCTGAAGTTGGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATAATG
  81 TGGGAAGAAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAAGTAGATGCCTGAA
 161 CTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACATTTTGGTCTCTATACTACATTATTAATGGGTTTT
 241 GTGTACTGTAAAGAATTTAGCTGTATCAAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCTTAG
 321 CCAGTTGTATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATCGATGGGGGATGCT
 401 TCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCTTTCCTGATCACTATGCATTTTAAAGTTAAACAT
 481 TTTTAAGTATTTCAGATGCTTTAGAGAGATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTATAT
 561 TTGTGATATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTAGGCATTGAGACTT
 641 CAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGAAAAGAATCCCTGTTCATTGTAAGCACTTTTACG
 721 GGGCGGGTGGGGAGGGGTGCTCTGCTGGTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGTACA
 801 GAATCATTGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGACTTT
 881 TCTTTGAAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAGATTCAATTTTCTTTAAC
 961 CAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATGGAAGTGGCAATATAAGGGGATGAGGAAGGCATGCCTGG
1041 ACAAACCCTTCTTTTAAGATGTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGAGCA
1121 AAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gauGGAC--GUGACAUUCGUGAAAa 5'
             ||||  ||:|||||||||||| 
Target 5' atcCCTGTTCATTGTAAGCACTTTt 3'
693 - 717 186.00 -25.20
2
miRNA  3' gauGGAC--GUGACAUUCGUGAAAa 5'
             ||||  |||  || |||:||| 
Target 5' tttCCTGATCAC--TATGCATTTTa 3'
447 - 469 146.00 -12.60
3
miRNA  3' gauGGACGUGACAUUCGUGAAAa 5'
             ::| || ||   |||:||| 
Target 5' tttTTTCCA-TGACTGCATTTTa 3'
512 - 533 131.00 -6.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-106a-5p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , qRT-PCR ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research Literature survey
Original Description (Extracted from the article) ... Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs,results in translational repression of APP mRNA and significantly reduces APP protein levels. We observed a significant ~50% decrease (p < 0.0001) in luciferase activity when the putative mir-106a target site was included in the reporter compared to either a reporter lacking the putative target site or reporter carrying a seed-region mutant of the putative mir-106a target site. ...

- Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al., 2008, Mol Neurodegener.

Article - Patel, N. Hoang, D. Miller, N. Ansaloni, S. et al.
- Mol Neurodegener, 2008
ABSTRACT: A number of studies have shown that increased APP levels, resulting from either a genomic locus duplication or alteration in APP regulatory sequences, can lead to development of early-onset dementias, including Alzheimer's disease (AD). Therefore, understanding how APP levels are regulated could provide valuable insight into the genetic basis of AD and illuminate novel therapeutic avenues for AD. Here we test the hypothesis that APP protein levels can be regulated by miRNAs, evolutionarily conserved small noncoding RNA molecules that play an important role in regulating gene expression. Utilizing human cell lines, we demonstrate that miRNAs hsa-mir-106a and hsa-mir-520c bind to their predicted target sequences in the APP 3'UTR and negatively regulate reporter gene expression. Over-expression of these miRNAs, but not control miRNAs, results in translational repression of APP mRNA and significantly reduces APP protein levels. These results are the first to demonstrate that levels of human APP can be regulated by miRNAs.
LinkOut: [PMID: 18684319]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-106a-5p :: APP    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... We found that miR-20a, miR-17-5p, and miRNA106b affected signi´Čücantly luciferase expression (Fig. 1B). In contrast, a scrambled miRNA sequence, as well as the other candidate miRNAs (miR-15a, miR-130a, let-7d and let-7a) showed no effect in this assay. Curiously, miR-106a, which is closely related to miR-106b, had in this assay an inconsistent effect. ...

- Hebert, S. S. Horre, K. Nicolai, L. et al., 2009, Neurobiol Dis.

Article - Hebert, S. S. Horre, K. Nicolai, L. et al.
- Neurobiol Dis, 2009
Gene dosage effects of Amyloid precursor protein (APP) can cause familial AD. Recent evidence suggest that microRNA (miRNA) pathways, implicated in gene transcriptional control, could be involved in the development of sporadic Alzheimer's disease (AD). We therefore investigated whether miRNAs could participate in the regulation of APP gene expression. We show that miRNAs belonging to the miR-20a family (that is, miR-20a, miR-17-5p and miR-106b) could regulate APP expression in vitro and at the endogenous level in neuronal cell lines. A tight correlation between these miRNAs and APP was found during brain development and in differentiating neurons. We thus identify miRNAs as novel endogenous regulators of APP expression, suggesting that variations in miRNA expression could contribute to changes in APP expression in the brain during development and disease. This possibility is further corroborated by the observation that a statistically significant decrease in miR-106b expression was found in sporadic AD patients.
LinkOut: [PMID: 19110058]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
671 hsa-miR-106a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000374 E2F1 E2F transcription factor 1 5 3
MIRT001223 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 5 5
MIRT001837 HIPK3 homeodomain interacting protein kinase 3 3 2
MIRT001838 MYLIP myosin regulatory light chain interacting protein 5 8
MIRT001840 RB1 retinoblastoma 1 6 7
MIRT001935 APP amyloid beta (A4) precursor protein 4 2
MIRT003743 RUNX1 runt-related transcription factor 1 4 1
MIRT004028 ARID4B AT rich interactive domain 4B (RBP1-like) 5 4
MIRT004465 VEGFA vascular endothelial growth factor A 3 2
MIRT005082 IL10 interleukin 10 3 1
MIRT006331 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT006825 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 3 4
MIRT007270 CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 1 1
MIRT026980 PAK7 p21 protein (Cdc42/Rac)-activated kinase 7 1 1
MIRT026981 PTEN phosphatase and tensin homolog 4 2
MIRT035532 SIRPA signal-regulatory protein alpha 1 1
MIRT048312 XIAP X-linked inhibitor of apoptosis 1 2
MIRT048313 CUL4A cullin 4A 1 1
MIRT048314 COL2A1 collagen, type II, alpha 1 1 1
MIRT048315 TFG TRK-fused gene 1 1
MIRT048316 RPH3A rabphilin 3A homolog (mouse) 1 1
MIRT048317 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT048318 PELI1 pellino E3 ubiquitin protein ligase 1 1 1
MIRT048319 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT048320 CYB561D1 cytochrome b-561 domain containing 1 1 1
MIRT048321 CKAP2 cytoskeleton associated protein 2 1 2
MIRT048322 ZBTB47 zinc finger and BTB domain containing 47 1 1
MIRT048323 SH3BP5L SH3-binding domain protein 5-like 1 1
MIRT048324 HEATR1 HEAT repeat containing 1 1 1
MIRT048325 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT048326 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT048327 ARHGAP5 Rho GTPase activating protein 5 1 1
MIRT048328 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT048329 NOTCH2 notch 2 1 1
MIRT048330 RNF182 ring finger protein 182 1 1
MIRT048331 VDAC1 voltage-dependent anion channel 1 1 1
MIRT048332 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT048333 SEPT2 septin 2 1 3
MIRT048334 CHST14 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 1 1
MIRT048335 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 6
MIRT048336 SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1 1
MIRT048337 HOXC11 homeobox C11 1 1
MIRT048338 CHTF8 CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) 1 1
MIRT048339 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT048340 RTCA RNA 3'-terminal phosphate cyclase 1 1
MIRT048341 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 1 1
MIRT048342 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT048343 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT048344 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT048345 MTMR3 myotubularin related protein 3 1 1
MIRT048346 RTN3 reticulon 3 1 1
MIRT048347 WEE1 WEE1 homolog (S. pombe) 1 2
MIRT048348 EIF3M eukaryotic translation initiation factor 3, subunit M 1 1
MIRT048349 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1 1 1
MIRT048350 CCDC47 coiled-coil domain containing 47 1 1
MIRT048351 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048352 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT048353 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT048354 MTF1 metal-regulatory transcription factor 1 1 1
MIRT048355 ZNF598 zinc finger protein 598 1 1
MIRT053068 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 3 1
MIRT053203 BMP2 bone morphogenetic protein 2 4 2
MIRT053229 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 3 2
MIRT053230 CCND1 cyclin D1 3 7
MIRT053296 ATM ataxia telangiectasia mutated 3 1
MIRT053388 CASP7 caspase 7, apoptosis-related cysteine peptidase 2 1
MIRT053389 BCL10 B-cell CLL/lymphoma 10 2 1
MIRT053564 RUNX3 runt-related transcription factor 3 4 2
MIRT053595 TIMP2 TIMP metallopeptidase inhibitor 2 3 2
MIRT054221 MAPK9 mitogen-activated protein kinase 9 2 1
MIRT054224 LIMK1 LIM domain kinase 1 2 1
MIRT054367 FASTK Fas-activated serine/threonine kinase 4 1
MIRT054883 MAPK14 mitogen-activated protein kinase 14 1 1
MIRT055022 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT055385 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT056302 WAC WW domain containing adaptor with coiled-coil 1 3
MIRT056478 PFKP phosphofructokinase, platelet 1 4
MIRT056815 REEP3 receptor accessory protein 3 1 1
MIRT057386 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT057824 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT060499 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT061183 MED17 mediator complex subunit 17 1 1
MIRT061790 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT063056 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT064437 GPR137B G protein-coupled receptor 137B 1 2
MIRT064799 ZBTB18 zinc finger protein 238 1 1
MIRT065672 ACVR1B activin A receptor, type IB 1 3
MIRT065860 GDF11 growth differentiation factor 11 1 1
MIRT065887 RAB5B RAB5B, member RAS oncogene family 1 4
MIRT067231 FOXJ2 forkhead box J2 1 1
MIRT069698 FOXJ3 forkhead box J3 1 1
MIRT070841 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 2
MIRT070998 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071906 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT072248 B2M beta-2-microglobulin 1 5
MIRT075777 KIAA0513 KIAA0513 1 3
MIRT076179 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 2
MIRT077067 KRT10 keratin 10 1 4
MIRT077833 MINK1 misshapen-like kinase 1 1 1
MIRT078813 UNK unkempt homolog (Drosophila) 1 1
MIRT079346 CCDC137 coiled-coil domain containing 137 1 1
MIRT079413 FOXK2 forkhead box K2 1 2
MIRT079774 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT080179 PRKACB protein kinase, cAMP-dependent, catalytic, beta 1 1
MIRT080224 SMAD4 SMAD family member 4 1 3
MIRT081118 LDLR low density lipoprotein receptor 1 4
MIRT081199 MIDN midnolin 1 5
MIRT082293 FNBP1L formin binding protein 1-like 1 3
MIRT083962 RAB22A RAB22A, member RAS oncogene family 1 2
MIRT084346 RRM2 ribonucleotide reductase M2 1 1
MIRT085174 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT086428 NABP1 nucleic acid binding protein 1 1 3
MIRT088034 UBXN2A UBX domain protein 2A 1 2
MIRT088338 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090635 U2SURP U2 snRNP-associated SURP domain containing 1 3
MIRT092686 C3ORF38 chromosome 3 open reading frame 38 1 4
MIRT093802 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT095721 ANKH ankylosis, progressive homolog (mouse) 1 4
MIRT097130 FCHO2 FCH domain only 2 1 1
MIRT099310 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099826 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100947 CENPQ centromere protein Q 1 2
MIRT102223 HBP1 HMG-box transcription factor 1 1 1
MIRT102296 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT103193 SP4 Sp4 transcription factor 1 3
MIRT104163 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT108652 ZBTB33 zinc finger and BTB domain containing 33 1 2
MIRT112091 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 3
MIRT115782 CAPN15 small optic lobes homolog (Drosophila) 1 1
MIRT122365 RGMB RGM domain family, member B 1 2
MIRT124128 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 2
MIRT126554 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT130075 TXNIP thioredoxin interacting protein 1 2
MIRT135795 GNS glucosamine (N-acetyl)-6-sulfatase 1 3
MIRT143571 RBL2 retinoblastoma-like 2 (p130) 1 1
MIRT144300 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 4
MIRT145599 LASP1 LIM and SH3 protein 1 1 1
MIRT153329 MAVS mitochondrial antiviral signaling protein 1 2
MIRT153972 PRNP prion protein 1 1
MIRT155892 SIK1 salt-inducible kinase 1 1 1
MIRT158576 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT159111 NRBP1 nuclear receptor binding protein 1 1 1
MIRT164527 MSMO1 methylsterol monooxygenase 1 1 1
MIRT170851 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 1 2
MIRT175381 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT178063 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT182519 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT187474 PCBP2 poly(rC) binding protein 2 1 2
MIRT188184 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT199108 ZNF532 zinc finger protein 532 1 1
MIRT199284 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT200925 ZNF264 zinc finger protein 264 1 3
MIRT201020 ZNF805 zinc finger protein 805 1 1
MIRT205048 CREB1 cAMP responsive element binding protein 1 1 1
MIRT205283 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT206194 RAB10 RAB10, member RAS oncogene family 1 2
MIRT208977 SKIL SKI-like oncogene 1 5
MIRT213205 REST RE1-silencing transcription factor 1 1
MIRT213323 KIAA0232 KIAA0232 1 1
MIRT216425 SERF1A small EDRK-rich factor 1A (telomeric) 1 1
MIRT216450 SERF1B small EDRK-rich factor 1B (centromeric) 1 1
MIRT216663 F2R coagulation factor II (thrombin) receptor 1 1
MIRT220121 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT222675 EIF4H eukaryotic translation initiation factor 4H 1 3
MIRT224749 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT230967 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT238174 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT241295 ZC3H12C zinc finger CCCH-type containing 12C 1 4
MIRT242198 TTC9 tetratricopeptide repeat domain 9 1 2
MIRT242659 SALL3 sal-like 3 (Drosophila) 1 2
MIRT244590 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT246962 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT257281 FOXC1 forkhead box C1 1 1
MIRT266051 FJX1 four jointed box 1 (Drosophila) 1 2
MIRT266855 SLC25A44 solute carrier family 25, member 44 1 1
MIRT280209 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT280992 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT283174 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT286948 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT289575 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT291933 TPM4 tropomyosin 4 1 1
MIRT293647 PVR poliovirus receptor 1 2
MIRT302437 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT303491 NAGK N-acetylglucosamine kinase 1 3
MIRT322522 HMBOX1 homeobox containing 1 1 1
MIRT325512 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT363925 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT368884 BCL2L2 BCL2-like 2 1 1
MIRT397686 ATXN7L3B ataxin 7-like 3B 1 1
MIRT400048 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT438794 TP53 tumor protein p53 1 1
MIRT441883 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT442205 CCDC132 coiled-coil domain containing 132 1 1
MIRT442554 SLCO5A1 solute carrier organic anion transporter family, member 5A1 1 1
MIRT442764 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT442803 CEP170 centrosomal protein 170kDa 1 2
MIRT443261 A1CF APOBEC1 complementation factor 1 1
MIRT443715 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT444314 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT444440 EMC1 ER membrane protein complex subunit 1 1 1
MIRT448319 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT448371 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 3
MIRT448395 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT448648 NPNT nephronectin 1 1
MIRT448674 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT448731 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT449176 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT450192 TMEM9B TMEM9 domain family, member B 1 1
MIRT450916 CADM2 cell adhesion molecule 2 1 1
MIRT450951 ATAD2 ATPase family, AAA domain containing 2 1 1
MIRT458296 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT462129 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT463557 ZBTB5 zinc finger and BTB domain containing 5 1 2
MIRT464851 RPS27A ribosomal protein S27a 1 6
MIRT465237 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT465542 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT465839 TMEM64 transmembrane protein 64 1 1
MIRT466458 TFAM transcription factor A, mitochondrial 1 4
MIRT467498 SMIM13 chromosome 6 open reading frame 228 1 3
MIRT467898 SLC22A23 solute carrier family 22, member 23 1 1
MIRT468164 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468188 SGMS1 sphingomyelin synthase 1 1 1
MIRT469857 PXK PX domain containing serine/threonine kinase 1 4
MIRT470053 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT471010 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT472054 NPAT nuclear protein, ataxia-telangiectasia locus 1 1
MIRT472171 NIN ninein (GSK3B interacting protein) 1 2
MIRT472287 NFIB nuclear factor I/B 1 2
MIRT472346 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 2
MIRT473165 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT473815 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT473907 M6PR mannose-6-phosphate receptor (cation dependent) 1 4
MIRT474421 KLHL28 kelch-like 28 (Drosophila) 1 4
MIRT474601 KLF6 Kruppel-like factor 6 1 1
MIRT475414 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT475473 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476123 GPR157 G protein-coupled receptor 157 1 3
MIRT476908 FBXL5 F-box and leucine-rich repeat protein 5 1 6
MIRT477115 FAM160B1 family with sequence similarity 160, member B1 1 3
MIRT477199 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT477289 ERGIC2 ERGIC and golgi 2 1 1
MIRT478721 CSNK1A1 casein kinase 1, alpha 1 1 2
MIRT479043 COIL coilin 1 5
MIRT479067 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 4
MIRT479271 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT480562 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT480679 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT480956 BBX bobby sox homolog (Drosophila) 1 4
MIRT481346 ATL3 atlastin GTPase 3 1 1
MIRT481604 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT481883 ANKRD50 ankyrin repeat domain 50 1 1
MIRT482136 AKAP11 A kinase (PRKA) anchor protein 11 1 6
MIRT482476 ADAR adenosine deaminase, RNA-specific 1 2
MIRT484871 ZNF70 zinc finger protein 70 1 2
MIRT484888 ZNF652 zinc finger protein 652 1 1
MIRT484920 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485098 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT485196 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 2
MIRT485330 MYO1D myosin ID 1 1
MIRT485590 FOXQ1 forkhead box Q1 1 1
MIRT486032 LPAR2 lysophosphatidic acid receptor 2 1 1
MIRT486760 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT489610 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT491663 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT491810 ZFYVE21 zinc finger, FYVE domain containing 21 1 4
MIRT492014 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT492042 TSG101 tumor susceptibility gene 101 1 2
MIRT492381 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT492781 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT493124 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 3
MIRT493342 LAPTM4A lysosomal protein transmembrane 4 alpha 1 6
MIRT493615 HMGB3 high mobility group box 3 1 3
MIRT494080 DUSP2 dual specificity phosphatase 2 1 2
MIRT494432 BTG2 BTG family, member 2 1 2
MIRT494539 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 4
MIRT496067 MORC1 MORC family CW-type zinc finger 1 1 1
MIRT498166 FEM1C fem-1 homolog c (C. elegans) 1 4
MIRT499909 KIAA1191 KIAA1191 1 2
MIRT500496 ZBTB4 zinc finger and BTB domain containing 4 1 3
MIRT500726 TRIM37 tripartite motif containing 37 1 1
MIRT500770 TMEM127 transmembrane protein 127 1 4
MIRT500871 SUCO SUN domain containing ossification factor 1 2
MIRT501469 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 4
MIRT502004 MAP7 microtubule-associated protein 7 1 4
MIRT502057 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 3
MIRT502374 GIGYF1 GRB10 interacting GYF protein 1 1 4
MIRT502407 GATA6 GATA binding protein 6 1 4
MIRT503078 C11orf30 chromosome 11 open reading frame 30 1 4
MIRT503215 ACER2 alkaline ceramidase 2 1 1
MIRT503564 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 2
MIRT503613 ZNF780A zinc finger protein 780A 1 1
MIRT503808 ZNF12 zinc finger protein 12 1 3
MIRT503832 TMEM242 transmembrane protein 242 1 2
MIRT503970 ZNF180 zinc finger protein 180 1 3
MIRT504101 C9orf40 chromosome 9 open reading frame 40 1 3
MIRT504569 ZNF417 zinc finger protein 417 1 3
MIRT504645 MFSD8 major facilitator superfamily domain containing 8 1 3
MIRT505064 ZNF202 zinc finger protein 202 1 3
MIRT505494 SRSF2 serine/arginine-rich splicing factor 2 1 2
MIRT505864 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT505983 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 2
MIRT506284 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT506377 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 3
MIRT506462 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506544 MORF4L1 mortality factor 4 like 1 1 4
MIRT506625 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506658 MAPK1 mitogen-activated protein kinase 1 1 2
MIRT506683 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506847 KIF23 kinesin family member 23 1 2
MIRT506875 KIAA1147 KIAA1147 1 1
MIRT506890 KIAA0101 KIAA0101 1 2
MIRT506994 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT507199 FZD9 frizzled family receptor 9 1 3
MIRT507368 FAM129A family with sequence similarity 129, member A 1 3
MIRT507441 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT507950 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT507962 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 3
MIRT508092 ANKRD52 ankyrin repeat domain 52 1 1
MIRT508579 CEP72 centrosomal protein 72kDa 1 2
MIRT508748 ZNF682 zinc finger protein 682 1 2
MIRT508840 GPR155 G protein-coupled receptor 155 1 1
MIRT509133 BMP8B bone morphogenetic protein 8b 1 3
MIRT509748 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT510032 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 2
MIRT510880 RAN RAN, member RAS oncogene family 1 4
MIRT511089 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 2
MIRT511266 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT511323 KIAA1551 KIAA1551 1 1
MIRT511559 HMGB1 high mobility group box 1 1 3
MIRT512325 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 3
MIRT513470 NARS asparaginyl-tRNA synthetase 1 3
MIRT513704 RBM20 RNA binding motif protein 20 1 2
MIRT513750 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT513991 CEP97 centrosomal protein 97kDa 1 1
MIRT514104 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 3
MIRT514140 SERF2 small EDRK-rich factor 2 1 1
MIRT514323 FXYD5 FXYD domain containing ion transport regulator 5 1 3
MIRT515001 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT515208 CRCP CGRP receptor component 1 1
MIRT515578 TMEM134 transmembrane protein 134 1 1
MIRT516063 MED18 mediator complex subunit 18 1 1
MIRT516373 GABPB1 GA binding protein transcription factor, beta subunit 1 1 1
MIRT516562 MIXL1 Mix paired-like homeobox 1 1
MIRT516802 PTRF polymerase I and transcript release factor 1 2
MIRT517024 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 1
MIRT517190 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT517263 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 2
MIRT518320 ZNF514 zinc finger protein 514 1 2
MIRT518471 KIF6 kinesin family member 6 1 1
MIRT518702 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1 1
MIRT518807 MED16 mediator complex subunit 16 1 2
MIRT518866 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT518975 GRK7 G protein-coupled receptor kinase 7 1 1
MIRT519435 KCNA7 potassium voltage-gated channel, shaker-related subfamily, member 7 1 2
MIRT519551 TMEM38A transmembrane protein 38A 1 1
MIRT519580 ZNFX1 zinc finger, NFX1-type containing 1 1 2
MIRT520085 YIPF4 Yip1 domain family, member 4 1 1
MIRT520159 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT521013 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521306 RRAGD Ras-related GTP binding D 1 2
MIRT521552 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT522175 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 2
MIRT522196 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT522509 MFN1 mitofusin 1 1 1
MIRT523086 HYPK huntingtin interacting protein K 1 1
MIRT523657 FOXK1 forkhead box K1 1 2
MIRT524086 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT524254 DCTN6 dynactin 6 1 1
MIRT524298 CYCS cytochrome c, somatic 1 1
MIRT524460 CNKSR3 CNKSR family member 3 1 1
MIRT524705 BTG3 BTG family, member 3 1 4
MIRT524982 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT525207 ZNF93 zinc finger protein 93 1 1
MIRT525491 TPK1 thiamin pyrophosphokinase 1 1 1
MIRT525767 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT526642 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT527209 XIRP2 xin actin-binding repeat containing 2 1 1
MIRT527262 TMEM196 transmembrane protein 196 1 1
MIRT527477 CLEC12B C-type lectin domain family 12, member B 1 2
MIRT528377 ZMYM1 zinc finger, MYM-type 1 1 2
MIRT530006 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 2
MIRT530594 ABHD15 abhydrolase domain containing 15 1 1
MIRT530992 EXO5 exonuclease 5 1 2
MIRT531482 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT531782 TXK TXK tyrosine kinase 1 2
MIRT531842 MTPAP mitochondrial poly(A) polymerase 1 2
MIRT532056 FHDC1 FH2 domain containing 1 1 1
MIRT532621 SPTLC2 serine palmitoyltransferase, long chain base subunit 2 1 1
MIRT532925 ZNF385A zinc finger protein 385A 1 1
MIRT533095 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT533884 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT534014 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT534570 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 2
MIRT534634 RNASEH1 ribonuclease H1 1 2
MIRT535036 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT536309 LIMA1 LIM domain and actin binding 1 1 2
MIRT536449 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT536500 KIAA0922 KIAA0922 1 1
MIRT536545 KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 1 1
MIRT537453 FBXL7 F-box and leucine-rich repeat protein 7 1 1
MIRT537737 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT538043 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT538719 CAPRIN2 caprin family member 2 1 2
MIRT539430 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT540281 FAM89A family with sequence similarity 89, member A 1 1
MIRT541094 RLIM ring finger protein, LIM domain interacting 1 1
MIRT541289 GLO1 glyoxalase I 1 1
MIRT542066 SLC25A46 solute carrier family 25, member 46 1 1
MIRT542148 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542274 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT543191 FICD FIC domain containing 1 1
MIRT543512 PLS1 plastin 1 1 1
MIRT543586 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544635 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT545209 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT546257 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT546300 TMEM200C transmembrane protein 200C 1 2
MIRT546699 RORA RAR-related orphan receptor A 1 2
MIRT546830 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT547088 PLRG1 pleiotropic regulator 1 1 1
MIRT547792 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT548320 EPHA4 EPH receptor A4 1 1
MIRT548398 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548470 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548825 CLIC4 chloride intracellular channel 4 1 2
MIRT548868 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT549111 C16orf70 chromosome 16 open reading frame 70 1 2
MIRT549258 ATXN1 ataxin 1 1 1
MIRT549326 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT549829 LUZP2 leucine zipper protein 2 1 1
MIRT550100 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT550311 ZNF681 zinc finger protein 681 1 1
MIRT551130 ZNF107 zinc finger protein 107 1 1
MIRT551751 FMNL2 formin-like 2 1 1
MIRT552211 F2RL3 coagulation factor II (thrombin) receptor-like 3 1 1
MIRT552692 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 2
MIRT552864 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552901 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553040 USP48 ubiquitin specific peptidase 48 1 1
MIRT553573 TMEM100 transmembrane protein 100 1 1
MIRT553710 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT554419 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT554481 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554538 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT554561 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 1
MIRT554757 RHOC ras homolog family member C 1 1
MIRT555471 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT556161 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT556189 MCC mutated in colorectal cancers 1 1
MIRT556599 LEPROT leptin receptor overlapping transcript 1 1
MIRT556911 ISOC1 isochorismatase domain containing 1 1 1
MIRT557031 HOXD11 homeobox D11 1 1
MIRT557599 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT557762 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT557891 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558273 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT558344 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 2
MIRT558782 CFL2 cofilin 2 (muscle) 1 1
MIRT558942 CBX1 chromobox homolog 1 1 1
MIRT559448 ARSJ arylsulfatase family, member J 1 1
MIRT561250 ZNF354B zinc finger protein 354B 1 1
MIRT562222 HMGB2 high mobility group box 2 1 1
MIRT562427 EFCAB14 KIAA0494 1 1
MIRT562561 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT562972 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT563386 DSPP dentin sialophosphoprotein 1 1
MIRT564690 ZNF35 zinc finger protein 35 1 1
MIRT564798 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT565702 SESN3 sestrin 3 1 1
MIRT565914 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT566148 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT566572 OTUD4 OTU domain containing 4 1 1
MIRT566883 LRP12 low density lipoprotein receptor-related protein 12 1 1
MIRT567060 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567120 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT567550 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567631 FAM210A family with sequence similarity 210, member A 1 1
MIRT567692 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT567851 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT567926 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT567999 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT568187 CCDC6 coiled-coil domain containing 6 1 1
MIRT568277 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT571685 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT571701 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT571731 RPL17-C18orf32 RPL17-C18orf32 readthrough 1 1
MIRT571870 NKIRAS1 NFKB inhibitor interacting Ras-like 1 1 1
MIRT572216 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT572683 AGMAT agmatine ureohydrolase (agmatinase) 1 2
MIRT573712 RBM12B RNA binding motif protein 12B 1 1
MIRT573923 SNAP47 synaptosomal-associated protein, 47kDa 1 1
MIRT574722 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT575221 Piwil2 piwi-like homolog 2 (Drosophila) 1 1
MIRT575996 Fem1a feminization 1 homolog a (C. elegans) 1 1
MIRT608375 PIWIL2 piwi-like 2 (Drosophila) 1 3
MIRT608755 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT608981 PRKCB protein kinase C, beta 1 1
MIRT611006 BRI3BP BRI3 binding protein 1 2
MIRT611843 FEM1A fem-1 homolog a (C. elegans) 1 2
MIRT612618 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT614270 WDR53 WD repeat domain 53 1 2
MIRT615183 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT615454 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT616179 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT616443 FAM126B family with sequence similarity 126, member B 1 1
MIRT619848 POLM polymerase (DNA directed), mu 1 2
MIRT620984 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT624432 CBX8 chromobox homolog 8 1 1
MIRT625086 C15orf41 chromosome 15 open reading frame 41 1 1
MIRT626045 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT626228 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626937 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT628572 MELK maternal embryonic leucine zipper kinase 1 1
MIRT633129 CBX5 chromobox homolog 5 1 1
MIRT634105 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634462 PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 1 1
MIRT634653 HIP1 huntingtin interacting protein 1 1 1
MIRT634962 GTF2H2C general transcription factor IIH, polypeptide 2C 1 2
MIRT640019 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT641713 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT641805 USP32 ubiquitin specific peptidase 32 1 1
MIRT645222 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT662414 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT664235 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT664401 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT664801 LIAS lipoic acid synthetase 1 2
MIRT673141 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT675846 DHODH dihydroorotate dehydrogenase (quinone) 1 2
MIRT677162 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT677268 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT678755 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT680381 GATAD1 GATA zinc finger domain containing 1 1 2
MIRT680708 ZNF785 zinc finger protein 785 1 1
MIRT680786 WDR73 WD repeat domain 73 1 1
MIRT681418 RMND1 required for meiotic nuclear division 1 homolog (S. cerevisiae) 1 1
MIRT681711 ABI2 abl-interactor 2 1 1
MIRT681848 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT682339 RAB42 RAB42, member RAS oncogene family 1 1
MIRT683337 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683407 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683511 ZNF7 zinc finger protein 7 1 1
MIRT683543 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT683894 OCIAD1 OCIA domain containing 1 1 1
MIRT683967 MYLK3 myosin light chain kinase 3 1 1
MIRT683996 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684099 TLR7 toll-like receptor 7 1 1
MIRT684152 CEP104 centrosomal protein 104kDa 1 1
MIRT684377 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT684593 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT684636 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT684667 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT684732 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT684761 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT684806 MYO1F myosin IF 1 1
MIRT684938 CD28 CD28 molecule 1 1
MIRT685214 DCTN5 dynactin 5 (p25) 1 1
MIRT685267 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685335 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT685370 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT685538 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685597 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT685728 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685761 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685802 ZNF426 zinc finger protein 426 1 1
MIRT685901 RTN2 reticulon 2 1 1
MIRT685974 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686125 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686175 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686302 WWC1 WW and C2 domain containing 1 1 1
MIRT686340 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686463 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686509 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686546 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT686601 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT686846 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT686899 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT686929 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT686999 SERINC1 serine incorporator 1 1 1
MIRT687063 RNF115 ring finger protein 115 1 1
MIRT687098 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687273 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687614 MANEAL mannosidase, endo-alpha-like 1 1
MIRT687669 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT687877 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT688002 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT688142 GEMIN8 gem (nuclear organelle) associated protein 8 1 1
MIRT688236 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT688294 FAM213A family with sequence similarity 213, member A 1 1
MIRT688476 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT688525 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688685 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT688718 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT688849 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT689131 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT689193 ZNF665 zinc finger protein 665 1 1
MIRT689818 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689863 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690758 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT691003 ZNF578 zinc finger protein 578 1 1
MIRT691095 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691352 KIAA1841 KIAA1841 1 1
MIRT691515 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT691597 CCDC125 coiled-coil domain containing 125 1 1
MIRT691633 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT692093 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692130 CXorf38 chromosome X open reading frame 38 1 2
MIRT692339 RFK riboflavin kinase 1 1
MIRT692401 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692462 METTL8 methyltransferase like 8 1 1
MIRT692565 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692626 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692807 SYNPO2L synaptopodin 2-like 1 1
MIRT692838 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT692900 RBM41 RNA binding motif protein 41 1 1
MIRT693010 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693160 THEM4 thioesterase superfamily member 4 1 1
MIRT693371 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694132 ZNF446 zinc finger protein 446 1 1
MIRT694216 ZNF347 zinc finger protein 347 1 1
MIRT694682 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694836 STX4 syntaxin 4 1 1
MIRT694958 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695202 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT695684 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695855 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695947 ZNF174 zinc finger protein 174 1 1
MIRT696205 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696466 SUGP1 SURP and G patch domain containing 1 1 1
MIRT696882 UBOX5 U-box domain containing 5 1 1
MIRT696929 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697268 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697413 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT698008 TSPAN6 tetraspanin 6 1 1
MIRT699293 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699338 SLC35F5 solute carrier family 35, member F5 1 2
MIRT699656 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699718 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT700067 RPL14 ribosomal protein L14 1 1
MIRT700125 RNF19B ring finger protein 19B 1 1
MIRT700445 PURB purine-rich element binding protein B 1 1
MIRT701133 PAPD5 PAP associated domain containing 5 1 1
MIRT701317 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701599 MYPN myopalladin 1 1
MIRT702398 KLF10 Kruppel-like factor 10 1 1
MIRT702548 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT703114 GPRIN3 GPRIN family member 3 1 1
MIRT704133 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704166 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704220 LDHD lactate dehydrogenase D 1 1
MIRT704786 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705107 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT705372 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT706128 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706298 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT706334 CCDC30 coiled-coil domain containing 30 1 1
MIRT706374 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706426 HAS2 hyaluronan synthase 2 1 1
MIRT706537 MTMR9 myotubularin related protein 9 1 1
MIRT707611 PCNXL2 pecanex-like 2 (Drosophila) 1 1
MIRT707840 TMEM133 transmembrane protein 133 1 1
MIRT708393 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708472 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT709095 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709560 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT710428 YTHDC1 YTH domain containing 1 1 1
MIRT711792 RFXAP regulatory factor X-associated protein 1 1
MIRT713357 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT714329 ZNF454 zinc finger protein 454 1 1
MIRT716563 GOLGA2 golgin A2 1 1
MIRT719094 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT725230 PEA15 phosphoprotein enriched in astrocytes 15 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*