Accession ID: MIRT001991 [miRNA, hsa-miR-96-5p :: ADCY6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-96LinkOut: [miRBase ]
Synonyms DFNA50, MIRN96, hsa-mir-96, miR-96, miRNA96, MIR96
Description Homo sapiens miR-96 stem-loop
Comment This sequence is localised to chromosome 7 and was named mir-96-7 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-96-5p
Mature Sequence 9| UUUGGCACUAGCACAUUUUUGCU |31
Evidence Experimental
Experiments Cloned
Putative hsa-miR-96-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ADCY6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AC6
Description adenylate cyclase 6
Transcript NM_015270    LinkOut: [ RefSeq ]
Other Transcripts NM_020983   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ADCY6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ADCY6
(miRNA target sites are highlighted)
>ADCY6|NM_015270|3'UTR
   1 CAGGGCCCAGCCACAAATTCAGCTGAAGGGACCAAGGTGGGCATTGAGTGGACTCTGTGCTCACTGGGTGGAGCTGTGGC
  81 AGGGGGCACTGAGCCTCCAGACCCTGCTAACCACAAAAGGGAACATCCCAGCAGGCTGTGCTTGGATCATGCTCGTCTGC
 161 CCTCAAGCTGGAAAACAAGGGGCTACCTACCGAGAGGATTATGCAAGTGACTTTCTTTCTTACTTGGGGTAGGGCTGTTC
 241 CCTCTCCAATCTTCCAGCCTTTGGGAGCAGGGGAGGGGTCAGTAGCAGAAGCAGAGGGAGGCCTCTTGCCTGAGGGATTA
 321 AAATGGCAGCTTGCCATGCCTACCCTTCCCTGTCTGTCTGGGCAGCAGGTTCAGGGCTGAGCCCTTCTTTTCCCTCTTTT
 401 TTCCTGGGAATATTTTGTACAATATTTTGTACAAAGACAGGCATGAGGAGTGCCTATTCCATGCTTGCCTTTGCAATACC
 481 TGCATCCCCAGCACTGGTCCTGGGCACTTCCCCACCCCAGCCAGGTGTCCCTCCTATGCACAGAGCAGAGGAGGGAGAAG
 561 CTCTGGGGAGCCAGCTTTGGCCATATTTCAGGAGAATGTTTCCATGTGCCAAATCTTAGTCCCATGATCTGTCCCCAAAG
 641 GGGAACAAAGGGACCTCTGACAGCTTAGATTTAGCCCCAGTTCCTGCACGCTCCAGGGAACGGGGTGTCTGGCCTCACTG
 721 GTACTGTGAAAAATGCTCAGAGAGCAAGCCTGTGTGTGGGGATGTCAGGTCAGGAGCTGGAAGTTCACCTGCAGGTGCCA
 801 AAGAGCAGGCCGGCCAGGGCTGGGGCAGTGCCAGACTCTGATCTGAGGACCCCGTCGGGGTCCAGATCAGGTCACTCTGC
 881 CCCAGTGCTCTCTTGCTGTCTGCTGACAAGGGGGCATGGAGCATCTCTTCCTCTTCTGTTGCCAAATAGAAAAGGGTCAG
 961 GGCATGGAGAAAGGTGACCCTGATCCCAAACCTGCCCTCCCAAGTCTCTGGTGTTGGGGAGGGCCCGTGTGTTTGTGTAA
1041 CTGTGTGTGCATGTTGGTCTTTGTGTGCATATCTGTTTTCCAGGTCTATGTGAGTCCTTGTGCTCCTGCTCCTCAGCTCT
1121 CCACCCCAGGTTGCCTCTCTCCTGTGGGCCTCTGTCTTCTGGGAATAAAGCAGGGTTTCCTACTTCAGGGGATGTAGAGA
1201 GATGCCCAGGTTGCACAGGAGTGGGATGGGGTGTGGTAGCAAAAGGAGGGAGAGGAGTCCTTTTTGTGCCAAATCCCTAA
1281 GTGCCGTTCGGGGGCCATGTGTGCAGCATGACTCTCCCTGTCTGTGGCAGGGACCCAAGCGCTTGCTTAAGCCCCAGTGC
1361 TCCATGCCAGCACTTGAACTGTCTGGGGTTTGATGGACAGAGGCTGAGGAATTTCCTGGCTTCCCCAGATAGTGTCCTGG
1441 GACATGGTATGCTTTGGGGCTGGGGTAGCATGGAATCCCTCTGAGGACCTGGATACTGGTACTACGGGGTGGGGAAGAGG
1521 AACCTTAAACTTGGCTTTCCCCAGCCTTCAGCCTGAGTCTAGCATGTTTCTAGCTCCCCAGTCCCTTGTGAAGCCTTGAG
1601 GGCTGGCAGAAGGGTTAGGAGGTTGAACTCTAGATTCCCTTCCTGTCTTTGCCTTCCTTTTACCCCTTTCCCTGCAACCT
1681 CCTTGACTCTGGCCTGAATTTGTTGGTGCCTCAGTTTCTCTGTCTGTACCTATTTAAGCCAAAGGCACTAGCCTGAATTT
1761 TGCTTGAAGATCACTTTGTCTTGGAAATGACTAGAGAGGCAGAGGAGAAGGGTTTCCAGAGTTGCTAGGTTTGGGAGTGG
1841 AAGGGGCAGGCAGTGCACTTGCCCCTCCTCATGCCCCTTCTGACACCAGCTCCCTGTGGAGGCCTGGTTTCTGGGTAATG
1921 CCTCCCTTGGGCATCTTCATGCATCAACCAAATGGGCCATCAGGTACTTCATTAGTCATGGCAGAAGGAGGGGAAAAGAC
2001 TTGTTTTCCAGACAGAAAATCTACTCCCCTGTCCCCAGCCATATCCCTGGATAGGAAGGGATAGGAAGAGACTACTTGGT
2081 GCCATGGGGTAGGGGTGAGGGTATAAGTAGATCAGAGTGGGAAGACCTCAGCCTTGGGTGGCTTGTCTCTGCTTCTTGCC
2161 AGGTGGGAGGGCCTGTCCACACCCTGGATCCCCGTACCACAGTGCCAGCCATGCCCTTCCCCTGGGCTACCATTGTCCCT
2241 TTCCTCACCCAGTTGGTAGAGGAGTCAGGAGGTGGGAGGCCGTGGGCTTTGGTTTTATAATGTAACCACTGTGGGGGTGG
2321 GGGAGGATGGTGAACCATGTATTTCAGTGAAATATTTAATATATTTAAATATCAATAAAATCAAACTCTTTGTAAAATT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucgUUUUUAC-ACGAU-CACGGUUu 5'
             :|:|||| | | | ||||||| 
Target 5' cagGAGAATGTTTCCATGTGCCAAa 3'
589 - 613 160.00 -15.00
2
miRNA  3' ucGUUUUUA----CACGAUCACGGUUu 5'
            :::||:|     ||| :||||||| 
Target 5' gcTGGAAGTTCACCTGCAGGTGCCAAa 3'
776 - 802 155.00 -14.40
3
miRNA  3' ucgUUUUUA-CACGAUCACGGUUu 5'
             |::|:|  | :| ||||||| 
Target 5' gagAGGAGTCCTTTTTGTGCCAAa 3'
1250 - 1273 152.00 -13.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-96-5p :: ADCY6    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions HEK293
Location of target site 3'UTR
Tools used in this research DIANA-microT , miRanda , TargetScan , PicTar
Original Description (Extracted from the article) ... miR-96 or miR-182 down-regulated luciferase activity by 75% ( 2%) and 61% ( 7%), respectively (Fig. 7C). Co-transfection with miR-96 plus miR-182 had the same effect as miR-96 alone (74 4% inhibition). These results strongly support the prediction of Adcy6 as a direct target of miR-96 and miR-182. ...

- Xu, S. Witmer, P. D. Lumayag, S. Kovacs, B. et al., 2007, J Biol Chem.

Article - Xu, S. Witmer, P. D. Lumayag, S. Kovacs, B. et al.
- J Biol Chem, 2007
Although microRNAs (miRNAs) provide a newly recognized level of regulation of gene expression, the miRNA transcriptome of the retina and the contributions of miRNAs to retinal development and function are largely unknown. To begin to understand the functions of miRNAs in retina, we compared miRNA expression profiles in adult mouse retina, brain, and heart by microarray analysis. Our results show that at least 78 miRNAs are expressed in adult mouse retina, 21 of which are potentially retina-specific. Among these, we identified a polycistronic, sensory organ-specific paralogous miRNA cluster that includes miR-96, miR-182, and miR-183 on mouse chromosome 6qA3 with conservation of synteny to human chromosome 7q32.2. In situ hybridization showed that members of this cluster are expressed in photoreceptors, retinal bipolar and amacrine cells. Consistent with their genomic organization, these miRNAs have a similar expression pattern during development with abundance increasing postnatally and peaking in adult retina. Target prediction and in vitro functional studies showed that MITF, a transcription factor required for the establishment and maintenance of retinal pigmented epithelium, is a direct target of miR-96 and miR-182. Additionally, to identify miRNAs potentially involved in circadian rhythm regulation of the retina, we performed miRNA expression profiling with retinal RNA harvested at noon (Zeitgeber time 5) and midnight (Zeitgeber time 17) and identified a subgroup of 12 miRNAs, including members of the miR-183/96/182 cluster with diurnal variation in expression pattern. Our results suggest that miR-96 and miR-182 are involved in circadian rhythm regulation, perhaps by modulating the expression of adenylyl cyclase VI (ADCY6).
LinkOut: [PMID: 17597072]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-96-5p :: ADCY6    [ Functional MTI ]
Validation Method Sequencing
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
191 hsa-miR-96-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001087 FOXO1 forkhead box O1 6 4
MIRT001989 MITF microphthalmia-associated transcription factor 2 1
MIRT001991 ADCY6 adenylate cyclase 6 3 2
MIRT002447 HTR1B 5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled 2 1
MIRT003144 Mitf microphthalmia-associated transcription factor 3 1
MIRT003414 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 5 1
MIRT004352 PRMT5 protein arginine methyltransferase 5 2 1
MIRT005450 FOXO3 forkhead box O3 4 1
MIRT005553 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 3
MIRT006779 REV1 REV1, polymerase (DNA directed) 3 1
MIRT006780 RAD51 RAD51 homolog (S. cerevisiae) 3 1
MIRT027869 CELSR2 cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) 1 1
MIRT027870 ODF2 outer dense fiber of sperm tails 2 1 1
MIRT027871 IRS1 insulin receptor substrate 1 1 1
MIRT027872 MYRIP myosin VIIA and Rab interacting protein 1 1
MIRT027873 RYK receptor-like tyrosine kinase 1 1
MIRT027874 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT027875 CDON Cdon homolog (mouse) 1 1
MIRT027876 MGST1 microsomal glutathione S-transferase 1 1 1
MIRT027877 SRXN1 sulfiredoxin 1 1 1
MIRT027878 SUPT4H1 suppressor of Ty 4 homolog 1 (S. cerevisiae) 1 1
MIRT027879 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 1
MIRT027880 ZC3H15 zinc finger CCCH-type containing 15 1 1
MIRT027881 ZYX zyxin 1 1
MIRT027882 ZMIZ1 zinc finger, MIZ-type containing 1 1 1
MIRT027883 JAZF1 JAZF zinc finger 1 1 1
MIRT027884 TRIM4 tripartite motif containing 4 1 1
MIRT027885 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT027886 POMP proteasome maturation protein 1 1
MIRT027887 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 1
MIRT027888 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT027889 SLAIN1 SLAIN motif family, member 1 1 1
MIRT027890 RPS29 ribosomal protein S29 1 1
MIRT027891 PON2 paraoxonase 2 1 1
MIRT027892 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT027893 SLC25A46 solute carrier family 25, member 46 1 1
MIRT027894 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT027895 BAG4 BCL2-associated athanogene 4 1 1
MIRT027896 TSPAN14 tetraspanin 14 1 1
MIRT027897 CHML choroideremia-like (Rab escort protein 2) 1 1
MIRT027898 REEP3 receptor accessory protein 3 1 1
MIRT027899 TWISTNB TWIST neighbor 1 1
MIRT027900 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT027901 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027902 NKIRAS2 NFKB inhibitor interacting Ras-like 2 1 1
MIRT027903 DDIT3 DNA-damage-inducible transcript 3 1 1
MIRT027904 RLF rearranged L-myc fusion 1 1
MIRT027905 MTHFD2L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like 1 1
MIRT027906 SYNGR2 synaptogyrin 2 1 1
MIRT027907 ADSS adenylosuccinate synthase 1 1
MIRT027908 PHF19 PHD finger protein 19 1 1
MIRT027909 SGK3 serum/glucocorticoid regulated kinase family, member 3 1 1
MIRT027910 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT027911 UBE2N ubiquitin-conjugating enzyme E2N 1 1
MIRT027912 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT027913 FBXO21 F-box protein 21 1 1
MIRT027914 ARHGEF2 Rho/Rac guanine nucleotide exchange factor (GEF) 2 1 1
MIRT027915 SPIN4 spindlin family, member 4 1 1
MIRT027916 CGGBP1 CGG triplet repeat binding protein 1 1 1
MIRT027917 PPP1R12A protein phosphatase 1, regulatory subunit 12A 1 2
MIRT027918 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT027919 TAOK1 TAO kinase 1 1 1
MIRT027920 EFNB2 ephrin-B2 1 1
MIRT027921 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT027922 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT027923 NHLRC3 NHL repeat containing 3 1 1
MIRT027924 SNX16 sorting nexin 16 1 1
MIRT027925 EVI5 ecotropic viral integration site 5 1 2
MIRT027926 PRDM16 PR domain containing 16 1 1
MIRT027927 HOXA9 homeobox A9 1 2
MIRT027928 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT027929 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT027930 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT027931 FAM171A1 family with sequence similarity 171, member A1 1 1
MIRT027932 MED1 mediator complex subunit 1 1 1
MIRT027933 CNNM3 cyclin M3 1 1
MIRT027934 PROK2 prokineticin 2 1 1
MIRT027935 ATXN1 ataxin 1 1 1
MIRT027936 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027937 PRKCE protein kinase C, epsilon 1 1
MIRT027938 SLC39A1 solute carrier family 39 (zinc transporter), member 1 1 1
MIRT035550 SCARB1 scavenger receptor class B, member 1 1 1
MIRT048714 FAM105B family with sequence similarity 105, member B 1 1
MIRT048715 SNX7 sorting nexin 7 1 1
MIRT048716 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048717 PAPD5 PAP associated domain containing 5 1 1
MIRT048718 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT048719 THAP9 THAP domain containing 9 1 1
MIRT048720 MOXD1 monooxygenase, DBH-like 1 1 1
MIRT048721 ITPR3 inositol 1,4,5-trisphosphate receptor, type 3 1 1
MIRT048722 ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 1 1
MIRT048723 ADNP2 ADNP homeobox 2 1 1
MIRT048724 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT048725 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT048726 FLII flightless I homolog (Drosophila) 1 1
MIRT048727 PMS2 PMS2 postmeiotic segregation increased 2 (S. cerevisiae) 1 1
MIRT048728 TMPO thymopoietin 1 1
MIRT048729 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT048730 SMIM12 chromosome 1 open reading frame 212 1 1
MIRT048731 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 1
MIRT048732 DEK DEK oncogene 1 1
MIRT048733 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT048734 YTHDC2 YTH domain containing 2 1 1
MIRT048735 ACTN4 actinin, alpha 4 1 1
MIRT048736 TERF2 telomeric repeat binding factor 2 1 1
MIRT048737 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT048738 PAQR4 progestin and adipoQ receptor family member IV 1 1
MIRT053181 ALK anaplastic lymphoma receptor tyrosine kinase 3 1
MIRT053390 CCNG1 cyclin G1 1 1
MIRT053391 RAB35 RAB35, member RAS oncogene family 1 1
MIRT053392 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT053393 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT053394 ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 1 1
MIRT053395 PPP1R9B protein phosphatase 1, regulatory subunit 9B 1 1
MIRT053396 ATG7 autophagy related 7 1 1
MIRT053397 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT053398 CCND2 cyclin D2 1 1
MIRT053783 GSK3B glycogen synthase kinase 3 beta 4 1
MIRT054654 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT054656 SNAI2 snail homolog 2 (Drosophila) 3 1
MIRT054678 SLC1A1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 2 1
MIRT054679 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 2 1
MIRT078464 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT079298 NPTX1 neuronal pentraxin I 1 1
MIRT203592 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT257150 TMEM170B transmembrane protein 170B 1 1
MIRT282640 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT291999 SIN3B SIN3 transcription regulator homolog B (yeast) 1 1
MIRT437837 IARS isoleucyl-tRNA synthetase 1 1
MIRT438045 RECK reversion-inducing-cysteine-rich protein with kazal motifs 4 2
MIRT438129 TRIB3 tribbles homolog 3 (Drosophila) 2 1
MIRT438804 SYCP1 synaptonemal complex protein 1 1 1
MIRT452671 GPR156 G protein-coupled receptor 156 1 1
MIRT453461 PITPNM3 PITPNM family member 3 1 1
MIRT454765 STOML3 stomatin (EPB72)-like 3 1 1
MIRT462316 CWC25 CWC25 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT467855 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT468527 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT470490 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT477660 EFHD2 EF-hand domain family, member D2 1 1
MIRT479790 CCND1 cyclin D1 1 1
MIRT481283 ATXN1L ataxin 1-like 1 1
MIRT491594 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT500672 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT501010 SPPL2A signal peptide peptidase like 2A 1 2
MIRT501681 PFN1 profilin 1 1 4
MIRT501919 MBD4 methyl-CpG binding domain protein 4 1 2
MIRT502390 GATSL2 GATS protein-like 2 1 1
MIRT503221 ACER2 alkaline ceramidase 2 1 1
MIRT503540 RPL7L1 ribosomal protein L7-like 1 1 3
MIRT505703 SESN2 sestrin 2 1 1
MIRT509888 RPS23 ribosomal protein S23 1 2
MIRT525372 SYNM synemin, intermediate filament protein 1 1
MIRT529420 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT533377 UBE2D4 ubiquitin-conjugating enzyme E2D 4 (putative) 1 2
MIRT533469 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT533595 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT535082 PODXL podocalyxin-like 1 1
MIRT541183 MORF4L1 mortality factor 4 like 1 1 1
MIRT544139 PGK1 phosphoglycerate kinase 1 1 1
MIRT547915 HOXA5 homeobox A5 1 1
MIRT555926 NUP43 nucleoporin 43kDa 1 1
MIRT557240 CRAMP1L Crm, cramped-like (Drosophila) 1 1
MIRT557939 FAM73A family with sequence similarity 73, member A 1 1
MIRT558455 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT561177 TNFRSF10A tumor necrosis factor receptor superfamily, member 10a 1 1
MIRT562310 GINM1 glycoprotein integral membrane 1 1 1
MIRT566586 NUP50 nucleoporin 50kDa 1 1
MIRT573341 TUBD1 tubulin, delta 1 1 1
MIRT576270 Cd59a CD59a antigen 1 1
MIRT612971 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT614998 GABRB1 gamma-aminobutyric acid (GABA) A receptor, beta 1 1 1
MIRT622020 STK17B serine/threonine kinase 17b 1 1
MIRT640562 CPE carboxypeptidase E 1 1
MIRT642241 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT646584 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648861 ABCA6 ATP-binding cassette, sub-family A (ABC1), member 6 1 1
MIRT652226 TRAPPC3L BET3 like (S. cerevisiae) 1 1
MIRT655805 NOTCH2 notch 2 1 1
MIRT656982 KDM5A lysine (K)-specific demethylase 5A 1 1
MIRT658778 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT660466 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT668470 EXOSC2 exosome component 2 1 1
MIRT689954 ZNF185 zinc finger protein 185 (LIM domain) 1 1
MIRT690112 ZFAND1 zinc finger, AN1-type domain 1 1 1
MIRT697755 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT705941 ACY1 aminoacylase 1 1 1
MIRT705981 ABHD14A-ACY1 ABHD14A-ACY1 readthrough (non-protein coding) 1 1
MIRT723429 MIPOL1 mirror-image polydactyly 1 1 1
MIRT723490 WDR33 WD repeat domain 33 1 1
MIRT725556 CTSB cathepsin B 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*